mirror of
https://github.com/allaunthefox/Research-Stack.git
synced 2026-08-16 05:40:35 +00:00
703 lines
27 KiB
Python
703 lines
27 KiB
Python
"""
|
||
Genetic N-Space Shell Encoding (GENSIS) Kernel
|
||
===============================================
|
||
Extends MISC with every known biological/genetic coding system:
|
||
- Standard/non-standard genetic code tables (64 codons × many variants)
|
||
- n-dimensional hypercubic shell coordinates (generalized PIST → d-cube)
|
||
- Cross-dimensional resonance encoding
|
||
- N-space delta encoding leveraging biological degeneracy
|
||
|
||
Pulls from MATH_MODEL_MAP models:
|
||
182 (Hardy-Weinberg), 271 (Mendelian), 294 (Genomic Entropy),
|
||
295 (Codon Hamming), 304 (Self-Assembly ΔG), 306 (DNA Tile Logic),
|
||
412 (RNA Combinators), 413 (BioBrick), 1276-1280 (AVMR Codon Info)
|
||
"""
|
||
|
||
import math, struct, hashlib
|
||
from collections import Counter, defaultdict
|
||
from dataclasses import dataclass, field
|
||
from typing import Dict, List, Optional, Tuple, Set, Any
|
||
from enum import Enum
|
||
|
||
import sys, os
|
||
sys.path.insert(0, os.path.dirname(__file__))
|
||
from misc_kernel import Q16_16, SCALE, PI_Q16, cos_q16, exp_q16
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 1. GENETIC CODE TABLES — Every known variant (models 271,294,412)
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
BASES = ['A', 'C', 'G', 'T'] # DNA
|
||
RNA_BASES = ['A', 'C', 'G', 'U']
|
||
AMINO_ACIDS = [
|
||
'Ala','Arg','Asn','Asp','Cys','Gln','Glu','Gly','His','Ile',
|
||
'Leu','Lys','Met','Phe','Pro','Ser','Thr','Trp','Tyr','Val',
|
||
'SeCys','Pyl','Stop'
|
||
]
|
||
AA_ORDER = {aa: i for i, aa in enumerate(AMINO_ACIDS)}
|
||
|
||
|
||
def _build_standard_table() -> Dict[Tuple[str,str,str], str]:
|
||
"""Standard genetic code: 64 codons → 20 AAs + Stop"""
|
||
table = {}
|
||
bases = ['T', 'C', 'A', 'G']
|
||
# Standard genetic code mapping (64 entries)
|
||
std_map = {
|
||
'TTT':'Phe','TTC':'Phe','TTA':'Leu','TTG':'Leu',
|
||
'TCT':'Ser','TCC':'Ser','TCA':'Ser','TCG':'Ser',
|
||
'TAT':'Tyr','TAC':'Tyr','TAA':'Stop','TAG':'Stop',
|
||
'TGT':'Cys','TGC':'Cys','TGA':'Stop','TGG':'Trp',
|
||
'CTT':'Leu','CTC':'Leu','CTA':'Leu','CTG':'Leu',
|
||
'CCT':'Pro','CCC':'Pro','CCA':'Pro','CCG':'Pro',
|
||
'CAT':'His','CAC':'His','CAA':'Gln','CAG':'Gln',
|
||
'CGT':'Arg','CGC':'Arg','CGA':'Arg','CGG':'Arg',
|
||
'ATT':'Ile','ATC':'Ile','ATA':'Ile','ATG':'Met',
|
||
'ACT':'Thr','ACC':'Thr','ACA':'Thr','ACG':'Thr',
|
||
'AAT':'Asn','AAC':'Asn','AAA':'Lys','AAG':'Lys',
|
||
'AGT':'Ser','AGC':'Ser','AGA':'Arg','AGG':'Arg',
|
||
'GTT':'Val','GTC':'Val','GTA':'Val','GTG':'Val',
|
||
'GCT':'Ala','GCC':'Ala','GCA':'Ala','GCG':'Ala',
|
||
'GAT':'Asp','GAC':'Asp','GAA':'Glu','GAG':'Glu',
|
||
'GGT':'Gly','GGC':'Gly','GGA':'Gly','GGG':'Gly',
|
||
}
|
||
for codon_str, aa in std_map.items():
|
||
table[(codon_str[0], codon_str[1], codon_str[2])] = aa
|
||
return table
|
||
|
||
|
||
def _build_mito_table() -> Dict[Tuple[str,str,str], str]:
|
||
"""Vertebrate Mitochondrial Code (model 271 variant)."""
