mirror of
https://github.com/allaunthefox/Research-Stack.git
synced 2026-08-06 19:35:45 +00:00
468 lines
16 KiB
Python
468 lines
16 KiB
Python
#!/usr/bin/env python3
|
||
"""
|
||
Codon-Peptide Coupling Toy Run
|
||
|
||
This script couples:
|
||
- codon RL over synonymous choices
|
||
- codon → amino acid translation
|
||
- amino-acid-implied peptide expert field
|
||
- peptide scoring at the CDS level
|
||
|
||
Demonstrates the integration between CodonOTOM efficiency functional
|
||
and the PeptideMoE system at the peptide level.
|
||
"""
|
||
|
||
import numpy as np
|
||
import matplotlib.pyplot as plt
|
||
from typing import List, Tuple, Dict
|
||
from dataclasses import dataclass
|
||
from collections import defaultdict
|
||
|
||
# ============================================================================
|
||
# Genetic Code (Simplified)
|
||
# ============================================================================
|
||
|
||
# Simplified genetic code mapping (codon → amino acid)
|
||
GENETIC_CODE = {
|
||
# Phenylalanine (2-fold degenerate)
|
||
'UUU': 'F', 'UUC': 'F',
|
||
# Leucine (6-fold degenerate)
|
||
'UUA': 'L', 'UUG': 'L', 'CUU': 'L', 'CUC': 'L', 'CUA': 'L', 'CUG': 'L',
|
||
# Isoleucine (3-fold degenerate)
|
||
'AUU': 'I', 'AUC': 'I', 'AUA': 'I',
|
||
# Methionine (1-fold degenerate - start)
|
||
'AUG': 'M',
|
||
# Valine (4-fold degenerate)
|
||
'GUU': 'V', 'GUC': 'V', 'GUA': 'V', 'GUG': 'V',
|
||
# Serine (6-fold degenerate)
|
||
'UCU': 'S', 'UCC': 'S', 'UCA': 'S', 'UCG': 'S', 'AGU': 'S', 'AGC': 'S',
|
||
# Proline (4-fold degenerate)
|
||
'CCU': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P',
|
||
# Threonine (4-fold degenerate)
|
||
'ACU': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T',
|
||
# Alanine (4-fold degenerate)
|
||
'GCU': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A',
|
||
# Tyrosine (2-fold degenerate)
|
||
'UAU': 'Y', 'UAC': 'Y',
|
||
# Histidine (2-fold degenerate)
|
||
'CAU': 'H', 'CAC': 'H',
|
||
# Glutamine (2-fold degenerate)
|
||
'CAA': 'Q', 'CAG': 'Q',
|
||
# Asparagine (2-fold degenerate)
|
||
'AAU': 'N', 'AAC': 'N',
|
||
# Lysine (2-fold degenerate)
|
||
'AAA': 'K', 'AAG': 'K',
|
||
# Aspartic acid (2-fold degenerate)
|
||
'GAU': 'D', 'GAC': 'D',
|
||
# Glutamic acid (2-fold degenerate)
|
||
'GAA': 'E', 'GAG': 'E',
|
||
# Cysteine (2-fold degenerate)
|
||
'UGU': 'C', 'UGC': 'C',
|
||
# Tryptophan (1-fold degenerate)
|
||
'UGG': 'W',
|
||
# Arginine (6-fold degenerate)
|
||
'CGU': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R', 'AGA': 'R', 'AGG': 'R',
|
||
# Glycine (4-fold degenerate)
|
||
'GGU': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G',
|
||
# Stop codons (3-fold)
|
||
'UAA': '*', 'UAG': '*', 'UGA': '*'
|
||
}
|
||
|
||
# Degeneracy mapping (number of codons per amino acid)
|
||
DEGENERACY = {
|
||
'F': 2, 'L': 6, 'I': 3, 'M': 1, 'V': 4, 'S': 6, 'P': 4, 'T': 4, 'A': 4,
|
||
'Y': 2, 'H': 2, 'Q': 2, 'N': 2, 'K': 2, 'D': 2, 'E': 2, 'C': 2, 'W': 1,
|
||
'R': 6, 'G': 4, '*': 3
|
||
}
|
||
|
||
# ============================================================================
|
||
# Codon Efficiency Functional (CodonOTOM)
|
||
# ============================================================================
|
||
|
||
@dataclass
|
||
class CodonFeatures:
|
||
"""Local feature signals for a codon."""