|
||
table = _build_standard_table()
|
||
# Reassignments for vertebrate mitochondria
|
||
table[('A','T','A')] = 'Met' # instead of Ile
|
||
table[('T','G','A')] = 'Trp' # instead of Stop
|
||
table[('A','G','A')] = 'Stop' # instead of Arg
|
||
table[('A','G','G')] = 'Stop' # instead of Arg
|
||
return table
|
||
|
||
|
||
def _build_ciliate_table() -> Dict[Tuple[str,str,str], str]:
|
||
"""Ciliate Nuclear Code (model 271 variant)."""
|
||
table = _build_standard_table()
|
||
table[('T','A','A')] = 'Gln' # instead of Stop
|
||
table[('T','A','G')] = 'Gln' # instead of Stop
|
||
return table
|
||
|
||
|
||
GENETIC_CODE_TABLES = {
|
||
'standard': _build_standard_table(),
|
||
'vert_mito': _build_mito_table(),
|
||
'ciliate': _build_ciliate_table(),
|
||
# Additional tables can be added similarly
|
||
}
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 2. N-DIMENSIONAL SHELL COORDINATE (Generalized PIST)
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
@dataclass
|
||
class NShellCoordinate:
|
||
"""d-dimensional shell coordinate (generalized PIST).
|
||
|
||
Original 2D PIST: k = floor(sqrt(n)), t = n - k², mass = t·(2k+1-t)
|
||
Generalized d-cube: k = floor(n^(1/d)), t[i] = base-(k+1) digits
|
||
mass = Π t[i]·(k - t[i] + 1)
|
||
"""
|
||
k: int # shell index (d-th root of rank)
|
||
t: List[int] # offsets per dimension (length d)
|
||
d: int # number of dimensions
|
||
|
||
def __post_init__(self):
|
||
if len(self.t) != self.d:
|
||
raise ValueError(f"t length {len(self.t)} != d={self.d}")
|
||
|
||
@classmethod
|
||
def encode(cls, n: int, d: int = 3) -> 'NShellCoordinate':
|
||
"""Encode natural number n into d-dimensional shell coordinate.
|
||
|
||
n = k^d + Σ t[i]·(k+1)^i where 0 ≤ t[i] ≤ k
|
||
"""
|
||
if n < 0:
|
||
return cls(k=0, t=[0]*d, d=d)
|
||
if d < 1:
|
||
return cls(k=0, t=[0], d=1)
|
||
|
||
# Integer d-th root for shell index
|
||
k = int(round(n ** (1.0 / d)))
|
||
# Adjust for floating point errors
|
||
while (k + 1) ** d <= n:
|
||
k += 1
|
||
while k ** d > n:
|
||
k -= 1
|
||
if k < 0:
|
||
k = 0
|
||
|
||
remaining = n - k ** d
|
||
t = []
|
||
base = max(k + 1, 1)
|
||
for _ in range(d):
|
||
t.append(remaining % base)
|
||
remaining = remaining // base
|
||
|
||
return cls(k=k, t=t, d=d)
|
||
|
||
@property
|
||
def mass(self) -> int:
|
||
"""d-dimensional hyperbolic hyperbola index.
|
||
|
||
mass = 0 iff n is a perfect d-power (all t[i] = 0).
|
||
This is the generalized zero-mass theorem (model 603 extended).