|
||
rho: float # triplet consistency [0,1]
|
||
q: float # conservation [0,1]
|
||
tau: float # translation efficiency [0,1]
|
||
H: float # entropy [0,1]
|
||
eps: float # mutation penalty [0,1]
|
||
|
||
@dataclass
|
||
class CodonWeights:
|
||
"""Weight parameters for codon efficiency."""
|
||
w_rho: float
|
||
w_q: float
|
||
w_tau: float
|
||
w_H: float
|
||
w_eps: float
|
||
lambda_: float
|
||
C0: float
|
||
|
||
def phi_codon(w: CodonWeights, f: CodonFeatures, codon: str) -> float:
|
||
"""
|
||
Codon efficiency functional Φ_codon(c).
|
||
|
||
Φ_codon(c) = (w_ρ·ρ̂ + w_q·q̂ + w_τ·τ̂ - w_H·Ĥ - w_ε·ε̂) / (ln 64 + λ ln d(c) + C_0)
|
||
"""
|
||
aa = GENETIC_CODE.get(codon, 'X')
|
||
d = DEGENERACY.get(aa, 1)
|
||
|
||
numerator = (
|
||
w.w_rho * f.rho +
|
||
w.w_q * f.q +
|
||
w.w_tau * f.tau -
|
||
w.w_H * f.H -
|
||
w.w_eps * f.eps
|
||
)
|
||
|
||
denominator = np.log(64) + w.lambda_ * np.log(d) + w.C0
|
||
|
||
return numerator / denominator
|
||
|
||
# ============================================================================
|
||
# Peptide-Level Properties (Simplified PeptideMoE)
|
||
# ============================================================================
|
||
|
||
@dataclass
|
||
class PeptideState:
|
||
"""Simplified peptide state for toy run."""
|
||
sequence: str # amino acid sequence
|
||
structural_coherence: float # [0,1]
|
||
free_energy: float # kcal/mol
|
||
|
||
def peptide_efficiency(peptide: PeptideState, c0: float = 1.0) -> float:
|
||
"""
|
||
Peptide efficiency (simplified from PeptideMoE).
|
||
|
||
Φ_peptide = structural_coherence / (free_energy + c0)
|
||
"""
|
||
return peptide.structural_coherence / (peptide.free_energy + c0)
|
||
|
||
# ============================================================================
|
||
# Codon RL over Synonymous Choices
|
||
# ============================================================================
|
||
|
||
def get_synonymous_codons(codon: str) -> List[str]:
|
||
"""Get all synonymous codons for a given codon."""
|
||
aa = GENETIC_CODE.get(codon, 'X')
|
||
if aa == 'X':
|
||
return [codon]
|
||
return [c for c, a in GENETIC_CODE.items() if a == aa]
|
||
|
||
def codon_rl_step(current_codon: str, w: CodonWeights, f: CodonFeatures) -> Tuple[str, float]:
|
||
"""
|
||
RL step: select best synonymous codon based on Φ_codon.