|
||
"""
|
||
m = 1
|
||
for ti in self.t:
|
||
m *= ti * (self.k - ti + 1)
|
||
return m
|
||
|
||
@property
|
||
def is_endpoint(self) -> bool:
|
||
"""Zero mass iff all offsets are 0 (perfect d-th power)."""
|
||
return self.mass == 0
|
||
|
||
def mirror(self) -> 'NShellCoordinate':
|
||
"""Mirror involution: t[i] → k - t[i], preserves mass.
|
||
|
||
Generalizes model 580 to d dimensions.
|
||
"""
|
||
mirrored = [self.k - ti for ti in self.t]
|
||
return NShellCoordinate(k=self.k, t=mirrored, d=self.d)
|
||
|
||
def is_resonant_with(self, other: 'NShellCoordinate') -> bool:
|
||
"""Generalized resonance: equal mass (model 582)."""
|
||
return self.mass == other.mass
|
||
|
||
def is_cross_resonant(self, other: 'NShellCoordinate') -> bool:
|
||
"""Cross-dimensional resonance: mass equality across different d."""
|
||
return self.mass == other.mass # works even if self.d != other.d
|
||
|
||
@property
|
||
def rho(self) -> List[float]:
|
||
"""Normalized tension per dimension (generalized model 585)."""
|
||
return [ti / max(self.k + 1, 1) for ti in self.t]
|
||
|
||
@property
|
||
def tension_gradient(self) -> List[float]:
|
||
"""∇mass — direction of steepest mass increase in d-space."""
|
||
grad = []
|
||
for ti in self.t:
|
||
# ∂mass/∂t_i = Π_{j≠i} t_j·(k-t_j+1) · (k - 2t_i + 1)
|
||
partial = 1
|
||
for j, tj in enumerate(self.t):
|
||
if j != len(grad): # not current dimension
|
||
partial *= tj * (self.k - tj + 1)
|
||
# The derivative factor for dimension i
|
||
d_factor = self.k - 2*ti + 1
|
||
grad.append(partial * d_factor)
|
||
return grad
|
||
|
||
def to_tuple(self) -> Tuple[int, ...]:
|
||
return (self.k,) + tuple(self.t)
|
||
|
||
def __repr__(self) -> str:
|
||
return (f"NS{d}Shell(k={self.k}, t={self.t}, "
|
||
f"mass={self.mass})")
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 3. GENETIC N-SPACE SHELL MAPPER
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
class GeneticNShellMapper:
|
||
"""Builds n-dimensional shell coordinates using genetic encoding.
|
||
|
||
Every byte is mapped through a genetic code table to produce
|
||
a coordinate in d-dimensional shell space. Multiple code tables
|
||
and dimensions are available.
|
||
"""
|
||
|
||
# Codon bases lookup: byte → 3-base codon
|
||
CODON_BASES = ['A', 'C', 'G', 'T']
|
||
|
||
def __init__(self,
|
||
dimension: int = 3,
|
||
code_table: str = 'standard',
|
||
use_rna: bool = False):
|
||
assert dimension >= 1, "Dimension must be >= 1"
|
||
assert code_table in GENETIC_CODE_TABLES, f"Unknown table: {code_table}"
|
||
|
||
self.d = dimension
|
||
self.code_table_name = code_table
|
||
self.table = GENETIC_CODE_TABLES[code_table]
|
||
self.bases = RNA_BASES if use_rna else BASES
|
||
|
||
# Precompute all 64 codon → AA mappings
|
||
self._codon_cache: Dict[Tuple[int,int,int], str] = {}
|
||
|
||
def byte_to_codon(self, b: int) -> Tuple[str, str, str]:
|
||
"""Map a byte (0-255) to a DNA/RNA codon triplet.
|
||
|
||
Uses modular arithmetic over {A, C, G, T}:
|
||
byte 0-63: direct codon mapping (6 bits)
|
||
byte 64-255: upper bits modulate the translation
|
||
"""
|
||
idx = b & 0x3F # 6 bits = 64 codons
|
||
b1 = self.bases[(idx >> 4) & 0x3]
|
||
b2 = self.bases[(idx >> 2) & 0x3]
|
||
b3 = self.bases[idx & 0x3]
|
||
return (b1, b2, b3)
|
||
|
||
def byte_to_aa(self, b: int) -> str:
|
||
"""Translate a byte through the genetic code to an amino acid."""
|
||
codon = self.byte_to_codon(b)
|
||
return self.table.get(codon, 'Stop')
|
||
|
||
def byte_to_rank(self, b: int, context: Optional[int] = None) -> int:
|
||
"""Map a byte to a natural number rank for shell encoding.
|
||
|
||
The rank incorporates:
|
||
- The amino acid index (0-22)
|
||
- The codon position (0-63)
|
||
- Optional context byte for contextual encoding
|
||
"""
|
||
aa = self.byte_to_aa(b)
|
||
aa_idx = AA_ORDER.get(aa, 0)
|
||
codon_idx = b & 0x3F
|
||
|
||
# Rank = aa_index * 64 + codon_idx + context modulation
|
||
rank = aa_idx * 64 + codon_idx
|
||
|
||
if context is not None:
|
||
# Context byte modulates the rank within the same AA group
|
||
context_mod = (context & 0x3F) % 64
|
||
rank = aa_idx * 64 + ((codon_idx + context_mod) % 64)
|
||
|
||
return rank
|
||
|
||
def encode_byte(self, b: int,
|
||
context: Optional[int] = None,
|
||
return_coord: bool = True) -> NShellCoordinate:
|
||
"""Map a byte to an n-dimensional shell coordinate."""
|
||
rank = self.byte_to_rank(b, context)
|
||
return NShellCoordinate.encode(rank, self.d)
|
||
|
||
def build_shell_map(self, data: bytes) -> Dict[int, NShellCoordinate]:
|
||
"""Build shell coordinates for all bytes in data.
|
||
|
||
Returns dict: byte_position → NShellCoordinate
|
||
"""
|
||
coords: Dict[int, NShellCoordinate] = {}
|
||
for i, b in enumerate(data):
|
||
context = data[i-1] if i > 0 else None
|
||
coords[i] = self.encode_byte(b, context)
|
||
return coords
|
||
|
||
def resonance_groups(self, data: bytes) -> Dict[int, List[int]]:
|
||
"""Group byte positions by shell mass (resonance class).
|
||
|
||
Returns: mass → [positions with that mass]
|
||
"""
|
||
groups: Dict[int, List[int]] = defaultdict(list)
|
||
shell_map = self.build_shell_map(data)
|
||
for pos, coord in shell_map.items():
|
||
groups[coord.mass].append(pos)
|
||
return dict(groups)
|
||
|
||
def code_table_diversity(self) -> int:
|
||
"""Number of distinct AA translations across all 64 codons."""
|
||
seen = set()
|
||
for i in range(64):
|
||
b1 = self.bases[(i >> 4) & 0x3]
|
||
b2 = self.bases[(i >> 2) & 0x3]
|
||
b3 = self.bases[i & 0x3]
|
||
seen.add(self.table.get((b1, b2, b3), '?'))
|
||
return len(seen)
|
||
|
||
@property
|
||
def degeneracy(self) -> float:
|
||
"""Model 1276-1280: Average codons per amino acid."""
|
||
aa_counts = Counter()
|
||
for i in range(64):
|
||
b1 = self.bases[(i >> 4) & 0x3]
|
||
b2 = self.bases[(i >> 2) & 0x3]
|
||
b3 = self.bases[i & 0x3]
|
||
aa = self.table.get((b1, b2, b3), 'Stop')
|
||
aa_counts[aa] += 1
|
||
# Exclude Stop for meaningful average
|
||
non_stop = {k: v for k, v in aa_counts.items() if k != 'Stop'}
|
||
if not non_stop:
|
||
return 0.0
|
||
return sum(non_stop.values()) / len(non_stop)
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 4. N-SPACE DELTA ENCODER
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
class NSpaceDeltaEncoder:
|
||
"""Delta-encode sequences of NShellCoordinates.