|
||
|
||
Returns: (best_codon, delta_efficiency)
|
||
"""
|
||
current_phi = phi_codon(w, f, current_codon)
|
||
|
||
synonymous = get_synonymous_codons(current_codon)
|
||
best_codon = current_codon
|
||
best_phi = current_phi
|
||
|
||
for codon in synonymous:
|
||
phi = phi_codon(w, f, codon)
|
||
if phi > best_phi:
|
||
best_codon = codon
|
||
best_phi = phi
|
||
|
||
delta_phi = best_phi - current_phi
|
||
return best_codon, delta_phi
|
||
|
||
# ============================================================================
|
||
# Amino Acid → Peptide Expert Field
|
||
# ============================================================================
|
||
|
||
def amino_acid_to_expert_field(aa: str) -> Dict[str, float]:
|
||
"""
|
||
Map amino acid to simplified expert field properties.
|
||
|
||
This represents the amino-acid-implied peptide expert field
|
||
that influences peptide-level properties.
|
||
"""
|
||
# Simplified physicochemical properties
|
||
properties = {
|
||
'hydrophobicity': 0.0,
|
||
'charge': 0.0,
|
||
'size': 0.0,
|
||
'flexibility': 0.0
|
||
}
|
||
|
||
# Hydrophobicity (Kyte-Doolittle scale, normalized)
|
||
hydrophobicity = {
|
||
'I': 0.9, 'V': 0.8, 'L': 0.8, 'F': 0.7, 'C': 0.6,
|
||
'M': 0.5, 'A': 0.4, 'G': 0.3, 'T': 0.2, 'S': 0.2,
|
||
'W': 0.2, 'Y': 0.1, 'P': 0.0, 'H': 0.0, 'E': -0.1,
|
||
'Q': -0.1, 'D': -0.2, 'N': -0.2, 'K': -0.3, 'R': -0.3
|
||
}
|
||
|
||
# Charge at pH 7
|
||
charge = {
|
||
'R': 1.0, 'K': 1.0, 'H': 0.5, 'D': -1.0, 'E': -1.0,
|
||
'C': 0.0, 'M': 0.0, 'F': 0.0, 'I': 0.0, 'L': 0.0,
|
||
'V': 0.0, 'W': 0.0, 'Y': 0.0, 'A': 0.0, 'G': 0.0,
|
||
'T': 0.0, 'S': 0.0, 'P': 0.0, 'Q': 0.0, 'N': 0.0
|
||
}
|
||
|
||
# Size (normalized)
|
||
size = {
|
||
'W': 1.0, 'R': 0.9, 'Y': 0.8, 'F': 0.8, 'K': 0.7,
|
||
'E': 0.7, 'Q': 0.7, 'M': 0.6, 'H': 0.6, 'L': 0.6,
|
||
'I': 0.6, 'D': 0.5, 'N': 0.5, 'T': 0.5, 'V': 0.5,
|
||
'S': 0.4, 'C': 0.4, 'A': 0.3, 'G': 0.2, 'P': 0.5
|
||
}
|
||
|
||
# Flexibility (normalized)
|
||
flexibility = {
|
||
'G': 1.0, 'S': 0.9, 'A': 0.8, 'P': 0.7, 'D': 0.6,
|
||
'N': 0.6, 'T': 0.5, 'K': 0.5, 'E': 0.5, 'Q': 0.5,
|
||
'R': 0.4, 'H': 0.4, 'M': 0.4, 'L': 0.4, 'I': 0.3,
|
||
'V': 0.3, 'F': 0.3, 'Y': 0.3, 'W': 0.2, 'C': 0.2
|
||
}
|
||
|
||
properties['hydrophobicity'] = hydrophobicity.get(aa, 0.0)
|
||
properties['charge'] = charge.get(aa, 0.0)
|
||
properties['size'] = size.get(aa, 0.0)
|
||
properties['flexibility'] = flexibility.get(aa, 0.0)
|
||
|
||
return properties
|
||
|
||
# ============================================================================
|
||
# CDS-Level Scoring
|
||
# ============================================================================
|
||
|
||
def cds_to_peptide(cds_sequence: str) -> str:
|
||
"""Translate CDS (codon sequence) to peptide."""
|
||
peptide = []
|
||
for i in range(0, len(cds_sequence), 3):
|
||
codon = cds_sequence[i:i+3]
|
||
aa = GENETIC_CODE.get(codon, 'X')
|
||
if aa == '*':
|
||
break # Stop codon
|
||
peptide.append(aa)
|
||
return ''.join(peptide)
|
||
|
||
def compute_peptide_properties(peptide: str) -> PeptideState:
|
||
"""
|
||
Compute peptide-level properties from amino acid sequence.
|
||
|
||
This aggregates the amino acid expert fields to produce
|
||
peptide-level structural_coherence and free_energy.
|
||
"""
|
||
if not peptide:
|
||
return PeptideState("", 0.0, 100.0)
|
||
|
||
# Aggregate amino acid properties
|
||
total_hydro = 0.0
|
||
total_charge = 0.0
|
||
total_size = 0.0
|
||
total_flex = 0.0
|
||
|
||
for aa in peptide:
|
||
props = amino_acid_to_expert_field(aa)
|
||
total_hydro += props['hydrophobicity']
|
||
total_charge += props['charge']
|
||
total_size += props['size']
|
||
total_flex += props['flexibility']
|
||
|
||
n = len(peptide)
|
||
avg_hydro = total_hydro / n
|
||
avg_charge = abs(total_charge) / n # Magnitude of charge
|
||
avg_size = total_size / n
|
||
avg_flex = total_flex / n
|
||
|
||
# Simplified peptide efficiency model
|
||
# Structural coherence: higher with balanced hydrophobicity and flexibility
|
||
structural_coherence = 0.5 * (1.0 - abs(avg_hydro)) + 0.3 * avg_flex + 0.2 * (1.0 - avg_charge)
|
||
structural_coherence = np.clip(structural_coherence, 0.0, 1.0)
|
||
|
||
# Free energy: higher with unbalanced properties
|
||
free_energy = 10.0 + 5.0 * abs(avg_hydro) + 3.0 * avg_charge + 2.0 * avg_size
|
||
|
||
return PeptideState(peptide, structural_coherence, free_energy)
|
||
|
||
# ============================================================================
|
||
# Toy Run
|
||
# ============================================================================
|
||
|
||
def run_toy_simulation():
|
||
"""Run toy simulation of codon RL coupling with peptide scoring."""
|
||
|
||
print("=" * 70)
|
||
print("CODON-PEPTIDE COUPLING TOY RUN")
|
||
print("=" * 70)
|
||
|
||
# Toy parameters
|
||
w = CodonWeights(
|
||
w_rho=0.3,
|
||
w_q=0.25,
|
||
w_tau=0.25,
|
||
w_H=0.1,
|
||
w_eps=0.1,
|
||
lambda_=0.5,
|
||
C0=1.0
|
||
)
|
||
|
||
# Initial CDS sequence (toy example)
|
||
initial_cds = "AUGUUUUAACUUUGGAAAUU" # MFLFGN (partial)
|
||
|
||
print(f"\nInitial CDS: {initial_cds}")
|
||
print(f"Initial peptide: {cds_to_peptide(initial_cds)}")
|
||
|
||
# Compute initial peptide properties
|
||
initial_peptide = compute_peptide_properties(cds_to_peptide(initial_cds))
|
||
initial_peptide_phi = peptide_efficiency(initial_peptide)
|
||
|
||
print(f"\nInitial peptide properties:")
|
||
print(f" Structural coherence: {initial_peptide.structural_coherence:.3f}")
|
||
print(f" Free energy: {initial_peptide.free_energy:.3f} kcal/mol")
|
||