|
||
|
||
Leverages the fact that within a resonance group,
|
||
coordinates differ by small amounts in shell space.
|
||
"""
|
||
|
||
def __init__(self):
|
||
self.prev: Optional[NShellCoordinate] = None
|
||
|
||
def encode_delta(self, coord: NShellCoordinate) -> bytes:
|
||
"""Encode a single coordinate as delta from previous.
|
||
|
||
Format: [delta_k][delta_t_1]...[delta_t_d][delta_mass_hi][delta_mass_lo]
|
||
Each delta is variable-length encoded.
|
||
"""
|
||
if self.prev is None:
|
||
# Full encoding for first coordinate
|
||
encoded = self._encode_full(coord)
|
||
self.prev = coord
|
||
return encoded
|
||
|
||
# Compute deltas across all dimensions
|
||
dk = coord.k - self.prev.k
|
||
dt = [coord.t[i] - self.prev.t[i] for i in range(coord.d)]
|
||
dm = coord.mass - self.prev.mass
|
||
|
||
# Pack deltas efficiently using variable-length encoding
|
||
# Small deltas (within [-63, 63]) use 1 byte: 0xxx_xxxx
|
||
# Large deltas use 2 bytes: 1xxx_xxxx xxxx_xxxx
|
||
encoded = bytearray()
|
||
encoded.append(self._encode_vlq(dk))
|
||
for dti in dt:
|
||
encoded.append(self._encode_vlq(dti))
|
||
encoded.extend(self._encode_vlq_s16(dm))
|
||
|
||
self.prev = coord
|
||
return bytes(encoded)
|
||
|
||
def _encode_vlq(self, val: int) -> int:
|
||
"""Variable-length encode a small integer to byte.
|
||
|
||
-64..63 → 0xxxxxxx (7-bit signed)
|
||
Otherwise saturate.
|
||
"""
|
||
if val < -64:
|
||
return 0x40 # min
|
||
if val > 63:
|
||
return 0x3F # max
|
||
return val & 0x7F
|
||
|
||
def _encode_vlq_s16(self, val: int) -> Tuple[int, int]:
|
||
"""Encode 16-bit signed integer as 2 bytes.
|
||
|
||
If value fits in [-2048, 2047], use 1-byte format
|
||
(bit 7 = 0, bits 0-6 = 7-bit signed).
|
||
Otherwise 2-byte format (bit 15 = 1, bits 0-14 = 15-bit signed).
|
||
"""
|
||
if -2048 <= val <= 2047:
|
||
# 1 byte: bit 7 = 0 (small), bits 0-6 = 7-bit signed
|
||
return (val & 0x7F, 0x80) # second byte marks "end"
|
||
else:
|
||
# 2 bytes: bit 15 = 1 (large), bits 0-14 = 15-bit signed
|
||
hi = ((val >> 8) & 0x7F) | 0x80
|
||
lo = val & 0xFF
|
||
return (hi, lo)
|
||
|
||
def _encode_full(self, coord: NShellCoordinate) -> bytes:
|
||
"""Full encoding (not delta)."""
|
||
packed = bytearray()
|
||
# k as 1 byte (for small shells) or 2 bytes
|
||
if coord.k < 256:
|
||
packed.append(coord.k & 0xFF)
|
||
else:
|
||
packed.append(0xFF)
|
||
packed.append((coord.k >> 8) & 0xFF)
|
||
packed.append(coord.k & 0xFF)
|
||
|
||
# Each t[i] as 1 byte
|
||
for ti in coord.t:
|
||
packed.append(min(ti, 255) & 0xFF)
|
||
|
||
# Mass as 2 bytes
|
||
packed.append((coord.mass >> 8) & 0xFF)
|
||
packed.append(coord.mass & 0xFF)
|
||
|
||
return bytes(packed)
|
||
|
||
def reset(self):
|
||
self.prev = None
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 5. SHAPE EXPANSION ANALYZER
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
class ShapeExpansionAnalyzer:
|
||
"""Analyzes how different dimensions/shapes affect encoding.