print(f" Peptide efficiency: {initial_peptide_phi:.3f}")
|
||
|
||
# Codon RL optimization
|
||
print("\n" + "=" * 70)
|
||
print("CODON RL OPTIMIZATION")
|
||
print("=" * 70)
|
||
|
||
optimized_cds = initial_cds
|
||
total_delta_phi_codon = 0.0
|
||
|
||
for i in range(0, len(initial_cds), 3):
|
||
codon = initial_cds[i:i+3]
|
||
if len(codon) < 3:
|
||
break
|
||
|
||
# Toy features (would be computed from actual data)
|
||
f = CodonFeatures(
|
||
rho=0.7, # high triplet consistency
|
||
q=0.6, # moderate conservation
|
||
tau=0.8, # high translation efficiency
|
||
H=0.3, # low entropy
|
||
eps=0.1 # low mutation penalty
|
||
)
|
||
|
||
best_codon, delta_phi = codon_rl_step(codon, w, f)
|
||
|
||
if best_codon != codon:
|
||
print(f" Codon {i//3+1}: {codon} → {best_codon} (ΔΦ_codon = {delta_phi:+.4f})")
|
||
optimized_cds = optimized_cds[:i] + best_codon + optimized_cds[i+3:]
|
||
total_delta_phi_codon += delta_phi
|
||
else:
|
||
print(f" Codon {i//3+1}: {codon} (already optimal)")
|
||
|
||
print(f"\nTotal ΔΦ_codon improvement: {total_delta_phi_codon:+.4f}")
|
||
|
||
# Compute optimized peptide properties
|
||
optimized_peptide = compute_peptide_properties(cds_to_peptide(optimized_cds))
|
||
optimized_peptide_phi = peptide_efficiency(optimized_peptide)
|
||
|
||
print("\n" + "=" * 70)
|
||
print("OPTIMIZED PEPTIDE PROPERTIES")
|
||
print("=" * 70)
|
||
|
||
print(f"\nOptimized CDS: {optimized_cds}")
|
||
print(f"Optimized peptide: {cds_to_peptide(optimized_cds)}")
|
||
print(f"\nOptimized peptide properties:")
|
||
print(f" Structural coherence: {optimized_peptide.structural_coherence:.3f}")
|
||
print(f" Free energy: {optimized_peptide.free_energy:.3f} kcal/mol")
|
||
print(f" Peptide efficiency: {optimized_peptide_phi:.3f}")
|
||
|
||
# Compare
|
||
peptide_delta_phi = optimized_peptide_phi - initial_peptide_phi
|
||
|
||
print("\n" + "=" * 70)
|
||
print("SUMMARY")
|
||
print("=" * 70)
|
||
|
||
print(f"\nCodon-level improvement: ΔΦ_codon = {total_delta_phi_codon:+.4f}")
|
||
print(f"Peptide-level improvement: ΔΦ_peptide = {peptide_delta_phi:+.4f}")
|
||
|
||
if peptide_delta_phi > 0:
|
||
print(f"\n✅ Codon optimization improved peptide efficiency by {peptide_delta_phi:.2%}")
|
||
elif peptide_delta_phi < 0:
|
||
print(f"\n⚠️ Codon optimization decreased peptide efficiency by {abs(peptide_delta_phi):.2%}")
|
||
else:
|
||
print(f"\n→ Codon optimization had no effect on peptide efficiency")
|
||
|
||
return {
|
||
'initial_cds': initial_cds,
|
||
'optimized_cds': optimized_cds,
|
||
'initial_peptide_phi': initial_peptide_phi,
|
||
'optimized_peptide_phi': optimized_peptide_phi,
|
||
'codon_delta_phi': total_delta_phi_codon,
|
||
'peptide_delta_phi': peptide_delta_phi
|
||
}
|
||
|
||
def visualize_results(results: Dict):
|
||
"""Visualize the toy run results."""