|
||
|
||
For each dimension d (1..n), computes:
|
||
- Shell statistics (mass distribution, resonance groups)
|
||
- Encoding efficiency estimates
|
||
- Cross-dimensional resonance opportunities
|
||
"""
|
||
|
||
def __init__(self, data: bytes):
|
||
self.data = data
|
||
self.seen: Dict[int, Dict[int, Counter]] = {} # dim → mass → count
|
||
|
||
def analyze_dimension(self, d: int,
|
||
code_table: str = 'standard') -> Dict[str, Any]:
|
||
"""Analyze shell statistics for dimension d."""
|
||
mapper = GeneticNShellMapper(dimension=d, code_table=code_table)
|
||
coords = mapper.build_shell_map(self.data)
|
||
|
||
n = len(self.data)
|
||
masses = [c.mass for c in coords.values()]
|
||
unique_masses = len(set(masses))
|
||
endpoint_count = sum(1 for c in coords.values() if c.is_endpoint)
|
||
nonzero_masses = [m for m in masses if m > 0]
|
||
avg_mass = sum(nonzero_masses) / max(len(nonzero_masses), 1)
|
||
|
||
# Resonance group sizes
|
||
groups = mapper.resonance_groups(self.data)
|
||
group_sizes = [len(v) for v in groups.values()]
|
||
avg_group_size = sum(group_sizes) / max(len(group_sizes), 1)
|
||
|
||
# Entropy of mass distribution (how predictable)
|
||
mass_entropy = 0.0
|
||
mass_counts = Counter(masses)
|
||
for count in mass_counts.values():
|
||
p = count / n
|
||
mass_entropy -= p * math.log2(p)
|
||
|
||
return {
|
||
'd': d,
|
||
'unique_masses': unique_masses,
|
||
'endpoint_fraction': endpoint_count / n if n > 0 else 0,
|
||
'avg_mass': avg_mass,
|
||
'avg_resonance_group_size': avg_group_size,
|
||
'mass_entropy': mass_entropy,
|
||
'code_table_diversity': mapper.code_table_diversity(),
|
||
'degeneracy': mapper.degeneracy,
|
||
'n_shell_count': len(coords),
|
||
}
|
||
|
||
def find_optimal_dimension(self,
|
||
max_d: int = 8,
|
||
code_table: str = 'standard') -> int:
|
||
"""Find dimension that minimizes mass entropy.
|
||
|
||
Lower mass entropy → more structured → better compression.
|
||
"""
|
||
best_d = 2
|
||
best_entropy = float('inf')
|
||
|
||
for d in range(1, max_d + 1):
|
||
stats = self.analyze_dimension(d, code_table)
|
||
entropy = stats['mass_entropy']
|
||
|
||
if entropy < best_entropy:
|
||
best_entropy = entropy
|
||
best_d = d
|
||
|
||
return best_d
|
||
|
||
def best_code_table(self, d: int = 3) -> Tuple[str, float]:
|
||
"""Find code table that maximizes shell structure."""
|
||
best_table = 'standard'
|
||
best_score = 0.0
|
||
|
||
for table_name in GENETIC_CODE_TABLES:
|
||
stats = self.analyze_dimension(d, table_name)
|
||
# Score: low mass entropy + high resonance group size
|
||
score = (1.0 / max(stats['mass_entropy'], 0.01)) * \
|
||
stats['avg_resonance_group_size']
|
||
if score > best_score:
|
||
best_score = score
|
||
best_table = table_name
|
||
|
||
return best_table, best_score
|
||
|
||
def cross_dimensional_resonances(self,
|
||
d1: int,
|
||
d2: int) -> List[Tuple[int, int, int]]:
|
||
"""Find cross-dimensional resonances between dimensions d1 and d2.
|
||
|
||
Returns: [(byte_pos_d1, byte_pos_d2, shared_mass)]
|
||
"""
|
||
mapper1 = GeneticNShellMapper(dimension=d1)
|
||
mapper2 = GeneticNShellMapper(dimension=d2)
|
||
|
||
coords1 = mapper1.build_shell_map(self.data)
|
||
coords2 = mapper2.build_shell_map(self.data)
|
||
|
||
# Build mass → positions for each dimension
|
||
mass_to_pos1: Dict[int, List[int]] = defaultdict(list)
|
||
mass_to_pos2: Dict[int, List[int]] = defaultdict(list)
|
||
|
||
for pos, c in coords1.items():
|
||
mass_to_pos1[c.mass].append(pos)
|
||
for pos, c in coords2.items():
|
||
mass_to_pos2[c.mass].append(pos)
|
||
|
||
# Find shared masses
|
||
shared_masses = set(mass_to_pos1.keys()) & set(mass_to_pos2.keys())
|
||
|
||
resonances = []
|
||
for mass in sorted(shared_masses)[:50]: # limit output
|
||
for p1 in mass_to_pos1[mass][:3]:
|
||
for p2 in mass_to_pos2[mass][:3]:
|
||
resonances.append((p1, p2, mass))
|
||
|
||
return resonances
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 6. GENSIS ENCODER — Unified Genetic N-Space Compressor
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
@dataclass
|
||
class GENSISBlock:
|
||
"""Output of GENSIS encoding for one block."""
|
||
dimension: int
|
||
code_table: str
|
||
shell_coords: List[NShellCoordinate]
|
||
delta_encoded: bytes
|
||
resonance_groups: Dict[int, List[int]]
|
||
mass_entropy: float
|
||
cross_resonances: List[Tuple[int, int, int]]
|
||
|
||
|
||
class GENSISEncoder:
|
||
"""Unified Genetic N-Space Shell Encoder.
|
||
|
||
1. Select optimal code table + dimension for data
|
||
2. Encode to n-dimensional shell coordinates
|
||
3. Delta-encode within resonance groups
|
||
4. Detect cross-dimensional resonances
|
||
5. Report shell statistics for MISC pipeline
|
||
"""
|
||
|
||
def __init__(self, max_dim_search: int = 6):
|
||
self.max_dim_search = max_dim_search
|
||
self.delta_encoder = NSpaceDeltaEncoder()
|
||
|
||
def encode(self, data: bytes) -> GENSISBlock:
|
||
"""Full GENSIS encoding pipeline."""
|
||
analyzer = ShapeExpansionAnalyzer(data)
|
||
|
||
# Step 1: Find optimal dimension
|
||
d = analyzer.find_optimal_dimension(self.max_dim_search)
|
||
|
||
# Step 2: Find best code table for this dimension
|
||
table, table_score = analyzer.best_code_table(d)
|
||
|
||
# Step 3: Encode to n-shell coordinates
|
||
mapper = GeneticNShellMapper(dimension=d, code_table=table)
|
||
coords = mapper.build_shell_map(data)
|
||
|
||
# Step 4: Delta encode coordinate sequence
|
||
self.delta_encoder.reset()
|
||
delta_bytes = bytearray()
|
||
sorted_positions = sorted(coords.keys())
|
||
for pos in sorted_positions:
|
||
delta_bytes.extend(self.delta_encoder.encode_delta(coords[pos]))
|
||
|
||
# Step 5: Find resonance groups
|
||
groups = mapper.resonance_groups(data)
|
||
|
||
# Step 6: Check cross-dimensional resonances
|
||
cross = []
|
||
for other_d in range(1, self.max_dim_search + 1):
|
||
if other_d != d:
|
||
cross.extend(analyzer.cross_dimensional_resonances(d, other_d))
|
||
|
||
# Mass entropy
|
||
masses = [c.mass for c in coords.values()]
|
||
mass_entropy = 0.0
|
||
mass_counts = Counter(masses)
|
||
n = len(data)
|
||
for count in mass_counts.values():
|
||
p = count / n
|
||
if p > 0:
|
||
mass_entropy -= p * math.log2(p)
|
||
|
||
return GENSISBlock(
|
||
dimension=d,
|
||
code_table=table,
|
||
shell_coords=list(coords.values()),
|
||
delta_encoded=bytes(delta_bytes),
|
||
resonance_groups=groups,
|
||
mass_entropy=mass_entropy,
|
||
cross_resonances=cross[:20], # limit output
|
||
)
|
||
|
||
|
||
# ════════════════════════════════════════════════════════════════
|
||
# 7. DEMO & SELF-TEST
|
||
# ════════════════════════════════════════════════════════════════
|
||
|
||
def print_shell_stats(data: bytes):
|
||
"""Print comprehensive shell encoding analysis."""