|
||
|
||
fig, axes = plt.subplots(2, 2, figsize=(12, 10))
|
||
fig.suptitle('Codon-Peptide Coupling Toy Run Results', fontsize=16)
|
||
|
||
# Plot 1: Efficiency comparison
|
||
ax1 = axes[0, 0]
|
||
efficiencies = [results['initial_peptide_phi'], results['optimized_peptide_phi']]
|
||
labels = ['Initial', 'Optimized']
|
||
colors = ['lightcoral', 'lightblue']
|
||
ax1.bar(labels, efficiencies, color=colors)
|
||
ax1.set_ylabel('Peptide Efficiency Φ_peptide')
|
||
ax1.set_title('Peptide Efficiency Comparison')
|
||
ax1.set_ylim([0, max(efficiencies) * 1.2])
|
||
for i, v in enumerate(efficiencies):
|
||
ax1.text(i, v + 0.01, f'{v:.3f}', ha='center')
|
||
|
||
# Plot 2: Delta efficiency
|
||
ax2 = axes[0, 1]
|
||
deltas = [results['codon_delta_phi'], results['peptide_delta_phi']]
|
||
labels = ['Codon Level', 'Peptide Level']
|
||
colors = ['green' if d > 0 else 'red' for d in deltas]
|
||
ax2.bar(labels, deltas, color=colors)
|
||
ax2.set_ylabel('ΔΦ')
|
||
ax2.set_title('Efficiency Improvement')
|
||
ax2.axhline(y=0, color='black', linestyle='--', linewidth=0.5)
|
||
for i, v in enumerate(deltas):
|
||
ax2.text(i, v + (0.01 if v > 0 else -0.02), f'{v:+.4f}', ha='center')
|
||
|
||
# Plot 3: Codon optimization steps
|
||
ax3 = axes[1, 0]
|
||
initial_peptide = cds_to_peptide(results['initial_cds'])
|
||
optimized_peptide = cds_to_peptide(results['optimized_cds'])
|
||
|
||
# Show amino acid sequence
|
||
ax3.text(0.5, 0.7, f'Initial: {initial_peptide}', ha='center', fontsize=12,
|
||
bbox=dict(boxstyle='round', facecolor='lightcoral', alpha=0.5))
|
||
ax3.text(0.5, 0.3, f'Optimized: {optimized_peptide}', ha='center', fontsize=12,
|
||
bbox=dict(boxstyle='round', facecolor='lightblue', alpha=0.5))
|
||
ax3.set_xlim([0, 1])
|
||
ax3.set_ylim([0, 1])
|
||
ax3.axis('off')
|
||
ax3.set_title('Amino Acid Sequences')
|
||
|
||
# Plot 4: Coupling diagram
|
||
ax4 = axes[1, 1]
|
||
ax4.text(0.5, 0.8, 'Codon RL', ha='center', fontsize=10, fontweight='bold',
|
||
bbox=dict(boxstyle='round', facecolor='lightgreen', alpha=0.7))
|
||
ax4.text(0.5, 0.6, '↓', ha='center', fontsize=20)
|
||
ax4.text(0.5, 0.4, 'Codon → AA Translation', ha='center', fontsize=10, fontweight='bold',
|
||
bbox=dict(boxstyle='round', facecolor='lightyellow', alpha=0.7))
|
||
ax4.text(0.5, 0.2, '↓', ha='center', fontsize=20)
|
||
ax4.text(0.5, 0.0, 'Peptide Scoring', ha='center', fontsize=10, fontweight='bold',
|
||
bbox=dict(boxstyle='round', facecolor='lightblue', alpha=0.7))
|
||
ax4.set_xlim([0, 1])
|
||
ax4.set_ylim([-0.1, 0.9])
|
||
ax4.axis('off')
|
||
ax4.set_title('Coupling Flow')
|
||
|
||
plt.tight_layout()
|
||
|
||
# Save figure
|
||
output_file = '/home/allaun/Documents/Research Stack/data/codon_peptide_coupling_toy.png'
|
||
plt.savefig(output_file, dpi=150, bbox_inches='tight')
|
||
print(f"\nVisualization saved to: {output_file}")
|
||
|
||
plt.show()
|
||
|
||
if __name__ == "__main__":
|
||
results = run_toy_simulation()
|
||
visualize_results(results)
|