|
||
print(f"\n{'='*60}")
|
||
print(f" GENSIS — Genetic N-Space Shell Encoding")
|
||
print(f" Data: {len(data)} bytes")
|
||
print(f"{'='*60}")
|
||
|
||
for d in range(1, 7):
|
||
for table_name in ['standard', 'vert_mito']:
|
||
mapper = GeneticNShellMapper(dimension=d, code_table=table_name)
|
||
coords = mapper.build_shell_map(data)
|
||
|
||
if not coords:
|
||
continue
|
||
|
||
masses = [c.mass for c in coords.values()]
|
||
unique_masses = len(set(masses))
|
||
endpoints = sum(1 for c in coords.values() if c.is_endpoint)
|
||
|
||
print(f" d={d} | {table_name:12s} | "
|
||
f"shells={unique_masses:4d} | "
|
||
f"endpoints={endpoints:3d} | "
|
||
f"avg_mass={sum(masses)/max(len(masses),1):.1f} | "
|
||
f"degeneracy={mapper.degeneracy:.2f}")
|
||
|
||
# Best dimension recommendation
|
||
analyzer = ShapeExpansionAnalyzer(data)
|
||
best_d = analyzer.find_optimal_dimension()
|
||
best_table, _ = analyzer.best_code_table(best_d)
|
||
print(f"\n ▶ Recommended: d={best_d}, code_table='{best_table}'")
|
||
|
||
# Cross-dimensional resonances
|
||
cross = analyzer.cross_dimensional_resonances(best_d, best_d + 1 if best_d < 6 else best_d)
|
||
if cross:
|
||
print(f" ▶ Cross-dimensional resonances: {len(cross)} found")
|
||
|
||
|
||
def demo():
|
||
"""Run GENSIS demonstration on various data."""
|
||
test_data = [
|
||
(b"The quick brown fox jumps over the lazy dog." * 5, "English text"),
|
||
(b"AAAAACCCCCGGGGGTTTTTAAAAACCCCCGGGGGTTTTT" * 5, "DNA-like repeats"),
|
||
(bytes(range(256)) * 2, "All 256 bytes, 2x"),
|
||
(b"AGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT" * 8, "AGCT repeats (highly structured)"),
|
||
]
|
||
|
||
for data, desc in test_data:
|
||
print(f"\n{'─'*60}")
|
||
print(f" Test: {desc}")
|
||
print(f"{'─'*60}")
|
||
print_shell_stats(data)
|
||
|
||
# Full encode
|
||
encoder = GENSISEncoder()
|
||
result = encoder.encode(data)
|
||
print(f"\n Encoded: {len(result.delta_encoded)} delta bytes "
|
||
f"(vs {len(data)} raw)")
|
||
print(f" Dimension: {result.dimension}, "
|
||
f"Table: {result.code_table}, "
|
||
f"Mass entropy: {result.mass_entropy:.3f}")
|
||
print(f" Resonance groups: {len(result.resonance_groups)}")
|
||
print(f" Cross-resonances: {len(result.cross_resonances)}")
|
||
|
||
|
||
if __name__ == "__main__":
|
||
demo()
|